ICG00142 Dicentrarchus labrax - Internal Control Genes Database (ICG)

Home Species

Dicentrarchus labrax

Accession: ICG00142

Latin Name: Dicentrarchus labrax

Common Name: European bass, European seabass

Taxonomy ID: 13489

Description: Dicentrarchus labrax is the first non-salmonid marine fish species to be commercially cultured in Europe. It is a major aquaculture species in the Mediterranean region and in the southern part of the north east Atlantic Ocean. Its domestication began in the 1980s, and while some breeding programs are starting (France, Greece, Israel), some hatcheries still use wild broodstock. Breeding programs are expected to provide important increases in productivity, because heritabilities of growth traits range from medium to high in this species.

ICG00142-1

Developmental Stages

Tissues

Internal Control Genes

Gene Symbol	Gene Model	Application Scenario	Accession Number	Primers(5' - 3') (Forward/Reverse)	Size (bp)	Annealing Temperature	Detection
Ef-1A	Elongation Factor	Morula 1/2 Epibolic Neurula Before Hatching Mouth Opening First Feeding Flexion Fins	FM019753	F: AGATGACCACGAGTCTCTGC R: CTTGGGTGGGTCGTTCTTG	-	57	SYBR
L13a	Ribosomal Protein L13	Morula 1/2 Epibolic Neurula Before Hatching Mouth Opening First Feeding Flexion Fins Spleen Liver Kidney Brain	DT044539	F: TCTGGAGGACTGTCAGGGGCATGC R: AGACGCACAATCTTGAGAGCAG	-	57	SYBR
Fau	FAU Ubiquitin Like And Ribosomal Protein	Spleen Liver Kidney Brain	FM004681	F: GACACCCAAGGTTGACAAGCAG R: GGCATTGAAGCACTTAGGAGTTG	-	57	SYBR

Molecular Types:

mRNA

Evaluation Methods

NormFinder

BestKeeper

Contact

Name: Elena Sarropoulou

Email: sarris@her.hcmr.gr

Institution: Institute of Marine Biology and Genetics, Hellenic Center of Marine Research, Crete, P.O. Box 2214, 710 03 Iraklio, Crete, Greece

Basic Information

Gene Summary