Difference between revisions of "FLICR"

From LncRNAWiki
Jump to: navigation, search
 
(41 intermediate revisions by 3 users not shown)
Line 1: Line 1:
 +
''FLICR'', a long noncoding RNA, modulates Foxp3 expression and autoimmunity
  
 
==Annotated Information==
 
==Annotated Information==
 +
===Approved Symbol===
 +
''FLICR''
 
===Name===
 
===Name===
FLICR:FOXP3 regulating long intergenic non-coding RNA<ref name="ref1" />
+
''FLICR'': FOXP3 regulating long intergenic non-coding RNA <ref name="ref1" />
 +
4930524L23Rik <ref name="ref1" />
  
 
===Characteristics===
 
===Characteristics===
FLICR is present across mammalian species with clear stretches of sequence conservation and FLICR's Treg-specific expression and genomic localization, partially overlapping Foxp3, are too striking to ignore. In addition, Flicr modulates Foxp3 expression, most visibly in a subset of Tregs and this subtle fine-tuning has important consequences for autoimmune disease, thus subtly modulating the Janus-faced dominant suppressive function of Tregs.<ref name="ref1" />
+
''FLICR'' neighbors Foxp3 in mouse and human genomes <ref name="ref1" />.
 +
''FLICR'' lncRNA is present across mammalian species with clear stretches of sequence conservation and ''FLICR'' transcripts in the mouse genome have four different isoforms of varying lengths (566,737, 3,278, and 4,150 bp) that share two exonic elements and an
 +
intron, located 1.8 kb upstream of the Foxp3 transcriptional start site (TSS) <ref name="ref1" />.
  
 
===Function===
 
===Function===
Flicr modifies chromatin accessibility in the conserved noncoding sequence 3 (CNS3)/Accessible region 5(AR5) region of Foxp3. And like many lncRNAs, Flicr’s molecular effects are subtle, but by curtailing Treg activity, Flicr markedly promotes autoimmune diabetes and, conversely, restrainsantiviral responses. This mechanism of FoxP3 control may allow escape from dominant Treg control during infection or cancer, at the cost of heightened autoimmunity.<ref name="ref1" />
+
''FLICR'' (Foxp3 long intergenic noncoding RNA) is a negative regulator that regulates key transcription factor FoxP3 expression in Tregs, resulting in twofold- to fivefold-lower levels of FoxP3 protein <ref name="ref1" />. Flicr acts only in cis. It does not affect DNA methylation, but modifies chromatin accessibility in the conserved noncoding sequence 3 (CNS3)/Accessible region 5(AR5) region of Foxp3 <ref name="ref1" />. As a result, ''FLICR'' curtails Treg activity, markedly promotes autoimmune diabetes and, conversely, restrains antiviral responses <ref name="ref1" />. Also, this mechanism of FoxP3 control may allow escape from dominant Treg control during infection or cancer, at the cost of heightened autoimmunity <ref name="ref1" />.
  
 
===Regulation===
 
===Regulation===
IL-2 can indirectly enhance Foxp3 expression by repressing Flicrhas.
+
IL-2 can repress ''FLICR'' to enhance Foxp3 expression <ref name="ref1" />.
Flicr's expression is also curtailed in conditions of heightened Treg activation and functionality, in tissue Tregs and after TCR activation.<ref name="ref1" />
+
''FLICR'' expression is also curtailed in conditions of heightened Treg activation and functionality <ref name="ref1" />.
 +
 
 +
===Diseases===
 +
*Autoimmune diabetes <ref name="ref1" />
 +
*Antiviral response <ref name="ref1" />  
  
 
===Expression===
 
===Expression===
Flicr is an lncRNA Specifically Expressed in Tregs.<ref name="ref1" />
+
''FLICR'' is specifically expressed in Tregs <ref name="ref1" />.
 +
 
 +
===Evolution===
 +
''FLICR'' is highly conserved across mammalian species <ref name="ref1" />.
  
===Sequence===
 
>NR_147988.1 Homo sapiens FOXP3 regulating long intergenic non-coding RNA (FLICR), long non-coding RNA
 
<dnaseq>CAGGCCCATTCTGGGCTTTTCCAGAAGGGTCTGAAGCCAGTCTTGTAGAGGGCTGGAGTGGTTGTTGGAC
 
GACTAGAACCCTGGGCTTTGCAGGGTGCTGGGAGCT</dnaseq>
 
 
==Labs working on this lncRNA==
 
==Labs working on this lncRNA==
 
*Division of Immunology, Department of Microbiology and Immunobiology, Harvard Medical School, Boston, MA 02115.
 
*Division of Immunology, Department of Microbiology and Immunobiology, Harvard Medical School, Boston, MA 02115.
 +
 
==References==
 
==References==
 
<references>
 
<references>
 
<ref name="ref1">
 
<ref name="ref1">
Zemmour D, Pratama A, Loughhead SM, Mathis D, Benoist C. Flicr, a long
+
Zemmour D, Pratama A, Loughhead SM, Mathis D, Benoist C. Flicr, a long noncoding RNA, modulates Foxp3 expression and autoimmunity. Proc Natl Acad Sci U S A. 2017 Apr 25;114(17):E3472-E3480.
noncoding RNA, modulates Foxp3 expression and autoimmunity. Proc Natl Acad Sci U  
+
</ref>(1)
S A. 2017 Apr 25;114(17):E3472-E3480.
 
</ref>
 
 
</references>
 
</references>
 +
 +
===Sequence===
 +
>gi|110437700|ref|NR_147988.1|Homo sapiens FOXP3 regulating long intergenic non-coding RNA (FLICR), long non-coding RNA
 +
<dnaseq>CAGGCCCATTCTGGGCTTTTCCAGAAGGGTCTGAAGCCAGTCTTGTAGAGGGCTGGAGTGGTTGTTGGAC
 +
GACTAGAACCCTGGGCTTTGCAGGGTGCTGGGAGCT</dnaseq>

Latest revision as of 05:02, 26 August 2019

FLICR, a long noncoding RNA, modulates Foxp3 expression and autoimmunity

Annotated Information

Approved Symbol

FLICR

Name

FLICR: FOXP3 regulating long intergenic non-coding RNA [1] 4930524L23Rik [1]

Characteristics

FLICR neighbors Foxp3 in mouse and human genomes [1]. FLICR lncRNA is present across mammalian species with clear stretches of sequence conservation and FLICR transcripts in the mouse genome have four different isoforms of varying lengths (566,737, 3,278, and 4,150 bp) that share two exonic elements and an intron, located 1.8 kb upstream of the Foxp3 transcriptional start site (TSS) [1].

Function

FLICR (Foxp3 long intergenic noncoding RNA) is a negative regulator that regulates key transcription factor FoxP3 expression in Tregs, resulting in twofold- to fivefold-lower levels of FoxP3 protein [1]. Flicr acts only in cis. It does not affect DNA methylation, but modifies chromatin accessibility in the conserved noncoding sequence 3 (CNS3)/Accessible region 5(AR5) region of Foxp3 [1]. As a result, FLICR curtails Treg activity, markedly promotes autoimmune diabetes and, conversely, restrains antiviral responses [1]. Also, this mechanism of FoxP3 control may allow escape from dominant Treg control during infection or cancer, at the cost of heightened autoimmunity [1].

Regulation

IL-2 can repress FLICR to enhance Foxp3 expression [1]. FLICR expression is also curtailed in conditions of heightened Treg activation and functionality [1].

Diseases

  • Autoimmune diabetes [1]
  • Antiviral response [1]

Expression

FLICR is specifically expressed in Tregs [1].

Evolution

FLICR is highly conserved across mammalian species [1].

Labs working on this lncRNA

  • Division of Immunology, Department of Microbiology and Immunobiology, Harvard Medical School, Boston, MA 02115.

References

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 Zemmour D, Pratama A, Loughhead SM, Mathis D, Benoist C. Flicr, a long noncoding RNA, modulates Foxp3 expression and autoimmunity. Proc Natl Acad Sci U S A. 2017 Apr 25;114(17):E3472-E3480.

Sequence

>gi|110437700|ref|NR_147988.1|Homo sapiens FOXP3 regulating long intergenic non-coding RNA (FLICR), long non-coding RNA

000001 CAGGCCCATT CTGGGCTTTT CCAGAAGGGT CTGAAGCCAG TCTTGTAGAG GGCTGGAGTG GTTGTTGGAC GACTAGAACC 000080
000081 CTGGGCTTTG CAGGGTGCTG GGAGCT