Difference between revisions of "NONHSAT132573"
(Created page with "Please input one-sentence summary here.
==Annotated Information==
===Transcriptomic Nomeclature===
Please input transcriptomic nomeclature information here.
===Functio...") |
|||
(One intermediate revision by one other user not shown) | |||
Line 42: | Line 42: | ||
sequence = <dnaseq>tccccttgctctgtcttcctcttgctccagtcatgtgagacactcgctcccctttgacctctgccatgattgtaagtatcatgaaggattatttctccactcataggacacaaagccctctcctgtgttttcttctttgaattttacagttttgcctttcccatgaacatctctattccatatgcgtttacttctgtatgaa</dnaseq>| | sequence = <dnaseq>tccccttgctctgtcttcctcttgctccagtcatgtgagacactcgctcccctttgacctctgccatgattgtaagtatcatgaaggattatttctccactcataggacacaaagccctctcctgtgttttcttctttgaattttacagttttgcctttcccatgaacatctctattccatatgcgtttacttctgtatgaa</dnaseq>| | ||
}} | }} | ||
− | [[Category:Intergenic]] | + | [[Category:Intergenic]][[Category:NONHSAG052648]][[Category:Transcripts]] |
Latest revision as of 07:20, 17 October 2014
Please input one-sentence summary here.
Contents
Annotated Information
Transcriptomic Nomeclature
Please input transcriptomic nomeclature information here.
Function
Please input function information here.
Regulation
Please input regulation information here.
Expression
Please input expression information here.
Allelic Information and Variation
Please input allelic information and variation information here.
Evolution
Please input evolution information here.
You can also add sub-section(s) at will.
Labs working on this lncRNA
Please input related labs here.
References
Please input cited references here.
Basic Information
Transcript ID |
NONHSAT132573 |
Source |
NONCODE4.0 |
Same with |
, |
Classification |
intergenic |
Length |
202 nt |
Genomic location |
chr9-:82788579..82803741 |
Exon number |
2 |
Exons |
82788579..82788705,82803667..82803741 |
Genome context |
|
Sequence |
000001 tccccttgct ctgtcttcct cttgctccag tcatgtgaga cactcgctcc cctttgacct ctgccatgat tgtaagtatc 000080
000081 atgaaggatt atttctccac tcataggaca caaagccctc tcctgtgttt tcttctttga attttacagt tttgcctttc 000160 000161 ccatgaacat ctctattcca tatgcgttta cttctgtatg aa |