Difference between revisions of "ENST00000444042.2"

From LncRNAWiki
Jump to: navigation, search
 
(One intermediate revision by one other user not shown)
Line 1: Line 1:
−
Please input one-sentence summary here.
+
''CYP4A22-AS1'', Long non-coding RNA with enhancer-like function in human
  
 
==Annotated Information==
 
==Annotated Information==
−
===Name===
+
===Approved Symbol===
−
CYP4A22-AS1
+
''CYP4A22-AS1''
 +
===Approved Name===
 +
''CYP4A22-AS1'': CYP4A22 Antisense RNA 1
 +
NcRNA-A3
  
 
===Characteristics===
 
===Characteristics===
−
Spliced, up to 4 exons, ~920 nt transcript ([http://www.ncbi.nlm.nih.gov/pubmed/20887892 Arom (2010)]).
+
''CYP4A22-AS1'' gene is Spliced, up to 4 exons, ~920 nt transcript.Its loci covers ~ 80kb and is antisense to CYP4A22 and CYP4Z1.<ref name="ref1" />
−
Loci covers ~ 80kb and is antisense to CYP4A22 and CYP4Z1 ([http://www.ncbi.nlm.nih.gov/pubmed/20887892 Arom (2010)]).
+
''CYP4A22-AS1'' is transcribed bidirectionally, downstream from TAL1 and PDZK1IP1 on same strand.<ref name="ref1" />
−
 
+
In-vitro translation of ''CYP4A22-AS1'' showed no sign of protein product.<ref name="ref1" />
−
Transcribed bidirectionally with [http://www.lncrnadb.org/Detail.aspx?TKeyID=276 PDZK1IP1-AS1], downstream from TAL1 and PDZK1IP1 on same strand ([http://www.ncbi.nlm.nih.gov/pubmed/20887892 Arom (2010)]).
 
−
 
 
−
In-vitro translation showed no sign of protein product ([http://www.ncbi.nlm.nih.gov/pubmed/20887892 Arom (2010)]).
 
−
 
 
−
===Transcriptomic Nomeclature===
 
−
Please input transcriptomic nomeclature information here.
 
  
 
===Function===
 
===Function===
−
CYP4A22-AS1 expression stimulates TAL1 gene expression (in MCF7 cells) ([http://www.ncbi.nlm.nih.gov/pubmed/20887892 Arom (2010)]).
+
''CYP4A22-AS1'' expression stimulates TAL1 gene expression (in MCF7 cells).<ref name="ref1" />
  
 
===Regulation===
 
===Regulation===
 
Please input regulation information here.
 
Please input regulation information here.
 +
 +
===Disease===
 +
Please input disease information here.
  
 
===Expression===
 
===Expression===
−
Expressed and functionally characterized in MCF7 cells ([http://www.ncbi.nlm.nih.gov/pubmed/20887892 Arom (2010)]).
+
Expressed and functionally of ''CYP4A22-AS1'' characterized in MCF7 cells. <ref name="ref1" />
−
 
+
''CYP4A22-AS1'' identified as enriched in K562, HelaS3 and HepG2 nuclear fractions. <ref name="ref2" />
−
CYP4A22-AS1 identified as enriched in K562, HelaS3 and HepG2 nuclear fractions ([http://www.ncbi.nlm.nih.gov/pubmed/22955988 Derrien (2012)]).
 
−
 
 
−
===Allelic Information and Variation===
 
−
Please input allelic information and variation information here.
 
−
 
 
−
===Evolution===
 
−
Please input evolution information here.
 
−
 
 
−
You can also add sub-section(s) at will.
 
  
 
==Labs working on this lncRNA==
 
==Labs working on this lncRNA==
−
Please input related labs here.
+
*The Wistar Institute, 3601 Spruce Street, Philadelphia
 +
*Centre for Genomic Regulation (CRG), UPF, Barcelona, Spain
  
 
==References==
 
==References==
−
Please input cited references here.
+
<references>
 +
<ref name="ref1">  Derrien T & Guigo R. Long non-coding RNAs with enhancer-like function in human cells[J]. M S-Med Sci. 2011, 27(4):359-361 </ref>(1)
 +
<ref name="ref2">  Derrien T, Johnson R, Bussotti G, Tanzer A, Djebali S, Tilgner H et al. The GENCODE v7 catalog of human long noncoding RNAs: Analysis of their gene structure, evolution, and expression[J]. Genome Res. 2012, 22(9):1775-1789
 +
</ref>(2)
 +
</references>
  
−
{{basic|
+
===Sequence===
−
tID = ENST00000444042.2|
+
Please input sequence here.
−
source = Gencode19|
 
−
same = lnc-PDZK1IP1-2:1,NONHSAT003050|
 
−
classification = overlapping(AS),antisense|
 
−
length = 921 nt|
 
−
location = chr1-:47562325..47644943|
 
−
number = 4|
 
−
exons = 47562325..47562849,47642707..47642741,47643843..47644121,47644862..47644943|
 
−
context = <html><div align="center">
 
−
<iframe src="http://lncrna.big.ac.cn/view/?data=species/human&loc=chr1:47562325..47644943&tracklist=0&overview=0&tracks=DNA,RefGene,lncRNA" style=" border-width:0 " width="100%" height="250" scrolling="yes"></iframe>
 
−
</div></html>|
 
−
sequence = <dnaseq>GAAGTTGAGCTTCAGGCGCGGCTCTTCCCCGTCACACTGGGACCGGACGCATTTCCATGGCGTGGTCCCAGGAACCTCTCAGAGTGAACTGAATTGGATGCAAGATCACGGTGCGTCAGAGCTAGCAAGATCCTTAGGATCATTTAGCCTGGTTTACTAATATTACACTATGGAATTTAAGCCCAAGGAATGGAGAGTACCCGACGAGCGTTATGTAAGGAGTCGAGTGAGAAGTAAGCTGGATGCTCTGCTTGGCTGGCAGGTACAGAATGTGCCAGACCCATCTGTACCAGCCTGGATCTCTTGAGGCATCAGCACAATGGACCTGGCCACACCAGTTTATTCCACACCGCTGAGGCTGGTCTTTGAGGAATCACCACACTGTCTTCCACAATGCACCATGGAATACTATGCAGACATAAAAAGGAATGAGATCATGTCGTTTGCAGGGACATGGATGGAGCTAGAAGCCATTATCCTCAGAAAACTAACACAGGAACAGAAAACCAAATACCACATGTTCTCACTTATAAGTGGGAGCTGAATGATGAGAACACATGGACACGTGGTGCGGGAACAATACACCTGGGGCCTGTTGGAGGGTGGGGGCTGGGAGGAGGGAGAGCATCAAGAATAGCTAATGAGGCCAGGCACAGTGGCTCACGCCTGTAATCCTAGCATTTTGGGAGGCTGAGGCGGGCAGATCATTTGAGGTCAGGAGTTTGAGACCAGCCTGGCCAATATGGTGAAACCCCGTCTCTATTAAAAATACAAAAATATTAGCCAGGCATGGTGGCAATGCCCGTAGTCCCTGCAACTTGGGAGGCTGAGGCAGGAGAATCGTTTGAACCTGGGAGGTGGAGTTTGCAGTGAGCCAAGATCGCGCCACTGCACTCCAGCCTGGGCGACAGAGTGAGGCTC</dnaseq>|
 
−
}}
 
−
[[Category:Overlapping(AS)]]
 
−
[[Category:Antisense]][[Category:lnc-PDZK1IP1-2]][[Category:NONHSAG001360]][[Category:ENSG00000225506.2]][[Category:Transcripts]][[Category:Transcripts]]
 

Latest revision as of 06:02, 22 November 2018

CYP4A22-AS1, Long non-coding RNA with enhancer-like function in human

Annotated Information

Approved Symbol

CYP4A22-AS1

Approved Name

CYP4A22-AS1: CYP4A22 Antisense RNA 1 NcRNA-A3

Characteristics

CYP4A22-AS1 gene is Spliced, up to 4 exons, ~920 nt transcript.Its loci covers ~ 80kb and is antisense to CYP4A22 and CYP4Z1.[1] CYP4A22-AS1 is transcribed bidirectionally, downstream from TAL1 and PDZK1IP1 on same strand.[1] In-vitro translation of CYP4A22-AS1 showed no sign of protein product.[1]

Function

CYP4A22-AS1 expression stimulates TAL1 gene expression (in MCF7 cells).[1]

Regulation

Please input regulation information here.

Disease

Please input disease information here.

Expression

Expressed and functionally of CYP4A22-AS1 characterized in MCF7 cells. [1] CYP4A22-AS1 identified as enriched in K562, HelaS3 and HepG2 nuclear fractions. [2]

Labs working on this lncRNA

  • The Wistar Institute, 3601 Spruce Street, Philadelphia
  • Centre for Genomic Regulation (CRG), UPF, Barcelona, Spain

References

  1. ↑ 1.0 1.1 1.2 1.3 1.4 Derrien T & Guigo R. Long non-coding RNAs with enhancer-like function in human cells[J]. M S-Med Sci. 2011, 27(4):359-361
  2. ↑ Derrien T, Johnson R, Bussotti G, Tanzer A, Djebali S, Tilgner H et al. The GENCODE v7 catalog of human long noncoding RNAs: Analysis of their gene structure, evolution, and expression[J]. Genome Res. 2012, 22(9):1775-1789

Sequence

Please input sequence here.

Retrieved from "https://ngdc.cncb.ac.cn/lncrnawiki1/index.php?title=ENST00000444042.2&oldid=1275497"