ICG10016 Artemisia sphaerocephala - Internal Control Genes Database (ICG)

Home Species

Artemisia sphaerocephala

Accession: ICG10016

Latin Name: Artemisia sphaerocephala

Common Name: -

Taxonomy ID: 401934

Description: Artemisia sphaerocephala, a dicotyledonous perennial semi-shrub belonging to the Artemisia genus of the Compositae family, is widely distributed in northwestern China. This shrub is one of the most important pioneer plants which is capable of protecting rangelands from wind erosion.

ICG10016-1

Tissues

Developmental Stages

Abiotic Stresses

Internal Control Genes

Gene Symbol	Gene Model	Application Scenario	Accession Number	Primers(5' - 3') (Forward/Reverse)	Size (bp)	Annealing Temperature	Detection
UBC9	Ubiquitin	Germinated Seeds After 3 Days Germinated Seeds After 7 Days Mature Leaf Stem Root Flower Flower Bud Early Developing Seed Mid-Developing Seed Mature Seed Salinity Stress High Temperature Condition Low Temperature Condition	AT4G27960	F: TCTCTCTCACACACCAAACC R: TGGCTCTCATTTCTATCCAA	102	-	SYBR
TIP41	Tonoplast Intrinsic Protein	Germinated Seeds After 3 Days Germinated Seeds After 7 Days Mature Leaf Stem Root Flower Flower Bud Early Developing Seed Mid-Developing Seed Mature Seed Salinity Stress High Temperature Condition Low Temperature Condition	AT4G34270	F: GTGGGAAGCAGACGAGAAAG R: TGATTGGAGGTTGAGAGAAGTG	136	-	SYBR

Molecular Types:

mRNA

Evaluation Methods

geNorm

NormFinder

BestKeeper

Contact

Name: Hua Fu

Email: fuhua@lzu.edu.cn

Institution: National Demonstration Center for Experimental Grassland Science Education, Lanzhou University, Lanzhou, China

Basic Information

Gene Summary