ICG10086 Arundo donax - Internal Control Genes Database (ICG)

Home Species

Arundo donax

Accession: ICG10086

Latin Name: Arundo donax

Common Name: giant cane

Taxonomy ID: 35708

Description: Arundo donax L. (commonly known as giant reed) is a fast-growing grass that belongs to the Poaceae family. Its high biomass production (up to 40 tons/ha) and low input requirements, make it one of the best options as non-food energy crop, especially in the Mediterranean area where it is naturalized since thousands of years.

ICG10086-1

Tissues

Hormone Treatments

Internal Control Genes

Gene Symbol	Gene Model	Application Scenario	Accession Number	Primers(5' - 3') (Forward/Reverse)	Size (bp)	Annealing Temperature	Detection
RPN6	Proteasome 26S Subunit, Non-ATPase	Shoot Root Osmotic Stress	Unigene067565	F: CACACGACTAGCAGCTTTCAAG R: TTCAAACGTCGGGAAGGTTG	78	80	SYBR
EF-1a	Elongation Factor	Shoot Root Osmotic Stress	Unigene076509	F: TGACTGTGCTGTGCTCATCA R: GTTGCAGCAGCAGATCATCT	133	83	SYBR
GADPH	Glyceraldehyde-3-Phosphate Dehydrogenase	Osmotic Stress	Unigene069707	F: TGACAAGGAGAAGGCTGCTG R: GAGCAAGGCAGTTTGTGGTG	167	82.5	SYBR

Molecular Types:

mRNA

Evaluation Methods

geNorm

NormFinder

BestKeeper

Contact

Name: Claudio Varotto

Email: claudio.varotto@fmach.it

Institution: Department of Biodiversity and Molecular Ecology, Research and Innovation Centre, Fondazione Edmund Mach,Via E. Mach 1, 38010, S. Michele all’Adige (TN), Italy.

Basic Information

Gene Summary