ICG00004 Anthurium andraeanum - Internal Control Genes Database (ICG)

Home Species

Anthurium andraeanum

Accession: ICG00004

Latin Name: Anthurium andraeanum

Common Name: Tailflower, Flamingo flower

Taxonomy ID: 226677

Description: Anthurium andraeanum (Hort.) is an ornamental crop cultivated for its cut-flower, which is commercially second only to orchids among tropical flowers. The cut-flower consists of a protruding inflorescence called the spadix that is subtended by a modified leaf called the spathe. The spathe is usually brilliantly colored and heart-shaped and is the more attractive part of the cut-flower.

ICG00004-1

Cultivars

Tissues

Developmental Stages

Internal Control Genes

Gene Symbol	Gene Model	Application Scenario	Accession Number	Primers(5' - 3') (Forward/Reverse)	Size (bp)	Annealing Temperature	Detection
CYP	Cytochrome	Cultivar Effect Color Effect First Visible Cut-Flower Peduncle Elongates Fully Expanded Spathe Post-Harvested Fruit	JN602201	F: GGCAAGCCCCTCCACTACAA R: GCCCTGGCACATGAACTGGG	65	60	SYBR
UBQ5	Ubiquitin	Cultivar Effect Color Effect First Visible Cut-Flower Peduncle Elongates Fully Expanded Spathe Post-Harvested Fruit	JN602199	F: TCCGCATCCAGAAGTGGTAC R: TGCCGTCGTGGATCTCGTAG	72	60	SYBR

Molecular Types:

mRNA

Evaluation Methods

geNorm

NormFinder

Contact

Name: Pathmanathan Umaharan

Email: pumaharan@sta.uwi.edu

Institution: Department of Life Sciences, Faculty of Science and Technology, The University of the West Indies, St. Augustine Campus, College Road, Republic of Trinidad and Tobago

Basic Information

Gene Summary