ICG00057 Humulus lupulus - Internal Control Genes Database (ICG)

Home Species

Humulus lupulus

Accession: ICG00057

Latin Name: Humulus lupulus

Common Name: Common hop, Hop

Taxonomy ID: 3486

Description: Humulus lupulus is a species of flowering plant in the Cannabaceae family, native to Europe, western Asia and North America. It is a dioecious, perennial, herbaceous climbing plant which sends up new shoots in early spring and dies back to a cold-hardy rhizome in autumn. They have stiff downward facing hairs that provide stability and allow them to climb. They have fragrant wind pollinated flowers that attract butterflies, the female flowers are used as a preservative and as a flavoring agent in beer.

ICG00057-1

Biotic Stresses

Fungal Infection

Internal Control Genes

Gene Symbol	Gene Model	Application Scenario	Accession Number	Primers(5' - 3') (Forward/Reverse)	Size (bp)	Annealing Temperature	Detection
YLS8	Yellow-Leaf-Specific Gene	Vascular Pathogen Verticillium Albo-Atrum Infection	NM_120912	F: CGTACCTGCTTCCACATTTGC R: TCCCAGTCGTGGCCAAAA	-	60	SYBR
DRH1	Helicase	Vascular Pathogen Verticillium Albo-Atrum Infection	-	F: CCAACCTACTGGGCTTCGAC R: CAGAATGGGTATGATCGGGC	-	60	SYBR

Molecular Types:

mRNA

Evaluation Methods

geNorm

NormFinder

Contact

Name: Branka Javornik

Email: branka.javornik@bf.uni-lj.si

Institution: Biotechnical Faculty, Agronomy Department, University of Ljubljana, Ljubljana, Slovenia

Basic Information

Gene Summary