ICG20028 Bombus Terrestris - Internal Control Genes Database (ICG)

Home Species

Bombus Terrestris

Accession: ICG20028

Latin Name: Bombus Terrestris

Common Name: Buff-tailed Bumblebee

Taxonomy ID: 30195

Description: The bumble bee (Bombus terrestris) plays an important role as a pollinator. In addition, the bumble bee is a prominent key model insect due to its relatively complex behaviors, such as sociality, division, and colony management. This makes the bumble bee a prominent key model insect.

ICG20028-1

Tissues

Lines

Internal Control Genes

Gene Symbol	Gene Model	Application Scenario	Accession Number	Primers(5' - 3') (Forward/Reverse)	Size (bp)	Annealing Temperature	Detection
S28	28S Ribosomal RNA	Ovary Fat Body Thorax Head Bumble Bee Queens (line 1–line 5)	NW_025963548.1	F: AGCGCGGATATCTTGGACTG R: TCAAGACGGGTCCTGAGAGT	83	59	SYBR
S5	5S Ribosomal RNA	Ovary Fat Body Thorax Head Bumble Bee Queens (line 1–line 5)	XM_012308701.2	F: TGCGCAATGTCCTATAGTCG R: AGCCGTCACAAGAACCTGTA	157	59	SYBR
S18	18S Ribosomal RNA	Ovary Fat Body Thorax Head Bumble Bee Queens (line 1–line 5)	XM_003400778.3	F: AGCGTGCTGGAGAATGTTCA R: TCGTTCCAAGTCCTCACGAAG	101	59	SYBR
PLA2	PHOSPHOLIPASE A2	Ovary Fat Body Thorax Head Bumble Bee Queens (line 1–line 5)	XM_003400908.4	F: TTGCGATGCGCATGACATTT R: ATCGCAGCCGATTGATACCC	114	59	SYBR
EF-1	Elongation Factor	Ovary Fat Body Thorax Head Bumble Bee Queens (line 1–line 5)	XM_012314816.3	F: GAGAAGTGCGCCGCTAGT R: AACGCGAATTAAGCGGATGC	94	59	SYBR

Molecular Types:

mRNA

Evaluation Methods

geNorm

NormFinder

BestKeeper

Contact

Name: Kyeong Yong Lee

Email: ultrataro@korea.kr

Institution: Division of Apiculture, Department of Agricultural Biology, National Institute of Agricultural Science, Rural Development of Administration, Wanju-gun 55365, Republic of Korea

Basic Information

Gene Summary