Difference between revisions of "LncRNAWiki:About"

From LncRNAWiki
Jump to: navigation, search
m (Protected "LncRNAWiki:About" (‎[edit=sysop] (indefinite) ‎[move=sysop] (indefinite)))
 
(One intermediate revision by the same user not shown)
Line 1: Line 1:
{{basic|
+
{{LncRNAWiki:Summary}}
tID = ENST00000423023.2|
 
same = |
 
location = chr13+:20248764-20250024|
 
classification = intergenic|
 
sequence = <dnaseq>CCATGAAAGGCTGGATTGGATGCCCAGAATGAAAACAGTGGAGCTCAAGGAGGATGATTAGCAAAACAAGGAAAAGCAGGAGACATAGAGCAGACTATGAAAAACCTGGGTCACGAACAGGATATTTCCCACAAAATGTTTTGACCTGGAAAAGAGACAGAGTCTTCACTAGTAAACAGGATCTAATCTCCATAGTATATTTTTCTAAAGAAACAAGAGCTTTCAGTCCTAAAGTAATTTGCTAGACTAGAATCACTGACCAGCAGACCTAAATTCAAGCTTCAATATTAAGATTGTTGATGGAGGAAACTGTCATGGAAATGGCAATTTCTTAACTCTTTATAATAAAAGCAGATTCAATGTCACAAGAATTAAA</dnaseq>|
 
}}
 
[[Category:Intergenic]]
 
  
{{annotation|
+
==Slogan==
tID = ENST00000423023.2|
+
* Nothing great is ever accomplished in isolation. — Yo-Yo Ma
ann = <tab class=wikitable sep=tab head=top>
+
* Imagine a world in which every single person on the planet has free access to the sum of all human knowledge. — Jimmy Wales, Founder of Wikipedia
Source Type Begin End ID Classfication
+
* Contribute your efforts, further our knowledge. — Zhang Zhang, Founder of ScienceWikis
HAVANA gene 20248764 20250024 ENSG00000226352.2 antisense
+
 
HAVANA transcript 20248764 20250024 ENST00000423023.2 antisense
+
==Purpose & Aims==
HAVANA exon 20248764 20248872 NA NA
+
The purpose of LncRNAWiki is as follows.
HAVANA exon 20249758 20250024 NA NA
+
 
</tab>|
+
* Establish a community-based system for lncRNA annotation.
}}
+
* Provide up-to-date, comprehensive, and professional annotations for lncRNA.
 +
* Build related wiki extensions to ease content accessibility, adding and editing.
 +
* Measure users' contributions and give explicit authorship.
 +
 
 +
==Content==
 +
The majority of the lncRNA information was initially seeded with a subset of information from GENCODE, NONCODE, LNCipedia, and lncRNAdb.
 +
 
 +
==Statistics==
 +
LncRNAWiki is run off of [http://www.mediawiki.org Mediawiki] version {{CURRENTVERSION}} and currently has {{NUMBEROFPAGES}} pages. You can view other statistics on [[Special:Statistics]].
 +
 
 +
==Acknowledgements==
 +
{{LncRNAWiki:Acknowledgements}}

Latest revision as of 00:40, 16 October 2014

LncRNAWiki is a wiki-based, publicly editable and open-content platform for community curation of human long non-coding RNAs (lncRNAs), viz., a community-curated lncRNA knowledgebase. Unlike conventional biological databases based on expert curation, lncRNAWiki harnesses collective intelligence to collect, edit and annotate information about lncRNAs, quantifies users' contributions in each annotated lncRNA and provides explicit authorship to encourage more participation from the whole scientific community.

Slogan

  • Nothing great is ever accomplished in isolation. — Yo-Yo Ma
  • Imagine a world in which every single person on the planet has free access to the sum of all human knowledge. — Jimmy Wales, Founder of Wikipedia
  • Contribute your efforts, further our knowledge. — Zhang Zhang, Founder of ScienceWikis

Purpose & Aims

The purpose of LncRNAWiki is as follows.

  • Establish a community-based system for lncRNA annotation.
  • Provide up-to-date, comprehensive, and professional annotations for lncRNA.
  • Build related wiki extensions to ease content accessibility, adding and editing.
  • Measure users' contributions and give explicit authorship.

Content

The majority of the lncRNA information was initially seeded with a subset of information from GENCODE, NONCODE, LNCipedia, and lncRNAdb.

Statistics

LncRNAWiki is run off of Mediawiki version 1.30.0 and currently has 598,511 pages. You can view other statistics on Special:Statistics.

Acknowledgements

This work was supported by grants from National Natural Science Foundation of China (Grant No. 31200978 to Lina Ma), the “100-Talent Program” of Chinese Academy of Sciences (Y1SLXb1365), the Strategic Priority Research Program of the Chinese Academy of Sciences (XDB13040500), and National Programs for High Technology Research and Development (863 Program; 2012AA020409), the Ministry of Science and Technology of the People’s Republic of China.