Library |
Library name |
Construction protocol |
Strategy |
Source |
Selection |
Layout |
OVX_103 |
DNA extraction and purification from feces were performed using a QIAamp Fast DNA Stool Mini Kit (Qiagen). The V4 hypervariable region of the bacterial 16S rRNA gene was amplified by using barcoded primers: (16SV4Fwd: AATGATACGGCGACCACCGA BARCODE TATGGTAATTGTGTGCCAGCMGCCGCGGTAA and 16SV4Rev: CAAGCAGAAGACGGCATACGAGAT BARCODE AGTCAGTCAGCCGGACTACHVGGGTWTCTAAT). KAPA HiFi poly- merase (Roche) was used. Individual PCR libraries were pooled, and then concentra- tion was measured on a Qubit fluorometer (ThermoFisher). The 16S rRNA v4 gene amplicon sequencing was performed by using a V2-500 cycle cartridge (Illumina) on the MiSeq platform (Illumina). |
AMPLICON |
GENOMIC |
PCR |
PAIRED
|
|