ICG00166 Oryctolagus cuniculus - Internal Control Genes Database (ICG)

Home Species

Oryctolagus cuniculus

Accession: ICG00166

Latin Name: Oryctolagus cuniculus

Common Name: Rabbit

Taxonomy ID: 9986

Description: Oryctolagus cuniculus is wildly spread in the world, it is a kind of small mammals in the family of the order Lagomorpha. The Lagomorpha family consists of eight different genera in the family classified as rabbits, including the European rabbit, cottontail rabbits, and the Amami rabbit. There are many other species of rabbit, and these, along with pikas and hares, make up the order Lagomorpha. Rabbits live in groups, underground burrows, or rabbit holes and feed by grazing on grass, forbs, and leafy weeds.

ICG00166-1

Tissues

Injury And Repair Research Model

Internal Control Genes

Gene Symbol	Gene Model	Application Scenario	Accession Number	Primers(5' - 3') (Forward/Reverse)	Size (bp)	Annealing Temperature	Detection
B2M	Microglobulin	Surrounding Cartilage Some Hard Bone Tissue	XM_002717921.1	F: AACGTGGAACAGTCAGACC R: AGTAATCTCGATCCCATTTC	157	60	SYBR
18S rRNA	18S Ribosomal RNA	Surrounding Cartilage Some Hard Bone Tissue	NR_033238.1	F: ATCAGATACCGTCGTAGTTC R: TTCCGTCAATTCCTTTAAG	167	60	SYBR

Molecular Types:

mRNA

Evaluation Methods

geNorm

NormFinder

Contact

Name: Xiao-Xiang Peng

Email: pxx74@sina.com

Institution: Shandong Provincial Key Laboratory of Clinical Laboratory Diagnostics, Department of Medical Laboratory, Weifang Medical University, Shandong 261053, China

Basic Information

Gene Summary