ICG00039 Cynodon dactylon - Internal Control Genes Database (ICG)

Home Species

Cynodon dactylon

Accession: ICG00039

Latin Name: Cynodon dactylon

Common Name: Vilfa stellata, D奴rv_ grass, Dhoob, Bermuda grass, Dubo, Dog's tooth grass, Bahama grass,

Taxonomy ID: 28909

Description: Cynodon dactylon, a perennial grass species, is an important turfgrass widely used in public parks, home lawns, golf courses and sports fields. In addition to turfgrass, it is also used as forage settings. It is abundant in China and widely distributed in tropical, subtropical and warm-temperate regions. It exhibits a wide range of genetic variability in stress tolerance, having superior drought and heat tolerance, but relatively poor salinity and cold tolerance.

ICG00039-1

Abiotic Stresses

Tissues

Temperature Conditions

Internal Control Genes

Gene Symbol	Gene Model	Application Scenario	Accession Number	Primers(5' - 3') (Forward/Reverse)	Size (bp)	Annealing Temperature	Detection
PP2A	Protein Phosphatase	Root Leaf Salinity Stress Drought Stress High Temperature Condition Low Temperature Condition	ES306101	F: ACTACTTCCCCTTGACGGC R: AAATACCCCAACCACATCG	183	60	TaqMan
CACS	Clathrin Adaptor Complex	Root Leaf Salinity Stress Drought Stress High Temperature Condition Low Temperature Condition	ES306283	F: TCCTGAAGGTTTGGGAGAAG R: AAATAACAGTTCCGAAGAGCC	129	60	TaqMan
EF1A	Elongation Factor	Root Leaf Drought Stress Low Temperature Condition	ES296122	F: TGTCCCTGTCGGTCGTGTT R: AGCCTCATGGTGCATCTCA	112	60	TaqMan
TIP41	Tonoplast Intrinsic Protein	Root Leaf Drought Stress Low Temperature Condition High Temperature Condition	ES303032	F: AATTGACCTTGTCGCTCTTTC R: GTCGGCATTACCCTCACTCT	126	60	TaqMan
UPL7	Ubiquitin	Leaf Low Temperature Condition	ES295712	F: CTACGGCAGCACAAACCATC R: TGTACAAACTCCCCGAAAGG	188	60	TaqMan
TUB	Tubulin	Leaf Low Temperature Condition	ES302563	F: AAGGACTACGAGGAGGTCGG R: ACTGGATAGCAGCGGCACA	120	60	TaqMan
GAPDH	Glyceraldehyde-3-Phosphate Dehydrogenase	Leaf Low Temperature Condition	ES302571	F: CCCTTCATCACCACCGACTA R: GAATCTCCTCTGGGTTCCTG	157	60	TaqMan

Molecular Types:

mRNA

Evaluation Methods

geNorm

NormFinder

BestKeeper

Contact

Name: Martin Filion

Email: martin.filion@umoncton.ca

Institution: Department of Biology, Université de Moncton, 18 Antonine-Maillet Ave, Moncton, NB E1A 3E9, Canada

Basic Information

Gene Summary