ICG10245 Glycyrrhiza uralensis - Internal Control Genes Database (ICG)

Home Species

Glycyrrhiza uralensis

Accession: ICG10245

Latin Name: Glycyrrhiza uralensis

Common Name: Chinese liquorice

Taxonomy ID: 74613

Description: Chinese liquorice (Glycyrrhiza uralensis), one of the oldest Chinese medicinal herbs, has high levels of bioactive phytochemicals22,23. This plant has multiple pharmacological properties, including anti-inflammatory, antiviral, antimicrobial, antioxidative, anticancer, and antidiabetic effects

ICG10245-1

Abiotic Stresses

Hormone Treatments

Tissues

Internal Control Genes

Gene Symbol	Gene Model	Application Scenario	Accession Number	Primers(5' - 3') (Forward/Reverse)	Size (bp)	Annealing Temperature	Detection
TIF1	Eukaryotic Translation Initiation Factor	Osmotic Stress Salinity Stress Abscisic Acid (Aba) Treatment Methyl Jasmonate (Meja) Treatment Leaf	MW122063	F: ACAACCGTTCAGGGATTGA R: GGGTCCTGAACAACTGTACC	98	62.2	SYBR
DNAJ	Heat Shock Protein	Osmotic Stress Salinity Stress Abscisic Acid (Aba) Treatment Methyl Jasmonate (Meja) Treatment Leaf Root	MW116277	F: TGGTTGTCAAGGAACTGGTATG R: CACTGTGGGCAGCGGTCT	135	63.4	SYBR
CS	Citrate Synthase	Osmotic Stress Salinity Stress Abscisic Acid (Aba) Treatment Methyl Jasmonate (Meja) Treatment Leaf	MW116272	F: GCTCAGCCGTTGACCCAG R: CACCACCAGGAAAAGCACC	93	64.2	SYBR
ABCC2	ATP Binding-Box Transporter	Osmotic Stress Salinity Stress Abscisic Acid (Aba) Treatment Methyl Jasmonate (Meja) Treatment Leaf	MW116275	F: TGAGTCTTTCCAGGGCTTTATT R: ATGGTGTTAAGGCGATGAGC	160	62.7	SYBR
DREB	Dehydration Responsive Element Binding	Osmotic Stress Salinity Stress Abscisic Acid (Aba) Treatment Methyl Jasmonate (Meja) Treatment Root	MW119710	F: GGTTGCTGAAATTCGGGAGC R: CATTGGGGAAGTTGAGGCG	139	64	SYBR
CAC	Clathrin Adaptor Complex	Osmotic Stress Salinity Stress Abscisic Acid (Aba) Treatment Methyl Jasmonate (Meja) Treatment Root	MW116276	F: GAGTTTCAGCTTCCTCCTTGCA R: TGATGGGGCTTTATCCTTTGG	126	63.4	SYBR

Molecular Types:

mRNA

Evaluation Methods

geNorm

NormFinder

BestKeeper

Contact

Name: Yongqing Li

Email: liyongqing@scbg.ac.cn

Institution: Key Laboratory of South China Agricultural Plant Molecular Analysis and Genetic Improvement & Guangdong Provincial Key Laboratory of Applied Botany, South China Botanical Garden,Chinese Academy of Sciences, Guangzhou 510650, China

Basic Information

Gene Summary