ICG00153 Homo sapiens - Internal Control Genes Database (ICG)

Home Species Homo sapiens

Extracellular Vesicle Model

Species: Human

Category: Human Biological Model

Description: Extracellular vesicles (EVs) are nano-sized lipid bilayer vesicles released by virtually every cell type. EVs have diverse biological activities, ranging from roles in development and homeostasis to cancer progression, which has spurred the development of EVs as disease biomarkers and drug nanovehicles. In addition, EVs are a diverse family in which subtypes have been defined based on subcellular origin, size, and composition: endosome-derived vesicles (including multivesicular endosome-derived exosomes with a diameter of 50–150 nm and secretory autophagosome-derived EVs).

ICG00153-73

Extracellular Vesicle Model

Human Biological Model

Internal Control Genes

Gene Symbol	Gene Model	Application Scenario	Accession Number	Primers(5' - 3') (Forward/Reverse)	Size (bp)	Annealing Temperature	Detection
miR-23a-3p	MiRNA	Atria Ventricular Septa Heart Biopsy Specimen	-	F: AUCACAUUGCCAGGGAUUUCC R: AUCACAUUGCCAGGGAUUUCC	-	60	SYBR
miR-101-3p	MiRNA	Atria Ventricular Septa Heart Biopsy Specimen	-	F: UACAGUACUGUGAUAACUGAA R: UACAGUACUGUGAUAACUGAA	-	60	SYBR
miR-26a-5p	MiRNA	Atria Ventricular Septa Heart Biopsy Specimen	-	F: UUCAAGUAAUCCAGGAUAGGCU R: UUCAAGUAAUCCAGGAUAGGCU	-	60	SYBR

Molecular Types:

MicroRNA

Evaluation Methods

geNorm

NormFinder

BestKeeper

Contact

Name: Ahmed Gamal-Eldin Ibrahim

Email: aibrahim@capricor.com

Institution: Capricor Therapeutics Institute, Beverly Hills, CA, USA

Basic Information

Gene Summary