|
|
| (11 intermediate revisions by the same user not shown) |
| Line 20: |
Line 20: |
| | | | |
| | ===Characteristics === | | ===Characteristics === |
| − | [[File:Functional domains of 7SK RNA..png|right|thumb|Functional domains of 7SK RNA([https://www.ncbi.nlm.nih.gov/pubmed/19246988 (Diribarne 2009)])]]
| + | Human UBE3A-ATS is a large (∼460 kb) transcript that initiates in the PWS-IC and extends distally through SNURF/SNRPN, IPW and overlaps UBE3A, alternatively spliced and serves as a host for several types of small nucleolar RNA (snoRNA) of the box C/D class that are contained within the introns and are expressed upon processing of the paternal copy of the host transcript<ref name="ref1" />. |
| − | | |
| − | ~330 nt in vertebrates*. Transcribed by RNAP III, GC-rich sequence forming conserved secondary structures (especially 3' and 5' stem-loop motifs).
| |
| − | | |
| − | The 7SK gene is located on chromosome 6, and chromosome 6 is the sole human chromosome that produces 7SK RNA ([https://www.ncbi.nlm.nih.gov/pubmed/8139910 (Driscoll 1994)])
| |
| − | | |
| − | 7SK RNA is capped at its 5' end by BCDIN3, a specific methylase methylphosphate capping enzyme (MePCE) ([http://www.ncbi.nlm.nih.gov/pubmed/17643375 (Jeronimo 2007)]).
| |
| − | | |
| − | RNAP II was recently found to bind near 7SK promoter, as well as many other known Pol III genes, suggesting that RNAP II may also play a role in regulating their transcription ([http://www.ncbi.nlm.nih.gov/pubmed/20139302 (Raha 2010)]).
| |
| − | | |
| − | In invertebrates, 7SK homologs may have different sizes (such as >400 nt and ~130 nt in drosophilids and nematodes, respectively). ([http://www.ncbi.nlm.nih.gov/pubmed/20139302 (Gruber 2008)]) ([http://www.ncbi.nlm.nih.gov/pubmed/18566019 (Marz 2009)])
| |
| | | | |
| | ===Expression=== | | ===Expression=== |
| − | Nuclear, highly abundant (one of the most abundant small RNAs in vertebrate cells), first isolated from HeLa nuclear extracts, but ubiquitously expressed.
| + | More distal part of UBE3A-ATS, which overlaps UBE3A, is brain specific<ref name="ref1" />. |
| − | | |
| − | RNA sequencing from 11 humans tissues confirmed ubiquitous high expression of 7SK with expression in some tissues being higher than any mRNA ([http://www.ncbi.nlm.nih.gov/pubmed/20668672 (Castle 2010)]).
| |
| | | | |
| | ===Regulation=== | | ===Regulation=== |
| − | In the 7SK ribonucleoprotein, Larp7 binds directly to 3′ terminus of 7SK RNA ([https://www.ncbi.nlm.nih.gov/pubmed/18281698 (Krueger 2008)]) ([https://www.ncbi.nlm.nih.gov/pubmed/18483487 (Markert 2008)]), and prevents degradation of 7SK in vivo ([https://www.ncbi.nlm.nih.gov/pubmed/18281698 (Krueger 2008)]).
| + | Please input information here. |
| | | | |
| | ===Function=== | | ===Function=== |
| − | [[File:Model of hLarp7 recognition of the 7SK.png|right|thumb|Model of hLarp7 recognition of the 7SK 3′end and mechanism of assembly of core 7SK RNP([https://www.ncbi.nlm.nih.gov/pubmed/29946027 (Eichhorn 2018)])]]
| + | The mechanism of epigenetic silencing of UBE3A has been associated with a brain specific paternal antisense (UBE3A-ATS) transcript in human and mouse<ref name="ref1" />. |
| − | | |
| − | 7SK snRNA functions in transcriptional regulation by interacting with PTEF-B complex ([http://www.ncbi.nlm.nih.gov/pubmed/11713533 (Nguyen 2001)]) ([http://www.ncbi.nlm.nih.gov/pubmed/11713532 (Yang 2001)]), BAF chromatin-remodeling complex ([https://www.ncbi.nlm.nih.gov/pubmed/26878240 (Flynn 2016)]), or hnRNP R ([https://www.ncbi.nlm.nih.gov/pubmed/29507242 (Briese 2018)]). Consistently, it has been found highly enriched in isolated chromatin fractions, which may be related to its role in transcriptional regulation ([http://www.ncbi.nlm.nih.gov/pubmed/20404130 (Mondal 2010)]). In addition to its critical role for controlling transcription, 7SK snRNA is also involved in alternative splicing ([http://www.ncbi.nlm.nih.gov/pubmed/19416841 (Barboric 2009)]) and the localization of protein in nucleolus ([http://www.ncbi.nlm.nih.gov/pubmed/17381310 (He 2007)]). Therefore, 7SK snRNA has a variety of functions in the nuclear, playing important roles in cell growth and differentiation ([http://www.ncbi.nlm.nih.gov/pubmed/11713533 (Nguyen 2001)]) ([http://www.ncbi.nlm.nih.gov/pubmed/11713532 (Yang 2001)]), axon maintenance ([https://www.ncbi.nlm.nih.gov/pubmed/29507242 (Briese 2018)]) and vertebrate development ([http://www.ncbi.nlm.nih.gov/pubmed/19416841 (Barboric 2009)]).
| |
| − | | |
| − | 7SK snRNA controls RNAP II activity by inhibiting P-TEFb elongation factor, which is a cdk-cyclin kinase that functions as both a general and an HIV-1 Tat-specific transcription factor ([http://www.ncbi.nlm.nih.gov/pubmed/11713533 (Nguyen 2001)]) ([http://www.ncbi.nlm.nih.gov/pubmed/11713532 (Yang 2001)]), with an impact on cell growth and differentiation. Specifically, 7SK snRNA functions as the central scaffold that coordinates protein-protein interactions and, by inhibiting P-TEFb kinase-mediated CTD phosphorylation, regulates RNAP II elongation ([http://www.ncbi.nlm.nih.gov/pubmed/11713533 (Nguyen 2001)]).
| |
| − | | |
| − | At an early stage of the HIV transcription cycle, elongation is prevented as P-TEFb is recruited to the HIV-1 promoter in a catalytically inactive state bound to the 7SK snRNP and also the Tat trans-activator of transcription protein. The inhibitory 7SK snRNP may be displaced by the nascent TAR HIV RNA that also binds Tat protein, activating P-TEFb kinase and transcriptional elongation ([http://www.ncbi.nlm.nih.gov/pubmed/20562857 (D'Orso 2010)]). Displacement of 7SK may also be performed by cellular RNAs, as indicated by the 3'-untranslated region (~300-nt) of HIC mRNA, which forms complexes with P-TEFb and is necessary and sufficient for stimulation of P-TEFb-dependent transcription of the HIV promoter ([http://www.ncbi.nlm.nih.gov/pubmed/17925858 (Young 2007)]).
| |
| − | | |
| − | 7SK snRNA inhibits enhancer transcription by modulating nucleosome position. 7SK physically interacts with the BAF chromatin-remodeling complex, recruits BAF to enhancers and inhibits enhancer transcription by modulating chromatin structure ([https://www.ncbi.nlm.nih.gov/pubmed/26878240 (Flynn 2016)]).
| |
| − | | |
| − | In axons, 7SK snRNA interacts with hnRNP R to regulate its function in axon maintenance ([https://www.ncbi.nlm.nih.gov/pubmed/29507242 (Briese 2018)]).
| |
| − | | |
| − | 7SK snRNP (composed of 7SK snRNA, Hexim1, Larp7/Pip7S, and the P-TEFb subunits CycT1 and Cdk9) is not only critical for controlling transcription, but also for regulating alternative splicing coupled to transcription elongation ([http://www.ncbi.nlm.nih.gov/pubmed/19416841 (Barboric 2009)]). 7SK snRNP disintegration promotes inclusion of an alternative exon via the increased occupancy of P-TEFb, Ser2-phosphorylated (Ser2-P) RNAPII, and the splicing factor SF2/ASF at the minigene ([http://www.ncbi.nlm.nih.gov/pubmed/19416841 (Barboric 2009)]).
| |
| − | | |
| − | 7SK snRNA also inhibits APOBEC3C deaminase activity and sequesters it to the nucleolus, suggesting broader role for 7SK RNA in regulating key nuclear functions ([http://www.ncbi.nlm.nih.gov/pubmed/17381310 (He 2007)]).
| |
| | | | |
| | ===Disease=== | | ===Disease=== |
| − | colon adenocarcinoma <ref name="ref1" />
| + | Angelman syndrome (AS)<ref name="ref1" /> |
| | | | |
| | ===Evolution=== | | ===Evolution=== |
| Line 64: |
Line 38: |
| | | | |
| | ==Labs working on this lncRNA== | | ==Labs working on this lncRNA== |
| − | Please input related labs here.
| + | * Department of Genetics and Developmental Biology, University of Connecticut Health Center, Farmington, CT 06030, USA. |
| | | | |
| | ==References== | | ==References== |
| | <references> | | <references> |
| − | <ref name="ref1"> Shahriyari L. Effect of normalization methods on the performance of supervised | + | <ref name="ref1"> Landers M, Bancescu DL, Le Meur E, et al. Regulation of the large (approximately 1000 kb) imprinted murine Ube3a antisense transcript by alternative exons upstream of Snurf/Snrpn[J]. Nucleic Acids Res, 2004, 32: 3480-3492. |
| − | learning algorithms applied to HTSeq-FPKM-UQ data sets: 7SK RNA expression as a
| |
| − | predictor of survival in patients with colon adenocarcinoma. Brief Bioinform.
| |
| − | 2017 Nov 3. doi: 10.1093/bib/bbx153.
| |
| | </ref>(1) | | </ref>(1) |
| | </references> | | </references> |
| | [http://www.lncrnadb.org/7SK/ Annotation originally sourced from lncRNAdb]. | | [http://www.lncrnadb.org/7SK/ Annotation originally sourced from lncRNAdb]. |
| − |
| |
| − | {{basic|
| |
| − | tID = NONHSAT113149|
| |
| − | source = NONCODE4.0|
| |
| − | same = ,|
| |
| − | classification = intergenic|
| |
| − | length = 332 nt|
| |
| − | location = chr6+:52860418..52860749|
| |
| − | number = 1|
| |
| − | exons = 52860418..52860749|
| |
| − | context = <html><div align="center">
| |
| − | <iframe src="http://lncrna.big.ac.cn/view/?data=species/human&loc=chr6:52860418..52860749&tracklist=0&overview=0&tracks=DNA,RefGene,lncRNA" style=" border-width:0 " width="100%" height="250" scrolling="yes"></iframe>
| |
| − | </div></html>|
| |
| − | sequence = <dnaseq>GGATGTGAGGGCGATCTGGCTGCGACATCTGTCACCCCATTGATCGCCAGGGTTGATTCGGCTGATCTGGCTGGCTAGGCGGGTGTCCCCTTCCTCCCTCACCGCTCCATGTGCGTCCCTCCCGAAGCTGCGCGCTCGGTCGAAGAGGACGACCATCCCCGATAGAGGAGGACCGGTCTTCGGTCAAGGGTATACGAGTAGCTGCGCTCCCCTGCTAGAACCTCCAAACAAGCTCTCAAGGTCCATTTGTAGGAGAACGTAGGGTAGTCAAGCTTCCAAGACTCCAGACACATCCAAATGAGGCGCTGCATGTGGCAGTCTGCCTTTCTTTT</dnaseq>|
| |
| − | }}
| |
| − | [[Category:Intergenic]][[Category:NONHSAG043942]][[Category:Transcripts]]
| |
Annotated Information
Name
Approved symbol: SNHG14
Approved name: small nucleolar RNA host gene 14
HGNC ID: HGNC:37462
Previous names: UBE3A antisense RNA 1 (non-protein coding); small nucleolar RNA host gene 14 (non-protein coding)
Previous symbols: UBE3A-AS1
Alias symbols: NCRNA00214; UBE3A-AS; UBE3A-ATS
Alias names: non-protein coding RNA 214; UBE3A antisense
RefSeq ID: NR_146177
LncBook ID: HSALNT0217643
Characteristics
Human UBE3A-ATS is a large (∼460 kb) transcript that initiates in the PWS-IC and extends distally through SNURF/SNRPN, IPW and overlaps UBE3A, alternatively spliced and serves as a host for several types of small nucleolar RNA (snoRNA) of the box C/D class that are contained within the introns and are expressed upon processing of the paternal copy of the host transcript[1].
Expression
More distal part of UBE3A-ATS, which overlaps UBE3A, is brain specific[1].
Regulation
Please input information here.
Function
The mechanism of epigenetic silencing of UBE3A has been associated with a brain specific paternal antisense (UBE3A-ATS) transcript in human and mouse[1].
Disease
Angelman syndrome (AS)[1]
Evolution
Please input evolution information here.
Labs working on this lncRNA
- Department of Genetics and Developmental Biology, University of Connecticut Health Center, Farmington, CT 06030, USA.
References
- ↑ 1.0 1.1 1.2 1.3 Landers M, Bancescu DL, Le Meur E, et al. Regulation of the large (approximately 1000 kb) imprinted murine Ube3a antisense transcript by alternative exons upstream of Snurf/Snrpn[J]. Nucleic Acids Res, 2004, 32: 3480-3492.
Annotation originally sourced from lncRNAdb.
