ICG10017 Hordeum vulgare L. var. nudum. hook. f. - Internal Control Genes Database (ICG)

Home Species

Hordeum vulgare L. var. nudum. hook. f.

Accession: ICG10017

Latin Name: Hordeum vulgare L. var. nudum. hook. f.

Common Name: Tibetan hulless barley

Taxonomy ID: 2821315

Description: Tibetan hulless barley (Hordeum vulgare L. var. nudum. hook. f.) is a type of traditional crop in the Qinghai-Tibetan plateau, which has been cultivated as an irreplaceable cereal by the local inhabitants for hundreds of years. As a true functional food, the hulless barley flour is rich in dietary fiber, which significantly reduces the risk of type II diabetes, cardiovascular dis- ease, and colorectal cancers.

ICG10017-1

Abiotic Stresses

Temperature Conditions

Internal Control Genes

Gene Symbol	Gene Model	Application Scenario	Accession Number	Primers(5' - 3') (Forward/Reverse)	Size (bp)	Annealing Temperature	Detection
TUBb6	Tubulin	Salinity Stress Low Temperature Condition Drought Stress	-	F: ACTGGGCCAAGGGACACTA R: GATGGGAACACGGAGAAGG	217	56	SYBR
E2	Ubiquitin	Salinity Stress Low Temperature Condition Drought Stress	-	F: CCATCCGAACATCAATAGC R: CGGTAAGCAGCGAGCA	112	56	SYBR
TUBa	Tubulin	Salinity Stress Low Temperature Condition Drought Stress	-	F: CCATCAAGACCAAGCGCACTA R: CATACCCTCACCCACATACCA	239	56	SYBR

Molecular Types:

mRNA

Evaluation Methods

geNorm

NormFinder

BestKeeper

Contact

Name: Yuwei Zhao

Email: zhaoyw@nwu.edu.cn

Institution: Provincial Key Laboratory of Biotechnology of Shaanxi Province, Xi'an, China

Basic Information

Gene Summary