ICG10313 Rousettus aegyptiacus - Internal Control Genes Database (ICG)

Home Species

Rousettus aegyptiacus

Accession: ICG10313

Latin Name: Rousettus aegyptiacus

Common Name: Egyptian fruit bat

Taxonomy ID: 9407

Description: Egyptian fruit bats, Rousettus aegyptiacus, have been identified as putative reservoir hosts of Marburg virus, Kasokero virus and Sosuga virus, and were shown to be suscepti- ble to experimental challenge with SARS-CoV-2 and Rift valley fever phlebovirus. These viruses may cause severe diseases with high mortality rates in humans.

ICG10313-1

Temperature Conditions

Abiotic Stresses

Internal Control Genes

Gene Symbol	Gene Model	Application Scenario	Accession Number	Primers(5' - 3') (Forward/Reverse)	Size (bp)	Annealing Temperature	Detection
EEF1A1	Elongation Factor	Ulfn Treatment 35C Ulfn Treatment 37C Ulfn Treatment 40C	-	F: GTATGCCTGGGTCTTGGATAAA R: GCCTGTGATGTGCCTGTAA	162	-	SYBR

Molecular Types:

mRNA

Evaluation Methods

NormFinder

BestKeeper

Contact

Name: Gang Pei

Email: Gang.Pei@fli.de

Institution: Institute of Immunology, Friedrich-Loeffler-Institut, Greifswald-Insel Riems, Germany

Basic Information

Gene Summary