ICG10052 Lens culinaris - Internal Control Genes Database (ICG)

Home Species

Lens culinaris

Accession: ICG10052

Latin Name: Lens culinaris

Common Name: lentil

Taxonomy ID: 3864

Description: Lentil (Lens culinaris) is a self-pollinating diploid (2n = 14 chromosomes), annual, cool season legume crop. It is a staple food in developing countries and contributes significantly to food and nutritional security. It is a rich source of protein and other micronutrients, like iron and zinc.

ICG10052-1

Developmental Stages

Abiotic Stresses

Internal Control Genes

Gene Symbol	Gene Model	Application Scenario	Accession Number	Primers(5' - 3') (Forward/Reverse)	Size (bp)	Annealing Temperature	Detection
RPL2	Ribosomal Protein L2	Salinity Stress Drought Stress High Temperature Condition Low Temperature Condition Abscisic Acid (Aba) Treatment Methyl Viologen (Mv) Treatment	XM_004489738.2	F: ATTGAGCTGAACCCAGGACAA R: GACGTGGGCTCCTTCAAGATC	80	60	SYBR
Tub	Tubulin	Seedling Emergence First Simple Leaf Second Simple Leaf First Bifoliate Leaf Second Bifoliate Leaf First Multifoliate Leaf Nth Multifoliate Leaf	NM_001252709.2	F: CACCCAGCAAATGTGGGATT R: TGGCAGATGCGGTGAGGTA	80	60	SYBR
Rbcl	Ribulose-1,5-Bisphospate Carboxylase/Oxygenase	Seedling Emergence First Simple Leaf Second Simple Leaf First Bifoliate Leaf Second Bifoliate Leaf First Multifoliate Leaf Nth Multifoliate Leaf	EU717256.1	F: ATGCCTGCTCTGACCGAGAT R: TTTCCCCAAGGGTGTCCTAAA	80	60	SYBR

Molecular Types:

mRNA

Evaluation Methods

geNorm

NormFinder

BestKeeper

Contact

Name: Anil Kumar Singh

Email: anil.singh12@icar.gov.in

Institution: ICAR-Indian Institute of Agricultural Biotechnology, Garhkhatanga, Ranchi, 834 010 India.

Basic Information

Gene Summary