ICG00119 Aphis gossypii - Internal Control Genes Database (ICG)

Home Species

Aphis gossypii

Accession: ICG00119

Latin Name: Aphis gossypii

Common Name: Greenfly, Cotton aphid, Melon aphid

Taxonomy ID: 80765

Description: Aphis gossypii, the cotton aphid, is a tiny greenfly that sucks sap from plants. It belongs to the superfamily Aphidoidea in the order Hemiptera. It is a widely distributed pest of a variety of agriculturally important crops in the families Cucurbitaceae, Rutaceae and Malvaceae, causing damage through feeding and virus transmission. The cotton aphid control is primarily dependent on the application of insecticides, often with multiple applications each year in China.

ICG00119-1

Developmental Stages

Temperature Conditions

Populations

Abiotic Stresses

Internal Control Genes

Gene Symbol	Gene Model	Application Scenario	Accession Number	Primers(5' - 3') (Forward/Reverse)	Size (bp)	Annealing Temperature	Detection
EF1	Elongation Factor	Nymph Alate Apterou Xinjiang Uygur Autonomous Region Hubei Province Shandong Province Henan Province	EU019874.1	F: GAAGCCTGGTATGGTTGTCGT R: GGGTGGGTTGTTCTTTGTG	187	60	SYBR
B-ACT	Actin	Nymph Alate Apterou Xinjiang Uygur Autonomous Region Hubei Province Shandong Province Henan Province	KF018928.1	F: TCTTGGGAATGGAATCTTGC R: GGACAGAGAAGCCAAGATGG	254	60	SYBR
RPL7	Ribosomal Protein L7	Nymph Alate Apterou High Temperature Condition Low Temperature Condition	KP676382	F: TGCCGGAGTCTGTACTCAA R: TCACACCACGAATACGCA	255	60	SYBR
GAPDH	Glyceraldehyde-3-Phosphate Dehydrogenase	High Temperature Condition Low Temperature Condition	KP676380	F: ACTACTGTTCATGCAACCACCG R: GCTGCTTCCTTAACCTTATCCT	272	60	SYBR
18S	18S Ribosomal RNA	Feeding Assay Experiment	KF018922.1	F: ATTGACGGAAGGGCACC R: CGCTCCACCAACTAAGAACG	157	60	SYBR

Molecular Types:

mRNA

Evaluation Methods

geNorm

NormFinder

BestKeeper

Contact

Name: Xi-Wu Gao

Email: gaoxiwu@263.net.cn

Institution: Department of Entomology, China Agricultural University, Beijing 100193, People's Republic of China

Basic Information

Gene Summary