Difference between revisions of "Lnc-C11orf16-1:1"
(Created page with "Please input one-sentence summary here.
==Annotated Information==
===Transcriptomic Nomeclature===
Please input transcriptomic nomeclature information here.
===Functio...") |
|||
| (6 intermediate revisions by 5 users not shown) | |||
| Line 2: | Line 2: | ||
==Annotated Information== | ==Annotated Information== | ||
| + | ===Name=== | ||
| + | NDM29: neuroblastoma differentiation marker 29 ([http://www.ncbi.nlm.nih.gov/pubmed/20581224 Castelnuovo (2010)], [http://www.ncbi.nlm.nih.gov/pubmed/17274687 Pagano (2007)]). | ||
| + | |||
| + | ===Characteristics=== | ||
| + | ~130 nt. 'Alu-like RNA', it has a canonical Alu/7SL-derived sequence structure. Transcribed by RNA Polymerase III from the first intron of the ASCL3 (Achaete Scute-Like homologue 3) gene [http://www.ncbi.nlm.nih.gov/pubmed/20581224 (Castelnuovo (2010))]. | ||
| + | |||
| + | ===Function=== | ||
| + | In humans, NDM29 maps in a genomic region whose deletion has been shown to be involved in neuroblastoma development [http://www.ncbi.nlm.nih.gov/pubmed/16000168 (De Preter (2005))]. | ||
| + | |||
| + | In-vitro over-expression of NDM29 promoted differentiation of neuroblastoma (NB) cells into cells with neuron-like features (including marker expression, morphology, anchorage-dependent growth and excitatory properties), and a reduction in the tumor initiating ('stem-like') cell fraction in the NB cell population. In-vitro and in-vivo experiments indicated that increased expression of NDM29 restricts NB development and malignancy. It also lead to reduced expression of multidrug resistance 1 (MDR1) mRNA in malignant NB cells, and so increased their susceptibility to doxorubicin and cis-platinum antiblastic drugs used in NB therapy [http://www.ncbi.nlm.nih.gov/pubmed/20581224 (Castelnuovo (2010))]. | ||
| + | |||
| + | ===Expression=== | ||
| + | NDM29 expression was analyzed in 6 different cell types and found in abundant levels in neural cells (neuroblastoma cell lines SHSY5Y and SKNBE2, and primary culture of human glioma cells), but at a very low levels in epithelial-derived cells (HeLa, HEK293, and primary cultures of skin fibrobroblast). NDM29 expression was increased in differentiating cells [http://www.ncbi.nlm.nih.gov/pubmed/20581224 (Castelnuovo (2010))]. NDM29 RNA was detected in both the nucleus and cytoplasm of SKNBE2 and HeLa cells, but enriched (~70%) in the latter [http://www.ncbi.nlm.nih.gov/pubmed/20581224 (Castelnuovo (2010))]. | ||
| + | |||
| + | ===Conservation=== | ||
| + | RNA was detected in humans - Alu-derived elements are restricted to primate lineage [http://www.ncbi.nlm.nih.gov/pubmed/20581224 (Castelnuovo (2010))]. | ||
| + | |||
| + | ===Disease=== | ||
| + | neuroblastoma | ||
| + | |||
| + | ===Misc=== | ||
| + | NDM29 transcript comprises Alu sequences and unique sequences and might have been inserted into the genomic locus by retrotransposition [http://www.ncbi.nlm.nih.gov/pubmed/20581224 (Castelnuovo (2010))]. Similar to 21A RNA, it is also a short interspersed nucleotide element, marked as AluJb elements. [http://www.ncbi.nlm.nih.gov/pubmed/17274687 (Pagano (2007))]. | ||
| + | |||
===Transcriptomic Nomeclature=== | ===Transcriptomic Nomeclature=== | ||
Please input transcriptomic nomeclature information here. | Please input transcriptomic nomeclature information here. | ||
| − | |||
| − | |||
| − | |||
===Regulation=== | ===Regulation=== | ||
Please input regulation information here. | Please input regulation information here. | ||
| − | |||
| − | |||
| − | |||
===Allelic Information and Variation=== | ===Allelic Information and Variation=== | ||
| Line 26: | Line 43: | ||
==References== | ==References== | ||
| − | + | [http://www.lncrnadb.org/NDM29/ Annotation originally sourced from lncRNAdb.]. | |
{{basic| | {{basic| | ||
| Line 42: | Line 59: | ||
sequence = <dnaseq>CTAACTAGACGCTATTGCTTGTTGAAGGCTTTGATCTTAGGAGGATTAGAAAGCATTCTAGGCCAGGCACGGTGGCTTCCTGTGTGTAATCCCAGCAGTTGGAGAGGCTGAGGCAGGCGGGTTGCTTGAGC</dnaseq>| | sequence = <dnaseq>CTAACTAGACGCTATTGCTTGTTGAAGGCTTTGATCTTAGGAGGATTAGAAAGCATTCTAGGCCAGGCACGGTGGCTTCCTGTGTGTAATCCCAGCAGTTGGAGAGGCTGAGGCAGGCGGGTTGCTTGAGC</dnaseq>| | ||
}} | }} | ||
| − | [[Category:Intronic(S)]] | + | [[Category:Intronic(S)]][[Category:lnc-C11orf16-1]][[Category:Transcripts]] |
Latest revision as of 12:43, 1 July 2016
Please input one-sentence summary here.
Contents
Annotated Information
Name
NDM29: neuroblastoma differentiation marker 29 (Castelnuovo (2010), Pagano (2007)).
Characteristics
~130 nt. 'Alu-like RNA', it has a canonical Alu/7SL-derived sequence structure. Transcribed by RNA Polymerase III from the first intron of the ASCL3 (Achaete Scute-Like homologue 3) gene (Castelnuovo (2010)).
Function
In humans, NDM29 maps in a genomic region whose deletion has been shown to be involved in neuroblastoma development (De Preter (2005)).
In-vitro over-expression of NDM29 promoted differentiation of neuroblastoma (NB) cells into cells with neuron-like features (including marker expression, morphology, anchorage-dependent growth and excitatory properties), and a reduction in the tumor initiating ('stem-like') cell fraction in the NB cell population. In-vitro and in-vivo experiments indicated that increased expression of NDM29 restricts NB development and malignancy. It also lead to reduced expression of multidrug resistance 1 (MDR1) mRNA in malignant NB cells, and so increased their susceptibility to doxorubicin and cis-platinum antiblastic drugs used in NB therapy (Castelnuovo (2010)).
Expression
NDM29 expression was analyzed in 6 different cell types and found in abundant levels in neural cells (neuroblastoma cell lines SHSY5Y and SKNBE2, and primary culture of human glioma cells), but at a very low levels in epithelial-derived cells (HeLa, HEK293, and primary cultures of skin fibrobroblast). NDM29 expression was increased in differentiating cells (Castelnuovo (2010)). NDM29 RNA was detected in both the nucleus and cytoplasm of SKNBE2 and HeLa cells, but enriched (~70%) in the latter (Castelnuovo (2010)).
Conservation
RNA was detected in humans - Alu-derived elements are restricted to primate lineage (Castelnuovo (2010)).
Disease
neuroblastoma
Misc
NDM29 transcript comprises Alu sequences and unique sequences and might have been inserted into the genomic locus by retrotransposition (Castelnuovo (2010)). Similar to 21A RNA, it is also a short interspersed nucleotide element, marked as AluJb elements. (Pagano (2007)).
Transcriptomic Nomeclature
Please input transcriptomic nomeclature information here.
Regulation
Please input regulation information here.
Allelic Information and Variation
Please input allelic information and variation information here.
Evolution
Please input evolution information here.
You can also add sub-section(s) at will.
Labs working on this lncRNA
Please input related labs here.
References
Annotation originally sourced from lncRNAdb..
Basic Information
| Transcript ID |
lnc-C11orf16-1:1 |
| Source |
LNCipedia2.1 |
| Same with |
, |
| Classification |
intronic(S) |
| Length |
131 nt |
| Genomic location |
chr11-:8960581..8960712 |
| Exon number |
1 |
| Exons |
8960581..8960712 |
| Genome context |
|
| Sequence |
000001 CTAACTAGAC GCTATTGCTT GTTGAAGGCT TTGATCTTAG GAGGATTAGA AAGCATTCTA GGCCAGGCAC GGTGGCTTCC 000080
000081 TGTGTGTAAT CCCAGCAGTT GGAGAGGCTG AGGCAGGCGG GTTGCTTGAG C |
