Difference between revisions of "CT70"

From LncRNAWiki
Jump to: navigation, search
(Created page with "==Annotated Information== ===Name=== Approved symbol: CT70 Approved name: cancer/testis associated transcript 70 HGNC ID: HGNC:37195 Previous names: cancer/testis antigen 7...")
 
(→‎Name)
 
(30 intermediate revisions by 2 users not shown)
Line 1: Line 1:
 +
Liver-expressed LXR-induced sequence (LeXis) is a functional lncRNA.
 +
 
==Annotated Information==
 
==Annotated Information==
 
===Name===
 
===Name===
Line 5: Line 7:
 
Approved name: cancer/testis associated transcript 70
 
Approved name: cancer/testis associated transcript 70
  
−
HGNC ID: HGNC:37195
+
HGNC ID: 37195
  
 
Previous names: cancer/testis antigen 70
 
Previous names: cancer/testis antigen 70
Line 12: Line 14:
  
 
RefSeq ID: XR_001746866
 
RefSeq ID: XR_001746866
−
 
−
#LncBook ID: [https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0107279 HSALNT0107279]
 
  
 
===Characteristics ===
 
===Characteristics ===
−
[[File:Functional domains of 7SK RNA..png|right|thumb|Functional domains of 7SK RNA([https://www.ncbi.nlm.nih.gov/pubmed/27251289 (Sallam T 2016)])]]
+
[[File:Schematic representation of the LeXis gene locus on Integrative Genome Viewer (IGV) showing histone marks from LICR ENCODE data.jpg|right|thumb|Schematic representation of the LeXis gene locus([https://www.ncbi.nlm.nih.gov/pubmed/27251289 <ref name="ref3" />])]]
−
 
 
−
Lie in close proximity to the canonical LXR target gene Abca1 in mouse([https://www.ncbi.nlm.nih.gov/pubmed/8139910 (Driscoll 1994)]).
 
−
The 7SK gene is located on chromosome 6, and chromosome 6 is the sole human chromosome that produces 7SK RNA ([https://www.ncbi.nlm.nih.gov/pubmed/8139910 (Driscoll 1994)])
 
−
 
 
−
7SK RNA is capped at its 5' end by BCDIN3, a specific methylase methylphosphate capping enzyme (MePCE) ([http://www.ncbi.nlm.nih.gov/pubmed/17643375 (Jeronimo 2007)]).
 
−
 
 
−
RNAP II was recently found to bind near 7SK promoter, as well as many other known Pol III genes, suggesting that RNAP II may also play a role in regulating their transcription ([http://www.ncbi.nlm.nih.gov/pubmed/20139302 (Raha 2010)]).
 
  
−
In invertebrates, 7SK homologs may have different sizes (such as >400 nt and ~130 nt in drosophilids and nematodes, respectively). ([http://www.ncbi.nlm.nih.gov/pubmed/20139302 (Gruber 2008)]) ([http://www.ncbi.nlm.nih.gov/pubmed/18566019 (Marz 2009)])
+
LeXis, named as "Liver-expressed LXR-induced sequence", it's gene locus Lie in close proximity to the canonical LXR target gene Abca1 in mouse([https://www.ncbi.nlm.nih.gov/pubmed/27251289 <ref name="ref3" />]), was distinct gene with Abca1, almost exclusively located in the insoluble nuclear pellet in fractionation studies, along with the known nuclear lncRNAs XIST and histone H3.
  
 
===Expression===
 
===Expression===
−
Nuclear, highly abundant (one of the most abundant small RNAs in vertebrate cells), first isolated from HeLa nuclear extracts, but ubiquitously expressed.
+
The highly expressed in primary mouse hepatocytes treated with GW3965([http://www.ncbi.nlm.nih.gov/pubmed/27251289 <ref name="ref3" />]) and upregulated in OS(Osteosarcoma) tissues([http://www.ncbi.nlm.nih.gov/pubmed/28744406 <ref name="ref4" />]).
−
 
 
−
RNA sequencing from 11 humans tissues confirmed ubiquitous high expression of 7SK with expression in some tissues being higher than any mRNA ([http://www.ncbi.nlm.nih.gov/pubmed/20668672 (Castle 2010)]).
 
  
 
===Regulation===
 
===Regulation===
−
In the 7SK ribonucleoprotein, Larp7 binds directly to 3′ terminus of 7SK RNA ([https://www.ncbi.nlm.nih.gov/pubmed/18281698 (Krueger 2008)]) ([https://www.ncbi.nlm.nih.gov/pubmed/18483487 (Markert 2008)]), and prevents degradation of 7SK in vivo ([https://www.ncbi.nlm.nih.gov/pubmed/18281698 (Krueger 2008)]).
+
Please input evolution information here.
  
 
===Function===
 
===Function===
−
[[File:Model of hLarp7 recognition of the 7SK.png|right|thumb|Model of hLarp7 recognition of the 7SK 3′end and mechanism of assembly of core 7SK RNP([https://www.ncbi.nlm.nih.gov/pubmed/29946027 (Eichhorn 2018)])]]
+
[[File:LeXis functions as a ceRNA of β-catenin.jpg|right|thumb|LeXis functions as a ceRNA of β-catenin([https://www.ncbi.nlm.nih.gov/pubmed/28744406 <ref name="ref4" />])]]
 +
LeXis binds with heterogeneous ribonucleoprotein Raly which contains both an RNA-binding domain and a leucine-zipper coiled domain, to affect the expression of srebf2 gene, resulting to the change of the level of SREBP-2(sterol regulatory element-binding protein), to modulate cholesterol metabolism([https://www.ncbi.nlm.nih.gov/pubmed/27251289 <ref name="ref3" />
  
−
7SK snRNA functions in transcriptional regulation by interacting with PTEF-B complex ([http://www.ncbi.nlm.nih.gov/pubmed/11713533 (Nguyen 2001)]) ([http://www.ncbi.nlm.nih.gov/pubmed/11713532 (Yang 2001)]), BAF chromatin-remodeling complex ([https://www.ncbi.nlm.nih.gov/pubmed/26878240 (Flynn 2016)]), or hnRNP R ([https://www.ncbi.nlm.nih.gov/pubmed/29507242 (Briese 2018)]). Consistently, it has been found highly enriched in isolated chromatin fractions, which may be related to its role in transcriptional regulation ([http://www.ncbi.nlm.nih.gov/pubmed/20404130 (Mondal 2010)]). In addition to its critical role for controlling transcription, 7SK snRNA is also involved in alternative splicing ([http://www.ncbi.nlm.nih.gov/pubmed/19416841 (Barboric 2009)]) and the localization of protein in nucleolus ([http://www.ncbi.nlm.nih.gov/pubmed/17381310 (He 2007)]). Therefore, 7SK snRNA has a variety of functions in the nuclear, playing important roles in cell growth and differentiation ([http://www.ncbi.nlm.nih.gov/pubmed/11713533 (Nguyen 2001)]) ([http://www.ncbi.nlm.nih.gov/pubmed/11713532 (Yang 2001)]), axon maintenance ([https://www.ncbi.nlm.nih.gov/pubmed/29507242 (Briese 2018)]) and vertebrate development ([http://www.ncbi.nlm.nih.gov/pubmed/19416841 (Barboric 2009)]).  
+
LeXis positively regulates CTNNB1 expression by functioning as a ceRNA against miR-199a to promote osteosarcoma growth([https://www.ncbi.nlm.nih.gov/pubmed/28744406 <ref name="ref4" />.
  
−
7SK snRNA controls RNAP II activity by inhibiting P-TEFb elongation factor, which is a cdk-cyclin kinase that functions as both a general and an HIV-1 Tat-specific transcription factor ([http://www.ncbi.nlm.nih.gov/pubmed/11713533 (Nguyen 2001)]) ([http://www.ncbi.nlm.nih.gov/pubmed/11713532 (Yang 2001)]), with an impact on cell growth and differentiation. Specifically, 7SK snRNA functions as the central scaffold that coordinates protein-protein interactions and, by inhibiting P-TEFb kinase-mediated CTD phosphorylation, regulates RNAP II elongation ([http://www.ncbi.nlm.nih.gov/pubmed/11713533 (Nguyen 2001)]).
+
LeXis expression was upregulated in OS tissues<ref name="ref3" />.
 +
===Disease===
 +
* osteosarcoma<ref name="ref3" />
 +
* colon adenocarcinoma <ref name="ref1" />
  
−
At an early stage of the HIV transcription cycle, elongation is prevented as P-TEFb is recruited to the HIV-1 promoter in a catalytically inactive state bound to the 7SK snRNP and also the Tat trans-activator of transcription protein. The inhibitory 7SK snRNP may be displaced by the nascent TAR HIV RNA that also binds Tat protein, activating P-TEFb kinase and transcriptional elongation ([http://www.ncbi.nlm.nih.gov/pubmed/20562857 (D'Orso 2010)]). Displacement of 7SK may also be performed by cellular RNAs, as indicated by the 3'-untranslated region (~300-nt) of HIC mRNA, which forms complexes with P-TEFb and is necessary and sufficient for stimulation of P-TEFb-dependent transcription of the HIV promoter ([http://www.ncbi.nlm.nih.gov/pubmed/17925858 (Young 2007)]).
+
===Evolution===
 +
Please input evolution information here.
  
−
7SK snRNA inhibits enhancer transcription by modulating nucleosome position. 7SK physically interacts with the BAF chromatin-remodeling complex, recruits BAF to enhancers and inhibits enhancer transcription by modulating chromatin structure ([https://www.ncbi.nlm.nih.gov/pubmed/26878240 (Flynn 2016)]).  
+
==Labs working on this lncRNA==
 +
* No.4 Department of Orthopedics, Cangzhou Central HospitalCangzhou, Hebei Province, China<ref name="ref1" /><ref name="ref4" />.
  
−
In axons, 7SK snRNA interacts with hnRNP R to regulate its function in axon maintenance ([https://www.ncbi.nlm.nih.gov/pubmed/29507242 (Briese 2018)]).
+
* Department of Pathology and Laboratory Medicine, Howard Hughes Medical Institute, University of California, Los Angeles, California 90095, USA.<ref name="ref1" /><ref name="ref3" />.
  
−
7SK snRNP (composed of 7SK snRNA, Hexim1, Larp7/Pip7S, and the P-TEFb subunits CycT1 and Cdk9) is not only critical for controlling transcription, but also for regulating alternative splicing coupled to transcription elongation ([http://www.ncbi.nlm.nih.gov/pubmed/19416841 (Barboric 2009)]).  7SK snRNP disintegration promotes inclusion of an alternative exon via the increased occupancy of P-TEFb, Ser2-phosphorylated (Ser2-P) RNAPII, and the splicing factor SF2/ASF at the minigene ([http://www.ncbi.nlm.nih.gov/pubmed/19416841 (Barboric 2009)]).
+
* Weill Medical College of Cornell University, New York, NY 10021, USA. ytchen@med.cornell.edu<ref name="ref2" />
  
−
7SK snRNA also inhibits APOBEC3C deaminase activity and sequesters it to the nucleolus, suggesting broader role for 7SK RNA in regulating key nuclear functions ([http://www.ncbi.nlm.nih.gov/pubmed/17381310 (He 2007)]).
+
* Department of Medicine, Division of Cardiology, University of California, Los Angeles, California 90095, USA<ref name="ref3" />.
  
−
===Disease===
+
* Departement of Human Genetics, University of California, Los Angeles, California 90095, USA<ref name="ref3" />.
−
colon adenocarcinoma <ref name="ref1" />
 
  
−
===Evolution===
+
* Ionis Pharmaceuticals, Carlsbad, California 92008, USA<ref name="ref3" />.
−
Please input evolution information here.
 
  
−
==Labs working on this lncRNA==
+
* Pasarow Mass Spectrometry Laboratory, NPI-Semel Institute, University of California, Los Angeles, California 90095, USA<ref name="ref3" />.
−
Please input related labs here.
 
  
−
==References==
 
 
<references>
 
<references>
−
<ref name="ref1"> Shahriyari L. Effect of normalization methods on the performance of supervised
+
<ref name="ref1"> Shahriyari L. Effect of normalization methods on the performance of supervised learning algorithms applied to HTSeq-FPKM-UQ data sets: 7SK RNA expression as a predictor of survival in patients with colon adenocarcinoma. Brief Bioinform.2017 Nov 3. doi: 10.1093/bib/bbx153.</ref>
−
learning algorithms applied to HTSeq-FPKM-UQ data sets: 7SK RNA expression as a
+
 
−
predictor of survival in patients with colon adenocarcinoma. Brief Bioinform.
+
<ref name="ref2">Chen YT, Scanlan MJ, Venditti CA, Chua R, Theiler G, Stevenson BJ, Iseli C, Gure AO, Vasicek T, Strausberg RL, Jongeneel CV, Old LJ, Simpson AJ. Identification of cancer/testis-antigen genes by massively parallel signature sequencing. Proc Natl Acad Sci U S A. 2005 May 31;102(22):7940-5. doi: 10.1073/pnas.0502583102. Epub 2005 May 19.</ref>
−
2017 Nov 3. doi: 10.1093/bib/bbx153.
+
 
−
</ref>(1)
+
<ref name="ref3">Sallam T, Jones MC, Gilliland T, Zhang L, Wu X, Eskin A, Sandhu J, Casero D, Vallim TQ, Hong C, Katz M, Lee R, Whitelegge J, Tontonoz P. Feedback modulation of cholesterol metabolism by the lipid-responsive non-coding RNA LeXis. Nature. 2016 Jun 2;534(7605):124-8. doi: 10.1038/nature17674. Epub 2016 May 11.</ref>
 +
 
 +
<ref name="ref4">Wang G, Cui T, Sun L, Peng N, Yang C. Long noncoding RNA LeXis promotes osteosarcoma growth through upregulation of CTNNB1 expression. Am J Cancer Res. 2017 Jul 1;7(7):1577-1587.</ref>
 
</references>
 
</references>
−
[http://www.lncrnadb.org/7SK/ Annotation originally sourced from lncRNAdb].
 
−
 
−
{{basic|
 
−
tID = NONHSAT113149|
 
−
source = NONCODE4.0|
 
−
same = ,|
 
−
classification = intergenic|
 
−
length = 332 nt|
 
−
location = chr6+:52860418..52860749|
 
−
number = 1|
 
−
exons = 52860418..52860749|
 
−
context = <html><div align="center">
 
−
<iframe src="http://lncrna.big.ac.cn/view/?data=species/human&loc=chr6:52860418..52860749&tracklist=0&overview=0&tracks=DNA,RefGene,lncRNA" style=" border-width:0 " width="100%" height="250" scrolling="yes"></iframe>
 
−
</div></html>|
 
−
sequence = <dnaseq>GGATGTGAGGGCGATCTGGCTGCGACATCTGTCACCCCATTGATCGCCAGGGTTGATTCGGCTGATCTGGCTGGCTAGGCGGGTGTCCCCTTCCTCCCTCACCGCTCCATGTGCGTCCCTCCCGAAGCTGCGCGCTCGGTCGAAGAGGACGACCATCCCCGATAGAGGAGGACCGGTCTTCGGTCAAGGGTATACGAGTAGCTGCGCTCCCCTGCTAGAACCTCCAAACAAGCTCTCAAGGTCCATTTGTAGGAGAACGTAGGGTAGTCAAGCTTCCAAGACTCCAGACACATCCAAATGAGGCGCTGCATGTGGCAGTCTGCCTTTCTTTT</dnaseq>|
 
−
}}
 
−
[[Category:Intergenic]][[Category:NONHSAG043942]][[Category:Transcripts]]
 

Latest revision as of 10:34, 19 February 2021

Liver-expressed LXR-induced sequence (LeXis) is a functional lncRNA.

Annotated Information

Name

Approved symbol: CT70

Approved name: cancer/testis associated transcript 70

HGNC ID: 37195

Previous names: cancer/testis antigen 70

Alias symbols: LeXis

RefSeq ID: XR_001746866

Characteristics

Schematic representation of the LeXis gene locus([1])

LeXis, named as "Liver-expressed LXR-induced sequence", it's gene locus Lie in close proximity to the canonical LXR target gene Abca1 in mouse([1]), was distinct gene with Abca1, almost exclusively located in the insoluble nuclear pellet in fractionation studies, along with the known nuclear lncRNAs XIST and histone H3.

Expression

The highly expressed in primary mouse hepatocytes treated with GW3965([1]) and upregulated in OS(Osteosarcoma) tissues([2]).

Regulation

Please input evolution information here.

Function

LeXis functions as a ceRNA of β-catenin([2])

LeXis binds with heterogeneous ribonucleoprotein Raly which contains both an RNA-binding domain and a leucine-zipper coiled domain, to affect the expression of srebf2 gene, resulting to the change of the level of SREBP-2(sterol regulatory element-binding protein), to modulate cholesterol metabolism([https://www.ncbi.nlm.nih.gov/pubmed/27251289 [1]

LeXis positively regulates CTNNB1 expression by functioning as a ceRNA against miR-199a to promote osteosarcoma growth([https://www.ncbi.nlm.nih.gov/pubmed/28744406 [2].

LeXis expression was upregulated in OS tissues[1].

Disease

  • osteosarcoma[1]
  • colon adenocarcinoma [3]

Evolution

Please input evolution information here.

Labs working on this lncRNA

  • No.4 Department of Orthopedics, Cangzhou Central HospitalCangzhou, Hebei Province, China[3][2].
  • Department of Pathology and Laboratory Medicine, Howard Hughes Medical Institute, University of California, Los Angeles, California 90095, USA.[3][1].
  • Weill Medical College of Cornell University, New York, NY 10021, USA. ytchen@med.cornell.edu[4]
  • Department of Medicine, Division of Cardiology, University of California, Los Angeles, California 90095, USA[1].
  • Departement of Human Genetics, University of California, Los Angeles, California 90095, USA[1].
  • Ionis Pharmaceuticals, Carlsbad, California 92008, USA[1].
  • Pasarow Mass Spectrometry Laboratory, NPI-Semel Institute, University of California, Los Angeles, California 90095, USA[1].
  1. ↑ 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 Sallam T, Jones MC, Gilliland T, Zhang L, Wu X, Eskin A, Sandhu J, Casero D, Vallim TQ, Hong C, Katz M, Lee R, Whitelegge J, Tontonoz P. Feedback modulation of cholesterol metabolism by the lipid-responsive non-coding RNA LeXis. Nature. 2016 Jun 2;534(7605):124-8. doi: 10.1038/nature17674. Epub 2016 May 11.
  2. ↑ 2.0 2.1 2.2 2.3 Wang G, Cui T, Sun L, Peng N, Yang C. Long noncoding RNA LeXis promotes osteosarcoma growth through upregulation of CTNNB1 expression. Am J Cancer Res. 2017 Jul 1;7(7):1577-1587.
  3. ↑ 3.0 3.1 3.2 Shahriyari L. Effect of normalization methods on the performance of supervised learning algorithms applied to HTSeq-FPKM-UQ data sets: 7SK RNA expression as a predictor of survival in patients with colon adenocarcinoma. Brief Bioinform.2017 Nov 3. doi: 10.1093/bib/bbx153.
  4. ↑ Chen YT, Scanlan MJ, Venditti CA, Chua R, Theiler G, Stevenson BJ, Iseli C, Gure AO, Vasicek T, Strausberg RL, Jongeneel CV, Old LJ, Simpson AJ. Identification of cancer/testis-antigen genes by massively parallel signature sequencing. Proc Natl Acad Sci U S A. 2005 May 31;102(22):7940-5. doi: 10.1073/pnas.0502583102. Epub 2005 May 19.
Retrieved from "https://ngdc.cncb.ac.cn/lncrnawiki1/index.php?title=CT70&oldid=1277452"