ICG00015 Buglossoides arvensis - Internal Control Genes Database (ICG)

Home Species

Buglossoides arvensis

Accession: ICG00015

Latin Name: Buglossoides arvensis

Common Name: Field gromwell,Corn gromwell,Bastard alkanet, Ahiflower

Taxonomy ID: 181181

Description: Buglossoides arvensis (L.), a member of the plant family Boraginaceae, commonly referred to as corn grom-well, or more recently as Ahiflower, this weed plant has evoked high interest amongst researchers for its nutraceutical value. Ahiflower oil is a dietary oil rich in stearidonic acid (20% SDA; 18:4 n-3). The SDA-rich Ahiflower oil (45% ALA, 20% SDA) extracted from the seed of Buglossoides arvensis is more efficient than ALA-rich flaxseed oil (60% ALA) at increasing serum, erythrocyte, mononuclear cell and neutrophil EPA and docosapentaenoic acid (DPA, 22:5 n-3) contents.

ICG00015-1

Tissues

Growth Conditions

Temperature Conditions

Abiotic Stresses

Biotic Stresses

Bacterial Infection

Internal Control Genes

Gene Symbol	Gene Model	Application Scenario	Accession Number	Primers(5' - 3') (Forward/Reverse)	Size (bp)	Annealing Temperature	Detection
CAC	Clathrin Adaptor Complex	Leaf Stem Flower Seed Inoculation Treatment High Temperature Condition Low Temperature Condition P. Fluorescens Infection	KJ883539	F: TTGACTGTTTGGTTTGGAAGATAAGA R: TTCCACCTCAGCACTCAATGTAG	-	60	SYBR
A-tub	Tubulin	Leaf Stem Flower Seed Inoculation Treatment High Temperature Condition Low Temperature Condition P. Fluorescens Infection	KJ920355	F: CCTGAGAAACAAGCCTGTTGAGA R: CGCAAGTCCCTCGACATTG	-	60	SYBR

Molecular Types:

mRNA

Evaluation Methods

geNorm

NormFinder

Contact

Name: Martin Filion

Email: martin.filion@umoncton.ca

Institution: Department of Biology, Université de Moncton, 18 Antonine-Maillet Ave, Moncton, NB E1A 3E9 Canada.

Basic Information

Gene Summary