ICG00125 Bos indicus - Internal Control Genes Database (ICG)

Home Species

Bos indicus

Accession: ICG00125

Latin Name: Bos indicus

Common Name: Zebu, Zebu cattle

Taxonomy ID: 9915

Description: Bos indicus are the most common type of large domesticated ungulates. They are a prominent modern member of the subfamily Bovinae, are the most widespread species of the genus Bos. They are characterised by a fatty hump on their shoulders, a large dewlap, and sometimes drooping ears. They are well adapted to withstanding high temperatures, and are farmed throughout the tropical countries. They are raised as livestock for meat (beef and veal), as dairy animals for milk and other dairy products. Other products include leather and dung for manure or fuel.

ICG00125-1

Developmental Stages

Internal Control Genes

Gene Symbol	Gene Model	Application Scenario	Accession Number	Primers(5' - 3') (Forward/Reverse)	Size (bp)	Annealing Temperature	Detection
PPP1R11	Protein Phosphatase	Milk Somatic Cells Multiparous Lactating Sahiwal Early Lactation Period Mid Lactation Period Late Lactation Period	NM_001100295	F: ACCATCAAACTTCGGAAACG R: CCTCCTCTTCCTCGTCATCA	-	60	SYBR
ACTB	Actin	Milk Somatic Cells Multiparous Lactating Sahiwal Early Lactation Period Mid Lactation Period Late Lactation Period	NM_173979	F: CTCTTCCAGCCTTCCTTCCT R: GGGCAGTGATCTCTTTCTGC	-	63	SYBR
UBC	Ubiquitin	Milk Somatic Cells Multiparous Lactating Sahiwal Early Lactation Period Mid Lactation Period Late Lactation Period	Z18245	F: AGATCCAGGATAAGGAAGGCAT R: GCTCCACCTCCAGGGTGAT	-	60	SYBR
GAPDH	Glyceraldehyde-3-Phosphate Dehydrogenase	Milk Somatic Cells Multiparous Lactating Sahiwal Early Lactation Period Mid Lactation Period Late Lactation Period	NM_001034034.1	F: GGGTCATCATCTCTGCACCT R: GGTCATAAGTCCCTCCACGA	-	62	SYBR

Molecular Types:

mRNA

Evaluation Methods

geNorm

NormFinder

Contact

Name: Mohanty

Email: ashokmohanty1@gmail.com

Institution: ational Dairy Research Institute, Karnal 132001, India

Basic Information

Gene Summary