ICG10176 Brevipalpus yothersi - Internal Control Genes Database (ICG)

Home Species

Brevipalpus yothersi

Accession: ICG10176

Latin Name: Brevipalpus yothersi

Common Name: NA

Taxonomy ID: 1754060

Description: The false spider mites Brevipalpus spp. (Acari: Tenuipalpidae) are phytophagous, polyphagous, worldwide dis- tributed, and considered one of the most prominence agricultural pests by association with more than 40 plant viruses. The so-called Brevipalpus-transmitted viruses (BTVs) severely affect a wide range of plant species, including economically important ones such as citrus, coffee, passion fruit, and orchids.

ICG10176-1

Developmental Stages

Internal Control Genes

Gene Symbol	Gene Model	Application Scenario	Accession Number	Primers(5' - 3') (Forward/Reverse)	Size (bp)	Annealing Temperature	Detection
Ubiq	Ubiquitin	Egg Larvae Protonymph Deutonymph Adult Female	-	F: TGTCGTAAATGTTATGCACGTC R: TTACGTCTTGGGCTTCTTCTTT	106	-	SYBR
EF1a	Elongation Factor	Egg Larvae Protonymph Deutonymph Adult Female	-	F: TGTGGAGACTTTCACTGACTTC R: TGCCAGCAGACAGATCTTTAG	116	-	SYBR
GAPDH	Glyceraldehyde-3-Phosphate Dehydrogenase	Egg Larvae Protonymph Deutonymph Adult Female	-	F: ACCTGTCGACTGAAGAAAGATG R: TACGGCCTGTTCATCACAATAA	114	-	SYBR
RPL13	Ribosomal Protein L13	Mites Host Plant: Sweet Orange Mites Host Plant: Common Bean	-	F: ATGGAGGTGGCGTATGTATG R: ACTGAGTGCCTTGTAAACCG	128	-	SYBR
RPL32	Ribosomal Protein L32	Mites Host Plant: Sweet Orange Mites Host Plant: Common Bean	-	F: CCCACTCAGTATCAGCCAAA R: TTCTTCGCTTCGTAGTCTTGAG	101	-	SYBR

Molecular Types:

mRNA

Evaluation Methods

geNorm

NormFinder

BestKeeper

Contact

Name: Valdenice Moreira Novelli

Email: valdenice@ccsm.br

Institution: Sylvio Moreira citrus center, Agronomic institute (iAc), cordeirópolis, S00o Paulo, Brazil.

Basic Information

Gene Summary