ICG00072 Musa acuminata - Internal Control Genes Database (ICG)

Home Species

Musa acuminata

Accession: ICG00072

Latin Name: Musa acuminata

Common Name: Banana

Taxonomy ID: 4641

Description: Musa acuminata is the second ranking fruit crop in the world, with an annual world production of 100 million metric tons. It is not only as a popular dessert fruit, but also as a source of vital carbohydrate. Cultivated bananas are giant herbaceous plants within the genus Musa, they are both sterile and parthenocarpic so the fruit develops without seed. The cultivated hybrids and species are mostly triploid, and most have been propagated from mutants found in the wild.

ICG00072-1

Tissues

Developmental Stages

Abiotic Stresses

Hormone Treatments

Biotic Stresses

Fungal Infection

Temperature Conditions

Internal Control Genes

Gene Symbol	Gene Model	Application Scenario	Accession Number	Primers(5' - 3') (Forward/Reverse)	Size (bp)	Annealing Temperature	Detection
RPS2	Ribosomal Protein S2	Root Leaf Flower Peel Pulp Of Fruit 3 Weeks Fruit After Anthesis 6 Weeks Fruit After Anthesis 8 Weeks Fruit After Anthesis 12 Weeks Fruit After Anthesis Ethylene Treatment Low Temperature Condition High Temperature Condition Colletotrichum Musae Spores Inoculation Salicylic Acid (Sa) Treatment Methyl Jasmonate (Meja) Treatment	HQ853246	F: TAGGGATTCCGACGATTTGTTT R: TAGCGTCATCATTGGCTGGGA	84	60	SYBR
UBQ2	Ubiquitin	Root Leaf Flower Peel Pulp Of Fruit 3 Weeks Fruit After Anthesis 6 Weeks Fruit After Anthesis 8 Weeks Fruit After Anthesis 12 Weeks Fruit After Anthesis Ethylene Treatment Low Temperature Condition High Temperature Condition Colletotrichum Musae Spores Inoculation Salicylic Acid (Sa) Treatment Methyl Jasmonate (Meja) Treatment	HQ853254	F: GGCACCACAAACAACACAGG R: AGACGAGCAAGGCTTCCATT	379	60	SYBR

Molecular Types:

mRNA

Evaluation Methods

geNorm

NormFinder

Contact

Name: Jian-ye Chen

Email: chenjianye@scau.edu.cn

Institution: Guangdong Key Laboratory for Postharvest Science, College of Horticultural Science, South China Agricultural University, Guangzhou, 510642, People's Republic of China.

Basic Information

Gene Summary