Difference between revisions of "Lnc-LRR1-1:1"
(→Function) |
Qianpeng Li (talk | contribs) (→Name) |
||
| (13 intermediate revisions by 6 users not shown) | |||
| Line 1: | Line 1: | ||
| − | |||
| − | |||
==Annotated Information== | ==Annotated Information== | ||
===Name=== | ===Name=== | ||
| − | 7SL | + | Approved symbol: RN7SL1 |
| + | |||
| + | Approved name: RNA component of signal recognition particle 7SL1 | ||
| + | |||
| + | Previous symbols: RN7SL | ||
| + | |||
| + | Alias symbols: 7SL, 7L1a, RNSRP1 | ||
| + | |||
| + | LncBook transcript ID: HSALNT0289533 | ||
===Characteristics=== | ===Characteristics=== | ||
| Line 10: | Line 16: | ||
The eukaryotic small cytoplasmic 7SL is an RNA component of the SRP (signal recognition particle), which associates with the ribosome and targets nascent proteins to the endoplasmic reticulum for secretion or membrane insertion ([http://www.ncbi.nlm.nih.gov/pubmed/6181418 (Walter 1982)]) ([http://www.ncbi.nlm.nih.gov/pubmed/15611297 (Zwieb 2004)]). | The eukaryotic small cytoplasmic 7SL is an RNA component of the SRP (signal recognition particle), which associates with the ribosome and targets nascent proteins to the endoplasmic reticulum for secretion or membrane insertion ([http://www.ncbi.nlm.nih.gov/pubmed/6181418 (Walter 1982)]) ([http://www.ncbi.nlm.nih.gov/pubmed/15611297 (Zwieb 2004)]). | ||
| − | === | + | ===Expression=== |
| − | 7SL | + | Ubiquitously expressed at high levels. Localises to the cytoplasm. An expression profile from 11 human tissues using RNA sequencing showed 7SL was most highly expressed ncRNA and could be an order of magnitude more highly expressed than any mRNA ([http://www.ncbi.nlm.nih.gov/pubmed/20668672 (Castle 2010)]). |
| + | |||
| + | ===Regulation=== | ||
| + | * Activating transcription factor (ATF), in the 5′ flanking region of 7S L RNA gene between –43 and –50 upstream of the transcription start site, is involved in the regulation of human 7S L RNA transcription by RNA polymerase III in vivo and in vitro([https://www.ncbi.nlm.nih.gov/pubmed/1702200 (Bredow 2004)]). | ||
| + | |||
| + | [[File:Re seq of RNA7SL.png|right|thumb|Schematic presentation of promoter elements utilized by pol III for basal transcription of the human 7SL RNA genes Hs7SL-1 and Hs7SL-3 in HeLa | ||
| + | nuclear extract([https://www.ncbi.nlm.nih.gov/pubmed/15667936 (Englert 2004)])]] | ||
| − | + | * It is reported that a TATA-like sequence located approximately between –20 and –30 upstream of the coding regions of Hs7SL-1 as well as internal A and B box-like motifs are important in the transcription of human 7SL RNA genes([https://www.ncbi.nlm.nih.gov/pubmed/15667936 (Englert 2004)]). | |
| − | + | ===Function=== | |
| + | * 7SL RNA is required for structural and functional properties of SRP ([http://www.ncbi.nlm.nih.gov/pubmed/6181418 (Walter 1982)]), being a scaffold component upon which the six proteins of the SRP bind in higher eukaryotes. In mammals SRP consists of the SRP RNA the six proteins named SRP9, SRP14, SRP19, SRP54, SRP68, and SRP72 ([http://www.ncbi.nlm.nih.gov/pubmed/6196367 (Walter 1983)]). | ||
| − | + | * Bacterial SRP has a much reduced complexity, consisting of a small SRP RNA (4.5S RNA) and a homolog of protein SRP54, also called Ffh or P48 ([http://www.ncbi.nlm.nih.gov/pubmed/8389475 (Bernstein 1993)]). In archaea only two SRP proteins, SRP19 and SRP54, are thought to be part of the SRP, although SRP RNA closely resembles the mammalian homolog ([http://www.ncbi.nlm.nih.gov/pubmed/10684931 (Bhuiyan 2000)]). | |
| − | |||
| − | |||
| − | |||
| − | + | * There is evidence that a highly conserved region of 7SL RNA catalyses the binding of SRP to its receptor SR, and that this RNA stimulates the GTPase activities of the SRP-SR complex ([http://www.ncbi.nlm.nih.gov/pubmed/18617187 (Zhang 2008)]) ([http://www.ncbi.nlm.nih.gov/pubmed/17164479 (Siu 2006)]) ([http://www.ncbi.nlm.nih.gov/pubmed/10834842 (Peluso 2000)]). | |
| − | |||
| − | === | + | ===Disease=== |
| − | + | AIDS <ref name="ref1" /> <ref name="ref2" /> | |
===Evolution=== | ===Evolution=== | ||
Please input evolution information here. | Please input evolution information here. | ||
| − | |||
| − | |||
==Labs working on this lncRNA== | ==Labs working on this lncRNA== | ||
| − | + | * Department of Microbiology and Immunology, University of Michigan Medical School, Ann Arbor, Michigan, USA.<ref name="ref1" /> | |
| + | * Laboratory of Cellular Biophysics, The Rockefeller University, New York, New York.<ref name="ref2" /> | ||
==References== | ==References== | ||
| − | + | <references> | |
| + | <ref name="ref1"> Keene SE, King SR, Telesnitsky A. 7SL RNA is retained in HIV-1 minimal | ||
| + | virus-like particles as an S-domain fragment. J Virol. 2010 Sep;84(18):9070-7. | ||
| + | doi: 10.1128/JVI.00714-10. | ||
| + | </ref>(1) | ||
| + | <ref name="ref2"> Itano MS, Arnion H, Wolin SL, Simon SM. Recruitment of 7SL RNA to assembling | ||
| + | HIV-1 virus-like particles. Traffic. 2018 Jan;19(1):36-43. doi: | ||
| + | 10.1111/tra.12536. | ||
| + | </ref>(2) | ||
| + | </references> | ||
| + | [http://www.lncrnadb.org/7SL/ Annotation originally sourced from lncRNAdb.] | ||
{{basic| | {{basic| | ||
| Line 53: | Line 71: | ||
sequence = <dnaseq>GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGCTGGAGGATCGCTTGAGTCCAGGAGTTCTGGGCTGTAGTGCGCTATGCCGATCGGGTGTCCGCACTAAGTTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGGAGGGGTGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAGTGGGATCGCGCCTGTGAATAGCCACTGCACTCCAGCCTGGGCAACATAGCGAGACCCCGTCTCT</dnaseq>| | sequence = <dnaseq>GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGCTGGAGGATCGCTTGAGTCCAGGAGTTCTGGGCTGTAGTGCGCTATGCCGATCGGGTGTCCGCACTAAGTTCGGCATCAATATGGTGACCTCCCGGGAGCGGGGGACCACCAGGTTGCCTAAGGAGGGGTGAACCGGCCCAGGTCGGAAACGGAGCAGGTCAAAACTCCCGTGCTGATCAGTAGTGGGATCGCGCCTGTGAATAGCCACTGCACTCCAGCCTGGGCAACATAGCGAGACCCCGTCTCT</dnaseq>| | ||
}} | }} | ||
| − | [[Category:Intergenic]] | + | [[Category:Intergenic]][[Category:lnc-LRR1-1]][[Category:Transcripts]] |
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
Latest revision as of 04:06, 12 August 2019
Contents
Annotated Information
Name
Approved symbol: RN7SL1
Approved name: RNA component of signal recognition particle 7SL1
Previous symbols: RN7SL
Alias symbols: 7SL, 7L1a, RNSRP1
LncBook transcript ID: HSALNT0289533
Characteristics
~300 nt, transcribed by RNAPIII.
The eukaryotic small cytoplasmic 7SL is an RNA component of the SRP (signal recognition particle), which associates with the ribosome and targets nascent proteins to the endoplasmic reticulum for secretion or membrane insertion ((Walter 1982)) ((Zwieb 2004)).
Expression
Ubiquitously expressed at high levels. Localises to the cytoplasm. An expression profile from 11 human tissues using RNA sequencing showed 7SL was most highly expressed ncRNA and could be an order of magnitude more highly expressed than any mRNA ((Castle 2010)).
Regulation
- Activating transcription factor (ATF), in the 5′ flanking region of 7S L RNA gene between –43 and –50 upstream of the transcription start site, is involved in the regulation of human 7S L RNA transcription by RNA polymerase III in vivo and in vitro((Bredow 2004)).
Schematic presentation of promoter elements utilized by pol III for basal transcription of the human 7SL RNA genes Hs7SL-1 and Hs7SL-3 in HeLa nuclear extract((Englert 2004))
- It is reported that a TATA-like sequence located approximately between –20 and –30 upstream of the coding regions of Hs7SL-1 as well as internal A and B box-like motifs are important in the transcription of human 7SL RNA genes((Englert 2004)).
Function
- 7SL RNA is required for structural and functional properties of SRP ((Walter 1982)), being a scaffold component upon which the six proteins of the SRP bind in higher eukaryotes. In mammals SRP consists of the SRP RNA the six proteins named SRP9, SRP14, SRP19, SRP54, SRP68, and SRP72 ((Walter 1983)).
- Bacterial SRP has a much reduced complexity, consisting of a small SRP RNA (4.5S RNA) and a homolog of protein SRP54, also called Ffh or P48 ((Bernstein 1993)). In archaea only two SRP proteins, SRP19 and SRP54, are thought to be part of the SRP, although SRP RNA closely resembles the mammalian homolog ((Bhuiyan 2000)).
- There is evidence that a highly conserved region of 7SL RNA catalyses the binding of SRP to its receptor SR, and that this RNA stimulates the GTPase activities of the SRP-SR complex ((Zhang 2008)) ((Siu 2006)) ((Peluso 2000)).
Disease
Evolution
Please input evolution information here.
Labs working on this lncRNA
- Department of Microbiology and Immunology, University of Michigan Medical School, Ann Arbor, Michigan, USA.[1]
- Laboratory of Cellular Biophysics, The Rockefeller University, New York, New York.[2]
References
- ↑ 1.0 1.1 Keene SE, King SR, Telesnitsky A. 7SL RNA is retained in HIV-1 minimal virus-like particles as an S-domain fragment. J Virol. 2010 Sep;84(18):9070-7. doi: 10.1128/JVI.00714-10.
- ↑ 2.0 2.1 Itano MS, Arnion H, Wolin SL, Simon SM. Recruitment of 7SL RNA to assembling HIV-1 virus-like particles. Traffic. 2018 Jan;19(1):36-43. doi: 10.1111/tra.12536.
Annotation originally sourced from lncRNAdb.
Basic Information
| Transcript ID |
lnc-LRR1-1:1 |
| Source |
LNCipedia2.1 |
| Same with |
, |
| Classification |
intergenic |
| Length |
299 nt |
| Genomic location |
chr14+:50053297..50053596 |
| Exon number |
1 |
| Exons |
50053297..50053596 |
| Genome context |
|
| Sequence |
000001 GCCGGGCGCG GTGGCGCGTG CCTGTAGTCC CAGCTACTCG GGAGGCTGAG GCTGGAGGAT CGCTTGAGTC CAGGAGTTCT 000080
000081 GGGCTGTAGT GCGCTATGCC GATCGGGTGT CCGCACTAAG TTCGGCATCA ATATGGTGAC CTCCCGGGAG CGGGGGACCA 000160 000161 CCAGGTTGCC TAAGGAGGGG TGAACCGGCC CAGGTCGGAA ACGGAGCAGG TCAAAACTCC CGTGCTGATC AGTAGTGGGA 000240 000241 TCGCGCCTGT GAATAGCCAC TGCACTCCAG CCTGGGCAAC ATAGCGAGAC CCCGTCTCT |
