ICG10055 Gammarus fossarum - Internal Control Genes Database (ICG)

Home Species

Gammarus fossarum

Accession: ICG10055

Latin Name: Gammarus fossarum

Common Name: -

Taxonomy ID: 52638

Description: Gammarus fossarum is indigenous and widespread in mainland Europe being found in countries that include France, Germany, Belgium, Switzerland and Poland. G. fossarum is a smaller species than G. pulex with the largest males only reaching 1516mm in size compared to c.24mm in G.pulex.

ICG10055-1

Heavy Metal Conditions

Internal Control Genes

Gene Symbol	Gene Model	Application Scenario	Accession Number	Primers(5' - 3') (Forward/Reverse)	Size (bp)	Annealing Temperature	Detection
SDH	Succinate Dehydrogenase Complex	Silver Stress Gold Stress	MF940255	F: GGAAGAAGCTGGATGGTCTG R: ACTTGTCTCCGTTCCACCAG	87	84	SYBR
Clathrin	Clathrin Adaptor Complex	Silver Stress Gold Stress	XP_018025977.1	F: ATCGCCAAGCTTTGTGACTT R: GCTTTGATAGGCGGACTCTG	107	85	SYBR

Molecular Types:

mRNA

Evaluation Methods

geNorm

NormFinder

BestKeeper

Contact

Name: Sébastien Cambier

Email: sebastien.cambier@list.lu

Institution: Environmental Research and Innovation (ERIN) Department, Luxembourg Institute of Science and Technology (LIST), 5, avenue des Hauts-Fourneaux, Esch-sur-Alzette, Luxembourg.

Basic Information

Gene Summary