| 建库方案: |
Library preparation was performed as previously described with some minor modifications (Weng et al., 2017). About 300 ng of RNA in 3.2 L was combined with 0.25 L RNase inhibitor (NEB) and 1 L CDS primer (5 AAGCAGTGGTATCAACGCAGAGTACT30VN-3 in an 8-well PCR tube strip, heated to 70 C for 2 min, and immediately placed on ice. 5.55 L RT mix, containing 2 L of 5X SMARTScribe RT buffer (Takara), 0.5 L of 100 mM DTT (Millipore Sigma), 0.3 L of 200 mM MgCl2 (Thermo Fisher Scientific), 1 L of 10 mM dNTPs (Takara), 1 L of 10 M TSO primer (5 AAGCAGTGGTATCAACGCAGAGTACATrGrGrG-3 , 0.25 L of RNase inhibitor (NEB), and 0.5 L SMARTScribe reverse transcriptase (Takara) was added to the reaction. RT was performed under the following conditions: 42 C for 90 minutes, 10 cycles of 50 C for 2 minutes and 42 C for 2 minutes, 70 C for 15 minutes, and 4 C indefinitely. For cDNA amplification, 2 L of the RT reaction was combined with 2.5 L of 10X Advantage 2 buffer (Takara), 2.5 L of 2.5 mM dNTPs (Takara), 0.25 L of 10 M IS PCR primer (5 AAGCAGTGGTATCAACGCAGAGT-3 , 17.25 L nuclease free water (ThermoFisher), and 0.5 L Advantage 2 DNA Polymerase (Takara). Thermocycling conditions were as follows: 94 C for 3 minutes, 8 cycles of 94 C for 15 s, 65 C for 30 s, and 68 C for 6 minutes, 72 C for 10 minutes, and 4 C indefinitely. Amplified cDNA was purified using 0.8X AMPure XP beads (Beckman Coulter), eluted in 15 L nuclease-free water, and quantified using Qubit dsDNA HS assay kit (Thermo Fisher Scientific). cDNA was fragmented by combining 100 pg cDNA in 1 L nuclease free water, 2X TD buffer (20 mM Tris, pH 8.0; Thermo Fisher Scientific), 10 mM MgCl2, and 16% PEG 8000 (MilliporeSigma), and 0.5 L Tn5 (Lucigen). The mixture was heated to 55 C for 12 minutes, and the reaction was terminated upon the addition of 1.25 L of 0.2% SDS (Fisher) and incubated at room temperature for 10 minutes. Fragments were amplified by adding 16.75 L nuclease free water (Thermo Fisher Scientific), 1 L of 10 mM Nextera i7 primer, 1 L of 10 mM Nextera i5 primer, and 25 L KAPA HiFi hotstart readymix (EMSCO/FISHER). Thermocycling conditions were as follows: 72 C for 5 minutes, 95 C for 1 minute, 14 cycles of 95 C for 30 s, 55 C for 30 s, and 72 C for 30 s, 72 C for 1 minute, and 4 C indefinitely. DNA was purified twice with 0.8X AMPure XP beads (Beckman Coulter) and eluted in 10 L of 10 mM Tris, pH 8 (Thermo Fisher Scientific). Samples were quantified by qPCR (KAPA) and pooled at equal molar amounts. Final sequencing library fragment sizes were quantified by bioanalyzer (Agilent) with an average size of ~420 bp, and concentrations were determined by qPCR (KAPA). Samples were loaded at concentrations of 2.7 pM and sequenced on a NextSeq 550 (Illumina) using 1x72 bp reads to an average depth of 40 million reads per sample. |
