Difference between revisions of "FLICR"
| (39 intermediate revisions by 3 users not shown) | |||
| Line 1: | Line 1: | ||
| + | ''FLICR'', a long noncoding RNA, modulates Foxp3 expression and autoimmunity | ||
==Annotated Information== | ==Annotated Information== | ||
| + | ===Approved Symbol=== | ||
| + | ''FLICR'' | ||
===Name=== | ===Name=== | ||
| − | FLICR:FOXP3 regulating long intergenic non-coding RNA <ref name="ref1" /> | + | ''FLICR'': FOXP3 regulating long intergenic non-coding RNA <ref name="ref1" /> |
| + | 4930524L23Rik <ref name="ref1" /> | ||
===Characteristics=== | ===Characteristics=== | ||
| − | + | ''FLICR'' neighbors Foxp3 in mouse and human genomes <ref name="ref1" />. | |
| + | ''FLICR'' lncRNA is present across mammalian species with clear stretches of sequence conservation and ''FLICR'' transcripts in the mouse genome have four different isoforms of varying lengths (566,737, 3,278, and 4,150 bp) that share two exonic elements and an | ||
| + | intron, located 1.8 kb upstream of the Foxp3 transcriptional start site (TSS) <ref name="ref1" />. | ||
===Function=== | ===Function=== | ||
| − | + | ''FLICR'' (Foxp3 long intergenic noncoding RNA) is a negative regulator that regulates key transcription factor FoxP3 expression in Tregs, resulting in twofold- to fivefold-lower levels of FoxP3 protein <ref name="ref1" />. Flicr acts only in cis. It does not affect DNA methylation, but modifies chromatin accessibility in the conserved noncoding sequence 3 (CNS3)/Accessible region 5(AR5) region of Foxp3 <ref name="ref1" />. As a result, ''FLICR'' curtails Treg activity, markedly promotes autoimmune diabetes and, conversely, restrains antiviral responses <ref name="ref1" />. Also, this mechanism of FoxP3 control may allow escape from dominant Treg control during infection or cancer, at the cost of heightened autoimmunity <ref name="ref1" />. | |
===Regulation=== | ===Regulation=== | ||
| − | IL-2 can repress | + | IL-2 can repress ''FLICR'' to enhance Foxp3 expression <ref name="ref1" />. |
| + | ''FLICR'' expression is also curtailed in conditions of heightened Treg activation and functionality <ref name="ref1" />. | ||
| − | + | ===Diseases=== | |
| + | *Autoimmune diabetes <ref name="ref1" /> | ||
| + | *Antiviral response <ref name="ref1" /> | ||
===Expression=== | ===Expression=== | ||
| − | + | ''FLICR'' is specifically expressed in Tregs <ref name="ref1" />. | |
===Evolution=== | ===Evolution=== | ||
| − | FLICR is highly conserved across mammalian species <ref name="ref1" />. | + | ''FLICR'' is highly conserved across mammalian species <ref name="ref1" />. |
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
==Labs working on this lncRNA== | ==Labs working on this lncRNA== | ||
| Line 32: | Line 36: | ||
<references> | <references> | ||
<ref name="ref1"> | <ref name="ref1"> | ||
| − | Zemmour D, Pratama A, Loughhead SM, Mathis D, Benoist C. Flicr, a long | + | Zemmour D, Pratama A, Loughhead SM, Mathis D, Benoist C. Flicr, a long noncoding RNA, modulates Foxp3 expression and autoimmunity. Proc Natl Acad Sci U S A. 2017 Apr 25;114(17):E3472-E3480. |
| − | noncoding RNA, modulates Foxp3 expression and autoimmunity. Proc Natl Acad Sci U | + | </ref>(1) |
| − | S A. 2017 Apr 25;114(17):E3472-E3480. | ||
| − | </ref> | ||
</references> | </references> | ||
| + | |||
| + | ===Sequence=== | ||
| + | >gi|110437700|ref|NR_147988.1|Homo sapiens FOXP3 regulating long intergenic non-coding RNA (FLICR), long non-coding RNA | ||
| + | <dnaseq>CAGGCCCATTCTGGGCTTTTCCAGAAGGGTCTGAAGCCAGTCTTGTAGAGGGCTGGAGTGGTTGTTGGAC | ||
| + | GACTAGAACCCTGGGCTTTGCAGGGTGCTGGGAGCT</dnaseq> | ||
Latest revision as of 05:02, 26 August 2019
FLICR, a long noncoding RNA, modulates Foxp3 expression and autoimmunity
Contents
Annotated Information
Approved Symbol
FLICR
Name
FLICR: FOXP3 regulating long intergenic non-coding RNA [1] 4930524L23Rik [1]
Characteristics
FLICR neighbors Foxp3 in mouse and human genomes [1]. FLICR lncRNA is present across mammalian species with clear stretches of sequence conservation and FLICR transcripts in the mouse genome have four different isoforms of varying lengths (566,737, 3,278, and 4,150 bp) that share two exonic elements and an intron, located 1.8 kb upstream of the Foxp3 transcriptional start site (TSS) [1].
Function
FLICR (Foxp3 long intergenic noncoding RNA) is a negative regulator that regulates key transcription factor FoxP3 expression in Tregs, resulting in twofold- to fivefold-lower levels of FoxP3 protein [1]. Flicr acts only in cis. It does not affect DNA methylation, but modifies chromatin accessibility in the conserved noncoding sequence 3 (CNS3)/Accessible region 5(AR5) region of Foxp3 [1]. As a result, FLICR curtails Treg activity, markedly promotes autoimmune diabetes and, conversely, restrains antiviral responses [1]. Also, this mechanism of FoxP3 control may allow escape from dominant Treg control during infection or cancer, at the cost of heightened autoimmunity [1].
Regulation
IL-2 can repress FLICR to enhance Foxp3 expression [1]. FLICR expression is also curtailed in conditions of heightened Treg activation and functionality [1].
Diseases
Expression
FLICR is specifically expressed in Tregs [1].
Evolution
FLICR is highly conserved across mammalian species [1].
Labs working on this lncRNA
- Division of Immunology, Department of Microbiology and Immunobiology, Harvard Medical School, Boston, MA 02115.
References
Sequence
>gi|110437700|ref|NR_147988.1|Homo sapiens FOXP3 regulating long intergenic non-coding RNA (FLICR), long non-coding RNA
000081 CTGGGCTTTG CAGGGTGCTG GGAGCT
