Difference between revisions of "LncRNAWiki:How to contribute"

Latest revision as of 14:41, 16 June 2014

You can perform different types of contributions to make LncRNAWiki the online encyclopedia for lncRNA.

If you are a researcher, please share your knowledge and curate genes in your area of expertise.
If you are a teacher/investigator, community curation of lncRNA genes in LncRNAWiki can be incorporated as student assignments, where contribution can be quantified as a score.
If you are a student, you can work as a volunteer, e.g., data collection, content formatting.
If you are a journal publisher, please consider community curation as a compulsory post-publication when any lncRNA-related paper is accepted by the journal.
At the very least, please spread this news to any one who might be of interest.

@@ Line 1: / Line 1: @@
-{{basic|
+You can perform different types of contributions to make LncRNAWiki the online encyclopedia for lncRNA.
-tID = ENST00000537157.1|
+* If you are a researcher, please share your knowledge and curate genes in your area of expertise.
-location = chr12-:122233476-122238913|
+* If you are a teacher/investigator, community curation of lncRNA genes in LncRNAWiki can be incorporated as student assignments, where contribution can be quantified as a score.
-same = lnc-RHOF-1:14|
+* If you are a student, you can work as a volunteer, e.g., data collection, content formatting.
-classification = intergenic|
+* If you are a journal publisher, please consider community curation as a compulsory post-publication when any lncRNA-related paper is accepted by the journal.
-sequence =
+* At the very least, please spread this news to any one who might be of interest.
-<dnaseq>GGCTTCGAGCCCGTCGCGGCTGGGCCGGGCTGGTCTGGCAGGCGGGCCCAGCCGGGCAGGGCTGCTTTGCTAATGGCGGCGGCTCTCTTTCCTTCCTTCCTCCTTTCCTCCGTCCCCCCGGTCGTGGGGAGCCCGGAGCAGGAGGCGGGCCCGCGGCCAGGTTCTGGGCCGGAGAAGGGGCGACGTTCGGGCACCCCCCGAATGGACAATCTTTCCTTCTGTCAACGGCAGGGGCAGGCCTAGTTTGACTCTGACAGTCCTCCCACTAAGGAATTCCTGGTGACTGGAAGGGGGAGTGACTCAGGCCCTCAACCTCTAGCAGAGTGCCTTGGCTCCCTCCTGTCGTCCTGGGGAACCTCGGCCCCAGCCCTGCCTCCCCAGCCAGTCACAGCTCCTCCCTGGTCACCCTGAGGGAGCTCAGGGCCCGGCTGGTAGCTGGGTTGCTCTGCTTCTGTCCCCCACTCCTGTGGAGCCTGGCA</dnaseq>|
-}}