Difference between revisions of "FLICR"
Jiabao Cao (talk | contribs) |
|||
| Line 1: | Line 1: | ||
| + | |||
==Annotated Information== | ==Annotated Information== | ||
| − | === | + | ===Name=== |
| − | FLICR | + | FLICR:FOXP3 regulating long intergenic non-coding RNA<ref name="ref1" /> |
| − | + | ||
| − | FOXP3 regulating long intergenic non-coding RNA | + | ===Characteristics=== |
| − | === | + | FLICR is present across mammalian species with clear stretches of sequence conservation and FLICR's Treg-specific expression and genomic localization, partially overlapping Foxp3, are too striking to ignore. In addition, Flicr modulates Foxp3 expression, most visibly in a subset of Tregs and this subtle fine-tuning has important consequences for autoimmune disease, thus subtly modulating the Janus-faced dominant suppressive function of Tregs.<ref name="ref1" /> |
| − | + | ||
| − | === | + | ===Function=== |
| − | + | Flicr modifies chromatin accessibility in the conserved noncoding sequence 3 (CNS3)/Accessible region 5(AR5) region of Foxp3. And like many lncRNAs, Flicr’s molecular effects are subtle, but by curtailing Treg activity, Flicr markedly promotes autoimmune diabetes and, conversely, restrainsantiviral responses. This mechanism of FoxP3 control may allow escape from dominant Treg control during infection or cancer, at the cost of heightened autoimmunity.<ref name="ref1" /> | |
| − | === | + | |
| − | + | ===Regulation=== | |
| − | === | + | IL-2 can indirectly enhance Foxp3 expression by repressing Flicrhas. |
| − | + | Flicr's expression is also curtailed in conditions of heightened Treg activation and functionality, in tissue Tregs and after TCR activation.<ref name="ref1" /> | |
| − | === | + | |
| − | + | ===Expression=== | |
| − | + | Flicr is an lncRNA Specifically Expressed in Tregs.<ref name="ref1" /> | |
| − | + | ||
| − | == | + | ===Sequence=== |
| − | + | >NR_147988.1 Homo sapiens FOXP3 regulating long intergenic non-coding RNA (FLICR), long non-coding RNA | |
| − | == | + | <dnaseq>CAGGCCCATTCTGGGCTTTTCCAGAAGGGTCTGAAGCCAGTCTTGTAGAGGGCTGGAGTGGTTGTTGGAC |
| − | + | GACTAGAACCCTGGGCTTTGCAGGGTGCTGGGAGCT</dnaseq> | |
| + | ==Labs working on this lncRNA== | ||
| + | *Division of Immunology, Department of Microbiology and Immunobiology, Harvard Medical School, Boston, MA 02115. | ||
| + | ==References== | ||
| + | <references> | ||
| + | <ref name="ref1"> | ||
| + | Zemmour D, Pratama A, Loughhead SM, Mathis D, Benoist C. Flicr, a long | ||
| + | noncoding RNA, modulates Foxp3 expression and autoimmunity. Proc Natl Acad Sci U | ||
| + | S A. 2017 Apr 25;114(17):E3472-E3480. | ||
| + | </ref> | ||
| + | </references> | ||
Revision as of 12:02, 12 August 2017
Contents
Annotated Information
Name
FLICR:FOXP3 regulating long intergenic non-coding RNA[1]
Characteristics
FLICR is present across mammalian species with clear stretches of sequence conservation and FLICR's Treg-specific expression and genomic localization, partially overlapping Foxp3, are too striking to ignore. In addition, Flicr modulates Foxp3 expression, most visibly in a subset of Tregs and this subtle fine-tuning has important consequences for autoimmune disease, thus subtly modulating the Janus-faced dominant suppressive function of Tregs.[1]
Function
Flicr modifies chromatin accessibility in the conserved noncoding sequence 3 (CNS3)/Accessible region 5(AR5) region of Foxp3. And like many lncRNAs, Flicr’s molecular effects are subtle, but by curtailing Treg activity, Flicr markedly promotes autoimmune diabetes and, conversely, restrainsantiviral responses. This mechanism of FoxP3 control may allow escape from dominant Treg control during infection or cancer, at the cost of heightened autoimmunity.[1]
Regulation
IL-2 can indirectly enhance Foxp3 expression by repressing Flicrhas. Flicr's expression is also curtailed in conditions of heightened Treg activation and functionality, in tissue Tregs and after TCR activation.[1]
Expression
Flicr is an lncRNA Specifically Expressed in Tregs.[1]
Sequence
>NR_147988.1 Homo sapiens FOXP3 regulating long intergenic non-coding RNA (FLICR), long non-coding RNA
000081 CTGGGCTTTG CAGGGTGCTG GGAGCT
Labs working on this lncRNA
- Division of Immunology, Department of Microbiology and Immunobiology, Harvard Medical School, Boston, MA 02115.
