ICG10243 Metopolophium dirhodum - Internal Control Genes Database (ICG)

Home Species

Metopolophium dirhodum

Accession: ICG10243

Latin Name: Metopolophium dirhodum

Common Name: rose-grain aphid

Taxonomy ID: 44670

Description: Metopolophium dirhodum (Walker) (Hemiptera: Aphididae) is one of the most major aphid pests affecting winter wheat and other cereals worldwide. Additionally, M. dirhodum, which was first detected in the 1970s, originated in the Holarctic and was subsequently introduced to South America and other regions

ICG10243-1

Geographic Populations

Abiotic Stresses

Tissues

Temperature Conditions

Nutrient Conditions

Internal Control Genes

Gene Symbol	Gene Model	Application Scenario	Accession Number	Primers(5' - 3') (Forward/Reverse)	Size (bp)	Annealing Temperature	Detection
SDHB	Succinate Dehydrogenase Complex	Geographic Effect Head Thorax Abdomen	TR11034\|c0_g1	F: TCACGCCAGATTACCG R: TAGCTCCATGAACAGAAG	221	60	SYBR
RPL8	Ribosomal Protein L8	Geographic Effect First-Instar Nymph Second-Instar Nymph Third-Instar Nymph Fourth-Instar Nymph Adult Wing Dimorphism High Temperature Condition Low Temperature Condition Rifampicin Treatment	TR12462\|c0_g1	F: CCACAACCCAGACTCCA R: TAGGCCAGCAATTACGC	179	60	SYBR
Actin	Actin	First-Instar Nymph Second-Instar Nymph Third-Instar Nymph Fourth-Instar Nymph Adult Wing Dimorphism High Temperature Condition Low Temperature Condition	TR9961\|c1_g1	F: CCATGTACCCTGGTATTGC R: TGTGGGAGGTGATGACTTA	234	60	SYBR
GAPDH	Glyceraldehyde-3-Phosphate Dehydrogenase	First-Instar Nymph Second-Instar Nymph Third-Instar Nymph Fourth-Instar Nymph Adult	TR3352\|c0_g1	F: GGATTACCGACGCTACGC R: CGCACGCACAAGGATTTA	232	60	SYBR
NADH	Nadh Dehydrogenase	Rifampicin Treatment	TR12676\|c0_g1	F: GTCAAACCTGGTGGCTAAA R: AGTCGTGGCGTCCATACAG	182	60	SYBR
RPL4	Ribosomal Protein L4	Starvation Stress Insecticide Treatment	TR996\|c0_g1	F: AAAGCACCCATCAGACC R: CGGACACGAGGAATACG	155	60	SYBR
EF1A	Elongation Factor	Starvation Stress	DQ005156.1	F: GGAACACGCTCTATTGGC R: CACGACCTACTGGGACTG	526	60	SYBR
AK	Arginine Kinase	Insecticide Treatment	TR3122\|c0_g1	F: AGTACATAATTTCTACGAGGGT R: GACATGCCAGTTAAGGGA	169	60	SYBR

Molecular Types:

mRNA

Evaluation Methods

geNorm

NormFinder

BestKeeper

Contact

Name: Xun Zhu

Email: zhuxun@caas.cn

Institution: State Key Laboratory for Biology of Plant Diseases and Insect Pests, Institute of Plant Protection, Chinese Academy of Agricultural Sciences,YuanmingyuanWestRoadNo.2,HaidianDistrict,Beijing100193,China

Basic Information

Gene Summary