ICG10213 Aquatica leii - Internal Control Genes Database (ICG)

Home Species

Aquatica leii

Accession: ICG10213

Latin Name: Aquatica leii

Common Name: NA

Taxonomy ID: 1421715

Description: Aquatica leii belongs to the order Coleoptera, family Lampyridae, subfamily Luciolinae, genus Aquatica and is mainly distributed in the middle and lower reaches of the Yangtze River in mainland China. A. leii is the most widely studied aquatic firefly species.

ICG10213-1

Genders

Developmental Stages

Tissues

Temperature Conditions

Abiotic Stresses

Internal Control Genes

Gene Symbol	Gene Model	Application Scenario	Accession Number	Primers(5' - 3') (Forward/Reverse)	Size (bp)	Annealing Temperature	Detection
a-tubulin	Tubulin	Head Thorax Abdomen Antenna Larvae Benzopyrene Treatment Female Male	c102349.graph_c0	F: CGTTTTGTCGGGTACATAT R: AACACGCATTTCCTATTTGA	138	55	SYBR
b-tubulin	Tubulin	Head Thorax Abdomen Antenna Larvae Benzopyrene Treatment Female Male	c91143.graph_c0	F: ACCTTACAATGCCACTCTT R: CCGTATGTTGGTGTCGTA	126	55	SYBR
b-actin	Actin	Female Male	c130645.graph_c0	F: TTCTTCCATAGCGGTGAA R: CCAGCAGTTGTTCTTGAC	147	55	SYBR
EF1A	Elongation Factor	Female Male Benzopyrene Treatment	c133684.graph_c0	F: TGAAACCTTTGCTGAATACC R: GTCCTTCTTGTCAACATTCTT	101	55	SYBR
GST	Glutathion S Transferase	Adult Egg Larvae Pupae Low Temperature Condition High Temperature Condition Normal Temperature Condition	c158765.graph_c0	F: CGGGTGGGTATAGAGTTT R: ACTGAACGGAATAGAACCT	129	55	SYBR
GAPDH	Glyceraldehyde-3-Phosphate Dehydrogenase	Adult Egg Larvae Pupae	c123644.graph_c0	F: CATACGAATAGTCCATAACGATT R: AGGGTGTTGCTTCTCATT	140	55	SYBR

Molecular Types:

mRNA

Evaluation Methods

geNorm

NormFinder

BestKeeper

Contact

Name: Qi-Lin Zhang

Email: zhangql@kust.edu.cn

Institution: Faculty of Life Science and Technology, Kunming University of Science and Technology, Kunming, China

Basic Information

Gene Summary