ICG00153 Homo sapiens - Internal Control Genes Database (ICG)

Home Species Homo sapiens

HIV

Species: Human

Category: Human Non-cancer Disease Studies

Description: HIV infection has become a global pandemic, affecting communities throughout the world. Ninety percent of people with HIV live in developing countries. In these countries, HIV/AIDS has taken a heavy toll on economic, social, and family structures. It is responsible for a large proportion of adult deaths causing millions of children to be orphaned.

ICG00153-107

HIV

Non-cancer Disease Studies

Internal Control Genes

Gene Symbol	Gene Model	Application Scenario	Accession Number	Primers(5' - 3') (Forward/Reverse)	Size (bp)	Annealing Temperature	Detection
TBP	TATA-binding Protein	Latency-reversing Agent Treatment HIV	NM_003194	F: CAGTGAATCTTGGTTGTAAACTTGA R: TCGTGGCTCTCTTATCCTCAT	113	60	SYBR
UBE2D2	Ubiquitin-Conjugating Enzyme	Latency-reversing Agent Treatment HIV	NM_181838	F: GTACTCTTGTCCATCTGTTCTCTG R: CCATTCCCGAGCTATTCTGTT	120	60	SYBR
RPL27A	Ribosomal Protein L27	Latency-reversing Agent Treatment HIV	NM_000990	F: AACATGCCATCCAGACTGAG R: GGTATTTGTCGAAGTTGATCCG	148	60	SYBR

Molecular Types:

mRNA

Evaluation Methods

geNorm

NormFinder

BestKeeper

Contact

Name: Nancie M. Archin

Email: nancie_archin@med.unc.edu

Institution: UNC HIV Cure Center, The University of North Carolina at Chapel Hill, Chapel Hill, North Carolina, USA

Basic Information

Gene Summary