ICG00136 Ctenopharyngodon idella - Internal Control Genes Database (ICG)

Home Species

Ctenopharyngodon idella

Accession: ICG00136

Latin Name: Ctenopharyngodon idella

Common Name: Grass carp

Taxonomy ID: 7959

Description: Ctenopharyngodon idella constitutes a member of the Cyprinidae family and the only species of the genus Ctenopharyngodon. Grass Carp is a sub-tropical to temperate species native to the large rivers of eastern Asia, where it tends to inhabit lower and middle reaches of these rivers and connected lacustrine habitats. Grass carp is one of the Chinese native carps with commercial importance for freshwater aquaculture, accounting for ~16% of global freshwater aquaculture, and has a vegetarian diet. It grows fast but is susceptible to various stressors and diseases.

ICG00136-1

Tissues

Biotic Stresses

Viral Infection

Internal Control Genes

Gene Symbol	Gene Model	Application Scenario	Accession Number	Primers(5' - 3') (Forward/Reverse)	Size (bp)	Annealing Temperature	Detection
18S rRNA	18S Ribosomal RNA	Gill Head Kidney Heart Intestine Liver Muscle Skin Spleen Trunk Kidney Grass Carp Reovirus (Gcrv) Infection	GQ266394	F: CGCCAGTGTTGCCTTCGT R: CGCTCAATCTTCCATCCCTT	99	60	SYBR
EF-1a	Elongation Factor	Cik Cell Culture Stimulated By Poly Cik Cell Culture Infected By Gcrv	EU047719	F: ATTTCCGACACGGAGAGG R: CATGGGTTTAGGATACGCTC	90	60	SYBR

Molecular Types:

mRNA

Evaluation Methods

geNorm

NormFinder

BestKeeper

Contact

Name: Chunrong Yang

Email: su.jianguo@gmail.com

Institution: College of Animal Science and Technology, Northwest A&F University, Shaanxi Key Laboratory of Molecular Biology for Agriculture, Yangling 712100, China

Basic Information

Gene Summary