ICG00018 Capsicum annuum - Internal Control Genes Database (ICG)

Home Species

Capsicum annuum

Accession: ICG00018

Latin Name: Capsicum annuum

Common Name: Hot Pepper

Taxonomy ID: 4072

Description: Capsicum annuum L. belongs to the Solanaceae family, which is one of the largest families in the plant kingdom, and includes more than 3000 species. It is one of the most important spices used worldwide as a natural flavoring and coloring agent owing to its unique spicy and pungent taste and color. In addition, peppers are a rich source of nutrients and diverse bioactive compounds with potential health-promoting properties, such as capsaicinoids and antioxidant compounds.

ICG00018-1

Tissues

Abiotic Stresses

Hormone Treatments

Temperature Conditions

Internal Control Genes

Gene Symbol	Gene Model	Application Scenario	Accession Number	Primers(5' - 3') (Forward/Reverse)	Size (bp)	Annealing Temperature	Detection
b-TUB	Tubulin	Salinity Stress Polyethylene Glycol (Peg) Stress Salicylic Acid (Sa) Treatment Abscisic Acid (Aba) Treatment High Temperature Condition Low Temperature Condition	EF495259	F: GAGGGTGAGTGAGCAGTTC R: CTTCATCGTCATCTGCTGTC	167	55	SYBR
UBI-3	Ubiquitin	Salinity Stress Polyethylene Glycol (Peg) Stress Salicylic Acid (Sa) Treatment Abscisic Acid (Aba) Treatment High Temperature Condition Low Temperature Condition	AY486137	F: TGTCCATCTGCTCTCTGTTG R: CACCCCAAGCACAATAAGAC	204	55	SYBR
GAPDH	Glyceraldehyde-3-Phosphate Dehydrogenase	Leaf Stem Root	AJ246013	F: ATGATGATGTGAAAGCAGCG R: TTTCAACTGGTGGCTGCTAC	276	55	SYBR

Molecular Types:

mRNA

Evaluation Methods

geNorm

NormFinder

BestKeeper

Contact

Name: Yuejian Yang

Email: hzyyj@yahoo.com.cn

Institution: Institute of Vegetables, Zhejiang Academy of Agricultural Sciences, Hangzhou 310021, People's Republic of China.

Basic Information

Gene Summary