Difference between revisions of "FLICR"
Jiabao Cao (talk | contribs) |
|||
| Line 2: | Line 2: | ||
==Annotated Information== | ==Annotated Information== | ||
===Name=== | ===Name=== | ||
| − | FLICR:FOXP3 regulating long intergenic non-coding RNA<ref name="ref1" /> | + | FLICR:FOXP3 regulating long intergenic non-coding RNA <ref name="ref1" /> |
===Characteristics=== | ===Characteristics=== | ||
| − | + | Flicr neighbors Foxp3 in mouse and human genomes <ref name="ref1" />. | |
===Function=== | ===Function=== | ||
| − | Flicr modifies chromatin accessibility in the conserved noncoding sequence 3 (CNS3)/Accessible region 5(AR5) region of Foxp3. | + | Flicr (Foxp3 long intergenic noncoding RNA) is a negative regulator that regulates key transcription factor FoxP3 expression in Tregs, resulting in twofold- to fivefold-lower levels of FoxP3 protein <ref name="ref1" />. Flicr acts only in cis. It does not affect DNA methylation, but modifies chromatin accessibility in the conserved noncoding sequence 3 (CNS3)/Accessible region 5(AR5) region of Foxp3 <ref name="ref1" />. As a result, Flicr curtails Treg activity, markedly promotes autoimmune diabetes and, conversely, restrains antiviral responses <ref name="ref1" />. Also, this mechanism of FoxP3 control may allow escape from dominant Treg control during infection or cancer, at the cost of heightened autoimmunity <ref name="ref1" />. |
===Regulation=== | ===Regulation=== | ||
| − | IL-2 can | + | IL-2 can repress Flicr to ienhance Foxp3 expression <ref name="ref1" />. |
| − | Flicr's expression is also curtailed in conditions of heightened Treg activation and functionality, in tissue Tregs and after TCR activation | + | |
| + | Flicr's expression is also curtailed in conditions of heightened Treg activation and functionality, in tissue Tregs and after TCR activation <ref name="ref1" />. | ||
===Expression=== | ===Expression=== | ||
| − | Flicr is | + | Flicr is specifically expressed in Tregs <ref name="ref1" />. |
| + | |||
| + | ===Evolution=== | ||
| + | FLICR is highly conserved across mammalian species <ref name="ref1" />. | ||
===Sequence=== | ===Sequence=== | ||
| Line 21: | Line 25: | ||
<dnaseq>CAGGCCCATTCTGGGCTTTTCCAGAAGGGTCTGAAGCCAGTCTTGTAGAGGGCTGGAGTGGTTGTTGGAC | <dnaseq>CAGGCCCATTCTGGGCTTTTCCAGAAGGGTCTGAAGCCAGTCTTGTAGAGGGCTGGAGTGGTTGTTGGAC | ||
GACTAGAACCCTGGGCTTTGCAGGGTGCTGGGAGCT</dnaseq> | GACTAGAACCCTGGGCTTTGCAGGGTGCTGGGAGCT</dnaseq> | ||
| + | |||
==Labs working on this lncRNA== | ==Labs working on this lncRNA== | ||
*Division of Immunology, Department of Microbiology and Immunobiology, Harvard Medical School, Boston, MA 02115. | *Division of Immunology, Department of Microbiology and Immunobiology, Harvard Medical School, Boston, MA 02115. | ||
| + | |||
==References== | ==References== | ||
<references> | <references> | ||
Revision as of 03:46, 29 August 2017
Contents
Annotated Information
Name
FLICR:FOXP3 regulating long intergenic non-coding RNA [1]
Characteristics
Flicr neighbors Foxp3 in mouse and human genomes [1].
Function
Flicr (Foxp3 long intergenic noncoding RNA) is a negative regulator that regulates key transcription factor FoxP3 expression in Tregs, resulting in twofold- to fivefold-lower levels of FoxP3 protein [1]. Flicr acts only in cis. It does not affect DNA methylation, but modifies chromatin accessibility in the conserved noncoding sequence 3 (CNS3)/Accessible region 5(AR5) region of Foxp3 [1]. As a result, Flicr curtails Treg activity, markedly promotes autoimmune diabetes and, conversely, restrains antiviral responses [1]. Also, this mechanism of FoxP3 control may allow escape from dominant Treg control during infection or cancer, at the cost of heightened autoimmunity [1].
Regulation
IL-2 can repress Flicr to ienhance Foxp3 expression [1].
Flicr's expression is also curtailed in conditions of heightened Treg activation and functionality, in tissue Tregs and after TCR activation [1].
Expression
Flicr is specifically expressed in Tregs [1].
Evolution
FLICR is highly conserved across mammalian species [1].
Sequence
>NR_147988.1 Homo sapiens FOXP3 regulating long intergenic non-coding RNA (FLICR), long non-coding RNA
000081 CTGGGCTTTG CAGGGTGCTG GGAGCT
Labs working on this lncRNA
- Division of Immunology, Department of Microbiology and Immunobiology, Harvard Medical School, Boston, MA 02115.
