Difference between revisions of "NONHSAT131969"
(Created page with "Please input one-sentence summary here.
==Annotated Information==
===Transcriptomic Nomeclature===
Please input transcriptomic nomeclature information here.
===Functio...") |
|||
Line 42: | Line 42: | ||
sequence = <dnaseq>tctttttttttattaactggcatattttgagagagaaacttccccttcccaactatttgttgtttttatttttaaatttttttttaacttgctgaggtttgctggtattcctatatttattctgcctgaagttgatgtatttaatcagttttggaaaatcattggttattatgtctttaaatatttctagtgtctttgtttc</dnaseq>| | sequence = <dnaseq>tctttttttttattaactggcatattttgagagagaaacttccccttcccaactatttgttgtttttatttttaaatttttttttaacttgctgaggtttgctggtattcctatatttattctgcctgaagttgatgtatttaatcagttttggaaaatcattggttattatgtctttaaatatttctagtgtctttgtttc</dnaseq>| | ||
}} | }} | ||
− | [[Category:Intergenic]] | + | [[Category:Intergenic]][[Category:NONHSAG052612]] |
Revision as of 11:47, 13 October 2014
Please input one-sentence summary here.
Contents
Annotated Information
Transcriptomic Nomeclature
Please input transcriptomic nomeclature information here.
Function
Please input function information here.
Regulation
Please input regulation information here.
Expression
Please input expression information here.
Allelic Information and Variation
Please input allelic information and variation information here.
Evolution
Please input evolution information here.
You can also add sub-section(s) at will.
Labs working on this lncRNA
Please input related labs here.
References
Please input cited references here.
Basic Information
Transcript ID |
NONHSAT131969 |
Source |
NONCODE4.0 |
Same with |
, |
Classification |
intergenic |
Length |
202 nt |
Genomic location |
chr9-:79586882..79587641 |
Exon number |
2 |
Exons |
79586882..79587024,79587583..79587641 |
Genome context |
|
Sequence |
000001 tctttttttt tattaactgg catattttga gagagaaact tccccttccc aactatttgt tgtttttatt tttaaatttt 000080
000081 tttttaactt gctgaggttt gctggtattc ctatatttat tctgcctgaa gttgatgtat ttaatcagtt ttggaaaatc 000160 000161 attggttatt atgtctttaa atatttctag tgtctttgtt tc |