logo
Experiment information
Accession SRX25232128
Organism mouse gut metagenome
Title 16S of mouse: OVX_137
BioProject PRJNA1132548
BioSample SRS21918417
Platform Illumina MiSeq
Library
Library name Construction protocol Strategy Source Selection Layout
OVX_137 DNA extraction and purification from feces were performed using a QIAamp Fast DNA Stool Mini Kit (Qiagen). The V4 hypervariable region of the bacterial 16S rRNA gene was amplified by using barcoded primers: (16SV4Fwd: AATGATACGGCGACCACCGA BARCODE TATGGTAATTGTGTGCCAGCMGCCGCGGTAA and 16SV4Rev: CAAGCAGAAGACGGCATACGAGAT BARCODE AGTCAGTCAGCCGGACTACHVGGGTWTCTAAT). KAPA HiFi poly- merase (Roche) was used. Individual PCR libraries were pooled, and then concentra- tion was measured on a Qubit fluorometer (ThermoFisher). The 16S rRNA v4 gene amplicon sequencing was performed by using a V2-500 cycle cartridge (Illumina) on the MiSeq platform (Illumina). AMPLICON GENOMIC PCR PAIRED
Release date2024-07-08
Run
Run accession Release date Run data file information
SRR29730001 2024-07-08 SRR29730001.SRA
Data Source NCBI