Difference between revisions of "NONHSAT062829"
| Line 42: | Line 42: | ||
sequence = <dnaseq>gccatgtgcagcagggcattcctgtagtcccagctactcgggaggctgaggcaggaggattgcttgacccaggagttctgggctgtagtgcactgcaccaatcaagtgtctgcactaagttcagcatcaatatggtgacctcttgagagcaggatgaccaagttgtccaaagagggatgaactggcccaggtcagaaatggagcaggtcaaaactcctgtgctgatcagtagggagatcgtgcgtatgaatagccactgcactccagcctgggcaacatagtgagacctgtc</dnaseq>| | sequence = <dnaseq>gccatgtgcagcagggcattcctgtagtcccagctactcgggaggctgaggcaggaggattgcttgacccaggagttctgggctgtagtgcactgcaccaatcaagtgtctgcactaagttcagcatcaatatggtgacctcttgagagcaggatgaccaagttgtccaaagagggatgaactggcccaggtcagaaatggagcaggtcaaaactcctgtgctgatcagtagggagatcgtgcgtatgaatagccactgcactccagcctgggcaacatagtgagacctgtc</dnaseq>| | ||
}} | }} | ||
| − | [[Category:Intronic(S)]][[Category:NONHSAG025063]] | + | [[Category:Intronic(S)]][[Category:NONHSAG025063]][[Category:Transcripts]] |
Latest revision as of 22:48, 16 October 2014
Please input one-sentence summary here.
Contents
Annotated Information
Transcriptomic Nomeclature
Please input transcriptomic nomeclature information here.
Function
Please input function information here.
Regulation
Please input regulation information here.
Expression
Please input expression information here.
Allelic Information and Variation
Please input allelic information and variation information here.
Evolution
Please input evolution information here.
You can also add sub-section(s) at will.
Labs working on this lncRNA
Please input related labs here.
References
Please input cited references here.
Basic Information
| Transcript ID |
NONHSAT062829 |
| Source |
NONCODE4.0 |
| Same with |
, |
| Classification |
intronic(S) |
| Length |
292 nt |
| Genomic location |
chr19-:17021303..17021594 |
| Exon number |
1 |
| Exons |
17021303..17021594 |
| Genome context |
|
| Sequence |
000001 gccatgtgca gcagggcatt cctgtagtcc cagctactcg ggaggctgag gcaggaggat tgcttgaccc aggagttctg 000080
000081 ggctgtagtg cactgcacca atcaagtgtc tgcactaagt tcagcatcaa tatggtgacc tcttgagagc aggatgacca 000160 000161 agttgtccaa agagggatga actggcccag gtcagaaatg gagcaggtca aaactcctgt gctgatcagt agggagatcg 000240 000241 tgcgtatgaa tagccactgc actccagcct gggcaacata gtgagacctg tc |
