Difference between revisions of "NONHSAT008484"
Line 42: | Line 42: | ||
sequence = <dnaseq>tgtcagaaactcagctcagctggaagaaacttgatgtaccaggtatcagagtagcaagtaaagccacaagccaaaaatgaaagagaatcttttaagtgcttatcgtgatggtgtaagtaattgtccaaaagaaacgccgattccttctgttccatttttacctgtggattgtggattgaaataaccattggaccatgaggagagactctgaagagaggtatgtgacagagtggggcctaggggtggctagtgatatgtgatataatactcttttgtgacgttggaccatggcagtgagccgcagctcccagtcagcaatgcgatcccaagaataaacaaccgattcttgacagtgtcctatgttgccagtcgattttgttcaacagtaggtaca</dnaseq>| | sequence = <dnaseq>tgtcagaaactcagctcagctggaagaaacttgatgtaccaggtatcagagtagcaagtaaagccacaagccaaaaatgaaagagaatcttttaagtgcttatcgtgatggtgtaagtaattgtccaaaagaaacgccgattccttctgttccatttttacctgtggattgtggattgaaataaccattggaccatgaggagagactctgaagagaggtatgtgacagagtggggcctaggggtggctagtgatatgtgatataatactcttttgtgacgttggaccatggcagtgagccgcagctcccagtcagcaatgcgatcccaagaataaacaaccgattcttgacagtgtcctatgttgccagtcgattttgttcaacagtaggtaca</dnaseq>| | ||
}} | }} | ||
− | [[Category:Intergenic]][[Category:NONHSAG003775]] | + | [[Category:Intergenic]][[Category:NONHSAG003775]][[Category:Transcripts]] |
Latest revision as of 19:49, 16 October 2014
Please input one-sentence summary here.
Contents
Annotated Information
Transcriptomic Nomeclature
Please input transcriptomic nomeclature information here.
Function
Please input function information here.
Regulation
Please input regulation information here.
Expression
Please input expression information here.
Allelic Information and Variation
Please input allelic information and variation information here.
Evolution
Please input evolution information here.
You can also add sub-section(s) at will.
Labs working on this lncRNA
Please input related labs here.
References
Please input cited references here.
Basic Information
Transcript ID |
NONHSAT008484 |
Source |
NONCODE4.0 |
Same with |
, |
Classification |
intergenic |
Length |
394 nt |
Genomic location |
chr1+:189119674..189277008 |
Exon number |
2 |
Exons |
189119674..189119918,189276860..189277008 |
Genome context |
|
Sequence |
000001 tgtcagaaac tcagctcagc tggaagaaac ttgatgtacc aggtatcaga gtagcaagta aagccacaag ccaaaaatga 000080
000081 aagagaatct tttaagtgct tatcgtgatg gtgtaagtaa ttgtccaaaa gaaacgccga ttccttctgt tccattttta 000160 000161 cctgtggatt gtggattgaa ataaccattg gaccatgagg agagactctg aagagaggta tgtgacagag tggggcctag 000240 000241 gggtggctag tgatatgtga tataatactc ttttgtgacg ttggaccatg gcagtgagcc gcagctccca gtcagcaatg 000320 000321 cgatcccaag aataaacaac cgattcttga cagtgtccta tgttgccagt cgattttgtt caacagtagg taca |
Predicted Small Protein
Name | NONHSAT008484_smProtein_194:259 |
Length | 22 |
Molecular weight | 2487.7229 |
Aromaticity | 0.0952380952381 |
Instability index | 56.519047619 |
Isoelectric point | 4.51251220703 |
Runs | 6 |
Runs residual | 0.0394557823129 |
Runs probability | 0.0250986280399 |
Amino acid sequence | MRRDSEERYVTEWGLGVASDM |
Secondary structure | LLLLLHHHEEEELLLLEELLL |
PRMN | - |
PiMo | - |