Difference between revisions of "Lnc-EPCAM-1:2"

From LncRNAWiki
Jump to: navigation, search
 
(One intermediate revision by the same user not shown)
Line 2: Line 2:
  
 
==Annotated Information==
 
==Annotated Information==
−
===Approved Symbol===
+
Approved symbol: ''BCYRN1''
−
''BCYRN1''
+
 
−
===Name===
+
Approved name: ''BCYRN1'' : brain cytoplasmic RNA 1
−
''BCYRN1'': brain cytoplasmic RNA 1 <ref name="ref1" /><ref name="ref2" />,
+
 
−
BC200 <ref name="ref1" /><ref name="ref2" />
+
Alias symbols: BC200, BC200a, NCRNA00004, LINC00004
 +
 
 +
HGNC ID : HGNC:1022
 +
 
 +
RefSeq ID: NR_001568
 +
 
 +
LncBook ID: HSALNT0289486
  
 
===Characteristics===
 
===Characteristics===
Line 32: Line 38:
 
''BCYRN1'' expression decreases with aging but is upregulated in Alzheimer's disease (AD). In AD affected brain regions, expression increased with disease severity  <ref name="ref3" />.
 
''BCYRN1'' expression decreases with aging but is upregulated in Alzheimer's disease (AD). In AD affected brain regions, expression increased with disease severity  <ref name="ref3" />.
 
''BCYRN1'' also suggested to localise to dendrites  <ref name="ref3" />.
 
''BCYRN1'' also suggested to localise to dendrites  <ref name="ref3" />.
 +
===Evolution===
 +
''BCYRN1'' arose after ''Anthropoidea'' diverged from prosimians and is conserved in ''Anthropoidea''<ref name="ref11" />.
  
 
===Disease===
 
===Disease===
Line 44: Line 52:
 
*Stomach cancer <ref name="ref3" />
 
*Stomach cancer <ref name="ref3" />
 
*Tongue cancer <ref name="ref3" />
 
*Tongue cancer <ref name="ref3" />
−
 
+
===Sequence===
 +
>gi|618|ref|NR_001568.1|Homo sapiens brain cytoplasmic RNA 1 (BCYRN1), long non-coding RNA
 +
<dnaseq>GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCTCTCAGGGAGGCTAAGAGGCGGGAGGATAGCTTGA
 +
GCCCAGGAGTTCGAGACCTGCCTGGGCAATATAGCGAGACCCCGTTCTCCAGAAAAAGGAAAAAAAAAAA
 +
CAAAAGACAAAAAAAAAATAAGCGTAACTTCCCTCAAAGCAACAACCCCCCCCCCCCTTT</dnaseq>
 
==Labs working on this lncRNA==
 
==Labs working on this lncRNA==
 
*School of Biochemistry and Cell Biology, Western Gateway Building, University College Cork, Cork, Ireland
 
*School of Biochemistry and Cell Biology, Western Gateway Building, University College Cork, Cork, Ireland
Line 75: Line 87:
 
<ref name="ref10">  Lin D., Pestova T.V., Hellen C.U.T., Tiedge H. Translational control by a small RNA: dendritic BC1 RNA targets the eukaryotic initiation factor 4A helicase mechanism. Mol. Cell Biol. 2008;28:3008–3019.
 
<ref name="ref10">  Lin D., Pestova T.V., Hellen C.U.T., Tiedge H. Translational control by a small RNA: dendritic BC1 RNA targets the eukaryotic initiation factor 4A helicase mechanism. Mol. Cell Biol. 2008;28:3008–3019.
 
</ref>(10)
 
</ref>(10)
 +
<ref name="ref11">  Kuryshev V Y , Skryabin B V , Kremerskothen J , et al. Birth of a gene: locus of neuronal BC200 snmRNA in three prosimians and human BC200 pseudogenes as archives of change in the Anthropoidea lineage[J]. Journal of Molecular Biology, 2001, 309(5):0-1066.
 +
</ref>(11)
 
</references>
 
</references>
−
 
−
===Sequence===
 
−
>gi|618|ref|NR_001568.1|Homo sapiens brain cytoplasmic RNA 1 (BCYRN1), long non-coding RNA
 
−
<dnaseq>GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCTCTCAGGGAGGCTAAGAGGCGGGAGGATAGCTTGA
 
−
GCCCAGGAGTTCGAGACCTGCCTGGGCAATATAGCGAGACCCCGTTCTCCAGAAAAAGGAAAAAAAAAAA
 
−
CAAAAGACAAAAAAAAAATAAGCGTAACTTCCCTCAAAGCAACAACCCCCCCCCCCCTTT</dnaseq>
 

Latest revision as of 01:54, 13 August 2019

BCYRN1-The shortest, long, non-coding RNA associated with cancer

Annotated Information

Approved symbol: BCYRN1

Approved name: BCYRN1 : brain cytoplasmic RNA 1

Alias symbols: BC200, BC200a, NCRNA00004, LINC00004

HGNC ID : HGNC:1022

RefSeq ID: NR_001568

LncBook ID: HSALNT0289486

Characteristics

BCYRN1 is a shortest known long noncoding RNA with a length of 200bps[1]. BCYRN1 is sense-transcribed from its gene locus situated on human chromosome 2 between the protein-coding genes for calmodulin 2 (CALM2) and epithelial cellular adhesion molecule (EPCAM)[2][3]. BCYRN1 is relatively recent, no orthologs of BCYRN1 have been identified outside of the primate order [4]. BCYRN1 is found in the primate brain, Among neural cells, BCYRN1 is highly expressed in dendrites, where is it thought to play a role in local translational control [1]. BCYRN1 is a tissue-specific Pol III transcript, altering the view that Pol III was only responsible for the synthesis of transfer RNA (tRNA) and 5 S ribosomal RNA [5][6][7]. BCYRN1 RNA sequence revealed three distinct sequence domains: a 5′ Alu element, a central adenosine-rich region and a 3′, 43-nucleotide, unique region containing a cytosine-rich stretch [8]. BCYRN1 has a 5′ Alu element that has very high sequence homology to the Alu-J repetitive element found in the human genome and the Alu domain of 7SL RNA [8].

Function

BCYRN1 is important in several key features of cancer – like cell proliferation, survival and migration [1]. BCYRN1 may act as a linker between certain proteins and mRNAs, allowing transient regulation and/or modification [1]. BCYRN1 exerts its translational inhibitory effects by acting as a competitor for PABP [9]. BCYRN1and BC1 interfere with eIF4A's catalytic mechanism by blocking the factor's helicase activity, while enhancing its ATPase activity [10]. BCYRN1 is linked wit necrosis [1].

Regulation

TATA box and internal promoter elements play a critical role in transcription of BCYRN1 [1].

Expression

long noncoding RNA BCYRN1 is expressed predominantly in different regions of the brain. It also shows low level expression in testis but not in other normal tissues examined [1] [8]. BCYRN1 is disregulated in cancer and is expressed in a number of human tumours but not in corresponding normal [1]. BCYRN1 expression decreases with aging but is upregulated in Alzheimer's disease (AD). In AD affected brain regions, expression increased with disease severity [1]. BCYRN1 also suggested to localise to dendrites [1].

Evolution

BCYRN1 arose after Anthropoidea diverged from prosimians and is conserved in Anthropoidea[11].

Disease

  • Alzheimer's disease [1]
  • Breast cancer [1]
  • Cervix cancer [1]
  • Colon cancer [1]
  • Lung cancer [1]
  • Oesophagus cancer [1]
  • Ovary cancer [1]
  • Parotid cancer [1]
  • Stomach cancer [1]
  • Tongue cancer [1]

Sequence

>gi|618|ref|NR_001568.1|Homo sapiens brain cytoplasmic RNA 1 (BCYRN1), long non-coding RNA

000001 GGCCGGGCGC GGTGGCTCAC GCCTGTAATC CCAGCTCTCA GGGAGGCTAA GAGGCGGGAG GATAGCTTGA GCCCAGGAGT 000080
000081 TCGAGACCTG CCTGGGCAAT ATAGCGAGAC CCCGTTCTCC AGAAAAAGGA AAAAAAAAAA CAAAAGACAA AAAAAAAATA 000160
000161 AGCGTAACTT CCCTCAAAGC AACAACCCCC CCCCCCCTTT

Labs working on this lncRNA

  • School of Biochemistry and Cell Biology, Western Gateway Building, University College Cork, Cork, Ireland
  • Department of Clinical Laboratory, Qilu Hospital, Shandong University, Jinan, Shandong Province, China
  • Department of Laboratory, Yuhuangding Hospital, Qingdao University Medical College, Yantai, Shandong Province, China
  • Department of Clinical Laboratory, The Affiliated Hospital of Qingdao University, Qingdao, Shandong Province, China
  • Clinical Medicine of Undergraduate, Taishan Medical University, Taian, Shandong Province, China
  • Wakayama Medical University, Wakayama, Wakayama, Japan

References

  1. ↑ 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 Samson J, Cronin S & Dean K. BC200 (BCYRN1)–The shortest, long, non-coding RNA associated with cancer[J]. Non-coding RNA research. 2018.
  2. ↑ Basile V., Vicente A., Martignetti J.A., Skryabin B.V., Brosius J., Kennedy J.L. Assignment of the human BC200 RNA gene (BCYRN1) to chromosome 2p16 by radiation hybrid mapping. Cytogenet. Cell Genet. 1998;82:271–272.
  3. ↑ Ludwig A., Rozhdestvensky T.S., Kuryshev V.Y., Schmitz J., Brosius J. An unusual primate locus that attracted two independent Alu insertions and facilitates their transcription. J. Mol. Biol. 2005;350:200–210.
  4. ↑ Martignetti J.A., Brosius J. BC200 RNA : a neural RNA polymerase III product encoded by a monomeric Alu element. Proc. Natl. Acad. Sci. Unit. States Am. 1993;90:11563–11567.
  5. ↑ Martignetti J.A., Brosius J. BC200 RNA : a neural RNA polymerase III product encoded by a monomeric Alu element. Proc. Natl. Acad. Sci. Unit. States Am. 1993;90:11563–11567.
  6. ↑ Dieci G., Fiorino G., Castelnuovo M., Teichmann M., Pagano A. The expanding RNA polymerase III transcriptome. Trends Genet. 2007;23:614–622.
  7. ↑ White R.J. Transcription by RNA polymerase III: more complex than we thought. Nat. Rev. Genet. 2011;12:459–463.
  8. ↑ 8.0 8.1 8.2 Tiedge H., Chen W., Brosius J. Primary structure, neural-specific expression, and dendritic location of human BC200 RNA. J. Neurosci. 1993;13 2382 LP-2390.
  9. ↑ Khanam T., Rozhdestvensky T.S., Bundman M., Galiveti C.R., Handel S., Sukonina V. Two primate-specific small non-protein-coding RNAs in transgenic mice: neuronal expression, subcellular localization and binding partners. Nucleic Acids Res. 2007;35:529–539.
  10. ↑ Lin D., Pestova T.V., Hellen C.U.T., Tiedge H. Translational control by a small RNA: dendritic BC1 RNA targets the eukaryotic initiation factor 4A helicase mechanism. Mol. Cell Biol. 2008;28:3008–3019.
  11. ↑ Kuryshev V Y , Skryabin B V , Kremerskothen J , et al. Birth of a gene: locus of neuronal BC200 snmRNA in three prosimians and human BC200 pseudogenes as archives of change in the Anthropoidea lineage[J]. Journal of Molecular Biology, 2001, 309(5):0-1066.
Retrieved from "https://ngdc.cncb.ac.cn/lncrnawiki1/index.php?title=Lnc-EPCAM-1:2&oldid=1276473"