|
|
| (One intermediate revision by the same user not shown) |
| Line 16: |
Line 16: |
| | | | |
| | ===Characteristics === | | ===Characteristics === |
| − | BRINP1 is a prototype member of the subsequently identified BRINP family of sequentially related neural-specific proteins including BRINP2 and BRINP3, located on chromosome 9q 32–33, a putative tumor suppressor locus whose deletion is frequently observed in bladder tumors([https://www.ncbi.nlm.nih.gov/pubmed/15193422 (Toshiyuki N 2004)]). | + | BRINP1 is a prototype member of the subsequently identified BRINP family of sequentially related neural-specific proteins including BRINP2 and BRINP3, located on chromosome 9q 32–33, between D9S1848 and AFMA239XA9a([https://www.ncbi.nlm.nih.gov/pubmed/10444335 (Nishiyama H 1999)]), putative tumor suppressor locus whose deletion is frequently observed in bladder tumors([https://www.ncbi.nlm.nih.gov/pubmed/15193422 (Toshiyuki N 2004)]). |
| | | | |
| | ===Expression=== | | ===Expression=== |
| Line 22: |
Line 22: |
| | | | |
| | ===Regulation=== | | ===Regulation=== |
| − | [[File:DNA_methylation_regulates_BRINP1_gene_expression.gif|right|thumb|DNA_methylation_regulates_BRINP1_gene_expression([https://www.ncbi.nlm.nih.gov/pubmed/15193422 (Toshiyuki N 2004)])]]
| |
| − |
| |
| | Hypermethylation of the BRINP1-CpG island suppresses BRINP1 expression in NIH 3T3 cells([https://www.ncbi.nlm.nih.gov/pubmed/15193422 (Toshiyuki N 2004)]). | | Hypermethylation of the BRINP1-CpG island suppresses BRINP1 expression in NIH 3T3 cells([https://www.ncbi.nlm.nih.gov/pubmed/15193422 (Toshiyuki N 2004)]). |
| − |
| |
| − | ===Function===
| |
| − | [[File:Model of hLarp7 recognition of the 7SK.png|right|thumb|Model of hLarp7 recognition of the 7SK 3′end and mechanism of assembly of core 7SK RNP([https://www.ncbi.nlm.nih.gov/pubmed/29946027 (Eichhorn 2018)])]]
| |
| − |
| |
| − | 7SK snRNA functions in transcriptional regulation by interacting with PTEF-B complex ([http://www.ncbi.nlm.nih.gov/pubmed/11713533 (Nguyen 2001)]) ([http://www.ncbi.nlm.nih.gov/pubmed/11713532 (Yang 2001)]), BAF chromatin-remodeling complex ([https://www.ncbi.nlm.nih.gov/pubmed/26878240 (Flynn 2016)]), or hnRNP R ([https://www.ncbi.nlm.nih.gov/pubmed/29507242 (Briese 2018)]). Consistently, it has been found highly enriched in isolated chromatin fractions, which may be related to its role in transcriptional regulation ([http://www.ncbi.nlm.nih.gov/pubmed/20404130 (Mondal 2010)]). In addition to its critical role for controlling transcription, 7SK snRNA is also involved in alternative splicing ([http://www.ncbi.nlm.nih.gov/pubmed/19416841 (Barboric 2009)]) and the localization of protein in nucleolus ([http://www.ncbi.nlm.nih.gov/pubmed/17381310 (He 2007)]). Therefore, 7SK snRNA has a variety of functions in the nuclear, playing important roles in cell growth and differentiation ([http://www.ncbi.nlm.nih.gov/pubmed/11713533 (Nguyen 2001)]) ([http://www.ncbi.nlm.nih.gov/pubmed/11713532 (Yang 2001)]), axon maintenance ([https://www.ncbi.nlm.nih.gov/pubmed/29507242 (Briese 2018)]) and vertebrate development ([http://www.ncbi.nlm.nih.gov/pubmed/19416841 (Barboric 2009)]).
| |
| − |
| |
| − | 7SK snRNA controls RNAP II activity by inhibiting P-TEFb elongation factor, which is a cdk-cyclin kinase that functions as both a general and an HIV-1 Tat-specific transcription factor ([http://www.ncbi.nlm.nih.gov/pubmed/11713533 (Nguyen 2001)]) ([http://www.ncbi.nlm.nih.gov/pubmed/11713532 (Yang 2001)]), with an impact on cell growth and differentiation. Specifically, 7SK snRNA functions as the central scaffold that coordinates protein-protein interactions and, by inhibiting P-TEFb kinase-mediated CTD phosphorylation, regulates RNAP II elongation ([http://www.ncbi.nlm.nih.gov/pubmed/11713533 (Nguyen 2001)]).
| |
| − |
| |
| − | At an early stage of the HIV transcription cycle, elongation is prevented as P-TEFb is recruited to the HIV-1 promoter in a catalytically inactive state bound to the 7SK snRNP and also the Tat trans-activator of transcription protein. The inhibitory 7SK snRNP may be displaced by the nascent TAR HIV RNA that also binds Tat protein, activating P-TEFb kinase and transcriptional elongation ([http://www.ncbi.nlm.nih.gov/pubmed/20562857 (D'Orso 2010)]). Displacement of 7SK may also be performed by cellular RNAs, as indicated by the 3'-untranslated region (~300-nt) of HIC mRNA, which forms complexes with P-TEFb and is necessary and sufficient for stimulation of P-TEFb-dependent transcription of the HIV promoter ([http://www.ncbi.nlm.nih.gov/pubmed/17925858 (Young 2007)]).
| |
| − |
| |
| − | 7SK snRNA inhibits enhancer transcription by modulating nucleosome position. 7SK physically interacts with the BAF chromatin-remodeling complex, recruits BAF to enhancers and inhibits enhancer transcription by modulating chromatin structure ([https://www.ncbi.nlm.nih.gov/pubmed/26878240 (Flynn 2016)]).
| |
| − |
| |
| − | In axons, 7SK snRNA interacts with hnRNP R to regulate its function in axon maintenance ([https://www.ncbi.nlm.nih.gov/pubmed/29507242 (Briese 2018)]).
| |
| − |
| |
| − | 7SK snRNP (composed of 7SK snRNA, Hexim1, Larp7/Pip7S, and the P-TEFb subunits CycT1 and Cdk9) is not only critical for controlling transcription, but also for regulating alternative splicing coupled to transcription elongation ([http://www.ncbi.nlm.nih.gov/pubmed/19416841 (Barboric 2009)]). 7SK snRNP disintegration promotes inclusion of an alternative exon via the increased occupancy of P-TEFb, Ser2-phosphorylated (Ser2-P) RNAPII, and the splicing factor SF2/ASF at the minigene ([http://www.ncbi.nlm.nih.gov/pubmed/19416841 (Barboric 2009)]).
| |
| − |
| |
| − | 7SK snRNA also inhibits APOBEC3C deaminase activity and sequesters it to the nucleolus, suggesting broader role for 7SK RNA in regulating key nuclear functions ([http://www.ncbi.nlm.nih.gov/pubmed/17381310 (He 2007)]).
| |
| | | | |
| | ===Disease=== | | ===Disease=== |
| − | colon adenocarcinoma <ref name="ref1" />
| + | bladder cancer([https://www.ncbi.nlm.nih.gov/pubmed/10444335 (Nishiyama H 1999)]) |
| − | | |
| − | ===Evolution===
| |
| − | Please input evolution information here.
| |
| | | | |
| | ==Labs working on this lncRNA== | | ==Labs working on this lncRNA== |
| − | Please input related labs here.
| + | Division of Innovative Research, Creative Research Initiative Sousei, Hokkaido University Sapporo 001-0020, Japan([https://www.ncbi.nlm.nih.gov/pubmed/15193422 (Toshiyuki N 2004)]). |
| | | | |
| − | ==References==
| + | ICRF Cancer Medicine Research Unit, St. James's University Hospital, Beckett Street, Leeds, LS9 7TF, United Kingdom([https://www.ncbi.nlm.nih.gov/pubmed/10444335 (Nishiyama H 1999)]). |
| − | <references>
| |
| − | <ref name="ref1"> Shahriyari L. Effect of normalization methods on the performance of supervised
| |
| − | learning algorithms applied to HTSeq-FPKM-UQ data sets: 7SK RNA expression as a
| |
| − | predictor of survival in patients with colon adenocarcinoma. Brief Bioinform.
| |
| − | 2017 Nov 3. doi: 10.1093/bib/bbx153.
| |
| − | </ref>(1)
| |
| − | </references>
| |
| − | [http://www.lncrnadb.org/7SK/ Annotation originally sourced from lncRNAdb]. | |
| | | | |
| − | {{basic|
| + | Molecular Genetics Laboratory, Marie Curie Research Institute, Surrey, UK([https://www.ncbi.nlm.nih.gov/pubmed/9175739 (Habuchi T 1997)]). |
| − | tID = NONHSAT113149|
| |
| − | source = NONCODE4.0|
| |
| − | same = ,|
| |
| − | classification = intergenic|
| |
| − | length = 332 nt|
| |
| − | location = chr6+:52860418..52860749|
| |
| − | number = 1|
| |
| − | exons = 52860418..52860749|
| |
| − | context = <html><div align="center">
| |
| − | <iframe src="http://lncrna.big.ac.cn/view/?data=species/human&loc=chr6:52860418..52860749&tracklist=0&overview=0&tracks=DNA,RefGene,lncRNA" style=" border-width:0 " width="100%" height="250" scrolling="yes"></iframe>
| |
| − | </div></html>|
| |
| − | sequence = <dnaseq>GGATGTGAGGGCGATCTGGCTGCGACATCTGTCACCCCATTGATCGCCAGGGTTGATTCGGCTGATCTGGCTGGCTAGGCGGGTGTCCCCTTCCTCCCTCACCGCTCCATGTGCGTCCCTCCCGAAGCTGCGCGCTCGGTCGAAGAGGACGACCATCCCCGATAGAGGAGGACCGGTCTTCGGTCAAGGGTATACGAGTAGCTGCGCTCCCCTGCTAGAACCTCCAAACAAGCTCTCAAGGTCCATTTGTAGGAGAACGTAGGGTAGTCAAGCTTCCAAGACTCCAGACACATCCAAATGAGGCGCTGCATGTGGCAGTCTGCCTTTCTTTT</dnaseq>|
| |
| − | }}
| |
| − | [[Category:Intergenic]][[Category:NONHSAG043942]][[Category:Transcripts]]
| |
Annotated Information
Name
Approved symbol: BRINP1
Approved name: BMP/retinoic acid inducible neural specific 1
HGNC ID: HGNC:2687
Previous names: deleted in bladder cancer chromosome region candidate 1, deleted in bladder cancer 1, bone morphogenetic protein/retinoic acid inducible neural-specific 1
Previous symbols: DBCCR1, DBC1
Alias symbols: FAM5A
RefSeq ID: NM_014618
Characteristics
BRINP1 is a prototype member of the subsequently identified BRINP family of sequentially related neural-specific proteins including BRINP2 and BRINP3, located on chromosome 9q 32–33, between D9S1848 and AFMA239XA9a((Nishiyama H 1999)), putative tumor suppressor locus whose deletion is frequently observed in bladder tumors((Toshiyuki N 2004)).
Expression
BRINP1 is most highly and widely expressed in various regions of the mammalian nervous system, although its expression is also found in some non-neural tissues and cell types at low levels((Toshiyuki N 2004)).
Regulation
Hypermethylation of the BRINP1-CpG island suppresses BRINP1 expression in NIH 3T3 cells((Toshiyuki N 2004)).
Disease
bladder cancer((Nishiyama H 1999))
Labs working on this lncRNA
Division of Innovative Research, Creative Research Initiative Sousei, Hokkaido University Sapporo 001-0020, Japan((Toshiyuki N 2004)).
ICRF Cancer Medicine Research Unit, St. James's University Hospital, Beckett Street, Leeds, LS9 7TF, United Kingdom((Nishiyama H 1999)).
Molecular Genetics Laboratory, Marie Curie Research Institute, Surrey, UK((Habuchi T 1997)).
