|
|
(28 intermediate revisions by the same user not shown) |
Line 1: |
Line 1: |
− | <div style="padding:0.08em 0.12em;text-align:right;font-size:70%;font-weight:bold;color:#2d2d2d;">
| + | ''FLICR'', a long noncoding RNA, modulates Foxp3 expression and autoimmunity |
− | {|class="wikitable sortable" style="width:80%;text-align:center"
| + | |
− | |-
| + | ==Annotated Information== |
− | !width="30"|Transcript ID
| + | ===Approved Symbol=== |
− | !width="30"|Gene ID
| + | ''FLICR'' |
− | !width="20"|Symbol
| + | ===Name=== |
− | !width="20"|Synonyms
| + | ''FLICR'': FOXP3 regulating long intergenic non-coding RNA <ref name="ref1" /> |
− | !width="30"|Functional Mechanism
| + | 4930524L23Rik <ref name="ref1" /> |
− | !width="30"|Biological Process
| + | |
− | !width="30"|Disease
| + | ===Characteristics=== |
− | !width="30"|Mesh Ontology
| + | ''FLICR'' neighbors Foxp3 in mouse and human genomes <ref name="ref1" />. |
− | |-
| + | ''FLICR'' lncRNA is present across mammalian species with clear stretches of sequence conservation and ''FLICR'' transcripts in the mouse genome have four different isoforms of varying lengths (566,737, 3,278, and 4,150 bp) that share two exonic elements and an |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289501 HSALNT0289501]
| + | intron, located 1.8 kb upstream of the Foxp3 transcriptional start site (TSS) <ref name="ref1" />. |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289501 HSALNG0141612]
| + | |
− | |HPVC1
| + | ===Function=== |
− | |PE5L,HPV18E5L
| + | ''FLICR'' (Foxp3 long intergenic noncoding RNA) is a negative regulator that regulates key transcription factor FoxP3 expression in Tregs, resulting in twofold- to fivefold-lower levels of FoxP3 protein <ref name="ref1" />. Flicr acts only in cis. It does not affect DNA methylation, but modifies chromatin accessibility in the conserved noncoding sequence 3 (CNS3)/Accessible region 5(AR5) region of Foxp3 <ref name="ref1" />. As a result, ''FLICR'' curtails Treg activity, markedly promotes autoimmune diabetes and, conversely, restrains antiviral responses <ref name="ref1" />. Also, this mechanism of FoxP3 control may allow escape from dominant Treg control during infection or cancer, at the cost of heightened autoimmunity <ref name="ref1" />. |
− | |NA
| + | |
− | |pathogenic process
| + | ===Regulation=== |
− | |NA
| + | IL-2 can repress ''FLICR'' to enhance Foxp3 expression <ref name="ref1" />. |
− | |NA
| + | ''FLICR'' expression is also curtailed in conditions of heightened Treg activation and functionality <ref name="ref1" />. |
− | |-
| + | |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289605 HSALNT0289605]
| + | ===Diseases=== |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289605 HSALNG0141720]
| + | *Autoimmune diabetes <ref name="ref1" /> |
− | |Alpha 250/ Alpha 280
| + | *Antiviral response <ref name="ref1" /> |
− | |NONHSAT104559,lnc-C9orf53-2:1
| + | |
− | |NA
| + | ===Expression=== |
− | |NA
| + | ''FLICR'' is specifically expressed in Tregs <ref name="ref1" />. |
− | |NA
| + | |
− | |NA
| + | ===Evolution=== |
− | |-
| + | ''FLICR'' is highly conserved across mammalian species <ref name="ref1" />. |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0199632 HSALNT0199632]
| + | |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0199632 HSALNG0096226]
| + | ==Labs working on this lncRNA== |
− | |N4BP2L2-IT2
| + | *Division of Immunology, Department of Microbiology and Immunobiology, Harvard Medical School, Boston, MA 02115. |
− | |CG030
| + | |
− | |NA
| + | ==References== |
− | |NA
| + | <references> |
− | |NA
| + | <ref name="ref1"> |
− | |NA
| + | Zemmour D, Pratama A, Loughhead SM, Mathis D, Benoist C. Flicr, a long noncoding RNA, modulates Foxp3 expression and autoimmunity. Proc Natl Acad Sci U S A. 2017 Apr 25;114(17):E3472-E3480. |
− | |-
| + | </ref>(1) |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0171094 HSALNT0171094]
| + | </references> |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0171094 HSALNG0082161]
| + | |
− | |LINC01150
| + | ===Sequence=== |
− | |2G7,TCONS_00019134
| + | >gi|110437700|ref|NR_147988.1|Homo sapiens FOXP3 regulating long intergenic non-coding RNA (FLICR), long non-coding RNA |
− | |NA
| + | <dnaseq>CAGGCCCATTCTGGGCTTTTCCAGAAGGGTCTGAAGCCAGTCTTGTAGAGGGCTGGAGTGGTTGTTGGAC |
− | |pathogenic process
| + | GACTAGAACCCTGGGCTTTGCAGGGTGCTGGGAGCT</dnaseq> |
− | |Wilms' tumor
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289115 HSALNT0289115]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289115 HSALNG0032599]
| |
− | |LINC01587
| |
− | |C4orf6,aC1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |neuroblastoma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290105 HSALNT0290105]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290105 HSALNG0142220]
| |
− | |NTT | |
− | |NONHSAT115106 | |
− | |NA | |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |- | |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289234 HSALNT0289234]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289234 HSALNG0053252]
| |
− | |RNF217-AS1
| |
− | |STL
| |
− | |NA
| |
− | |pathogenic process
| |
− | |acute lymphoblastic leukemia
| |
− | |Immune System Diseases;Neoplasms;Hemic and Lymphatic Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0280481 HSALNT0280481]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0280481 HSALNG0136795]
| |
− | |INE2
| |
− | |NCRNA00011
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289485 HSALNT0289485]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289485 HSALNG0137683]
| |
− | |INE1
| |
− | |NCRNA00010
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289511 HSALNT0289511]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289511 HSALNG0141622]
| |
− | |LINC01565
| |
− | |C3orf27,GR6
| |
− | |NA
| |
− | |pathogenic process
| |
− | |leukemia
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289068 HSALNT0289068]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289068 HSALNG0006924]
| |
− | |LINC00869
| |
− | |KIAA0493
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289430 HSALNT0289430]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289430 HSALNG0026312]
| |
− | |ERC2-IT1
| |
− | |C1orf1,C3orf51,Po42
| |
− | |NA
| |
− | |pathogenic process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290394 HSALNT0290394]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290394 HSALNG0142509]
| |
− | |Y RNAs
| |
− | |lnc-PDIA4-1:1
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289195 HSALNT0289195]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289195 HSALNG0032409]
| |
− | |NOP14-AS1
| |
− | |C4orf10,RES4-24
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290309 HSALNT0290309]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290309 HSALNG0142424]
| |
− | |TncRNA
| |
− | |NONHSAT022116,AF080092,TSU
| |
− | |NA
| |
− | |developmental process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289243 HSALNT0289243]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289243 HSALNG0045080]
| |
− | |SMAD5-AS1
| |
− | |SMAD5O,DAMS
| |
− | |NA
| |
− | |pathogenic process
| |
− | |malignant hematopoietic
| |
− | |Cell Physiological Phenomena
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289025 HSALNT0289025]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289025 HSALNG0062672]
| |
− | |LINC00244
| |
− | |C7orf4,NCRNA00244
| |
− | |NA
| |
− | |pathogenic process
| |
− | |preaxial polydactyly
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289017 HSALNT0289017]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289017 HSALNG0055219]
| |
− | |KIF25-AS1
| |
− | |C6orf54,NCRNA00300,HGC6.1.1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |ovarian cancer
| |
− | |Endocrine System Diseases;Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289332 HSALNT0289332]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289332 HSALNG0055207]
| |
− | |LINC01558
| |
− | |C6orf123,LINC01557,HGC6.2,dJ431P23.4
| |
− | |NA
| |
− | |pathogenic process
| |
− | |ovarian cancer
| |
− | |Endocrine System Diseases;Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289438 HSALNT0289438]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289438 HSALNG0055209]
| |
− | |AFDN-AS1
| |
− | |C6orf124,MLLT4-AS1,HGC6.4,dJ431P23.3
| |
− | |NA
| |
− | |pathogenic process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289232 HSALNT0289232]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289232 HSALNG0135027]
| |
− | |RFPL3S
| |
− | |RFPL3-AS1,RFPL3-A, NCRNA00005
| |
− | |NA
| |
− | |pathogenic process
| |
− | |opitz syndrome
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289393 HSALNT0289393]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289393 HSALNG0134830]
| |
− | |RFPL1S
| |
− | |RFPL1-AS1,RFPL1-A, NCRNA00006
| |
− | |NA
| |
− | |pathogenic process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289500 HSALNT0289500]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289500 HSALNG0141611]
| |
− | |HCG4B
| |
− | |HCG4P6,HCGIV-6,HCGIV.5,HCGIV-06,bCX67J3.3,Em:AB023056.16,bPG309N1.1,bQB90C11.3
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289894 HSALNT0289894]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289894 HSALNG0142009]
| |
− | |LINC00294
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289345 HSALNT0289345]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289345 HSALNG0140599]
| |
− | |LINC00893
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hunter syndrome
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290133 HSALNT0290133]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290133 HSALNG0142248]
| |
− | |PCBP3-OT1
| |
− | |PCBP3-OT1,FLJ44028
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289488 HSALNT0289488]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289488 HSALNG0141599]
| |
− | |BPESC1
| |
− | |NCRNA00187
| |
− | |NA
| |
− | |pathogenic process
| |
− | |blepharophimosis syndrome
| |
− | |Eye Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289712 HSALNT0289712]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289712 HSALNG0141827]
| |
− | |COPG2IT1
| |
− | |CIT1,NCRNA00170,COPG2AS
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0265040 HSALNT0265040]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0265040 HSALNG0128978]
| |
− | |LINC00652
| |
− | |HSPC072
| |
− | |NA
| |
− | |developmental process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289282 HSALNT0289282]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289282 HSALNG0108689]
| |
− | |WASIR2
| |
− | |NCRNA00286A
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0246856 HSALNT0246856]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0246856 HSALNG0119601]
| |
− | |LINC00470
| |
− | |C18orf2
| |
− | |NA
| |
− | |pathogenic process
| |
− | |age-related macular degeneration
| |
− | |Eye Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289507 HSALNT0289507]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289507 HSALNG0141618]
| |
− | |LINC00588
| |
− | |C8orf71,DKFZP434F122
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0276604 HSALNT0276604]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0276604 HSALNG0134754]
| |
− | |TTC28-AS1
| |
− | |TTC28AS,TTC28-AS,KIAA1648
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0237577 HSALNT0237577]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0237577 HSALNG0114754]
| |
− | |CDRT7
| |
− | |NCRNA00025,LINC00025
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288912 HSALNT0288912]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288912 HSALNG0114755]
| |
− | |CDRT8
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0275048 HSALNT0275048]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0275048 HSALNG0133887]
| |
− | |CECR3
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |cat eye syndrome
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288915 HSALNT0288915]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288915 HSALNG0133890]
| |
− | |CECR9
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |cat eye syndrome
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288998 HSALNT0288998]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288998 HSALNG0133878]
| |
− | |HDHD5-AS1
| |
− | |CECR4,CECR5-AS1,NCRNA00017
| |
− | |NA
| |
− | |pathogenic process
| |
− | |cat eye syndrome
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288914 HSALNT0288914]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288914 HSALNG0133878]
| |
− | |CECR5-AS1
| |
− | |NCRNA00017
| |
− | |NA
| |
− | |pathogenic process
| |
− | |cat eye syndrome
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288919 HSALNT0288919]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288919 HSALNG0029809]
| |
− | |CLRN1-AS1
| |
− | |CLRN1O,UCRP
| |
− | |NA
| |
− | |pathogenic process
| |
− | |usher syndrome type 3
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289271 HSALNT0289271]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289271 HSALNG0082585]
| |
− | |TMEM9B-AS1
| |
− | |C11orf18
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289324 HSALNT0289324]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289324 HSALNG0133586]
| |
− | |LINC01547
| |
− | |C21orf69,C21orf67
| |
− | |NA
| |
− | |pathogenic process
| |
− | |Down syndrome
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0270409 HSALNT0270409]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0270409 HSALNG0131587]
| |
− | |LINC00029
| |
− | |C20orf51,NCRNA00029,bA305P22.4
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289336 HSALNT0289336]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289336 HSALNG0141634]
| |
− | |LINC00529
| |
− | |C8orf8
| |
− | |NA
| |
− | |pathogenic process
| |
− | |keratolytic winter erythema
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288978 HSALNT0288978]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288978 HSALNG0010403]
| |
− | |FLVCR1-AS1
| |
− | |FLVCR1-DT,LQK1
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0238050 HSALNT0238050]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0238050 HSALNG0114969]
| |
− | |SMCR2
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |Smith-Magenis syndrome
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289401 HSALNT0289401]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289401 HSALNG0114982]
| |
− | |SMCR5
| |
− | |NCRNA00034
| |
− | |NA
| |
− | |pathogenic process
| |
− | |Smith-Magenis syndrome
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290246 HSALNT0290246]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290246 HSALNG0142361]
| |
− | |SMCR6
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |Smith-Magenis syndrome
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0274626 HSALNT0274626]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0274626 HSALNG0133620]
| |
− | |LINC00205
| |
− | |C21orf86,NCRNA00205,
| |
− | |NA
| |
− | |pathogenic process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0271512 HSALNT0271512]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0271512 HSALNG0132117]
| |
− | |C21orf91-OT1
| |
− | |NCRNA00285,D21S2089E
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0272596 HSALNT0272596]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0272596 HSALNG0132582]
| |
− | |LINC00307
| |
− | |NCRNA00307,D21S2091E
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0274502 HSALNT0274502]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0274502 HSALNG0133549]
| |
− | |TSPEAR-AS2
| |
− | |C21orf90
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0274807 HSALNT0274807]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0274807 HSALNG0133721]
| |
− | |MCM3AP-AS1
| |
− | |C21orf85,MCM3APAS,MCM3AP-AS,FLJ10508,NCRNA00031
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288888 HSALNT0288888]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288888 HSALNG0133144]
| |
− | |B3GALT5-AS1
| |
− | |C21orf88
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288898 HSALNT0288898]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288898 HSALNG0133127]
| |
− | |BRWD1-AS2
| |
− | |C21orf87,NCRNA00257,BRWD1-IT2
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289031 HSALNT0289031]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289031 HSALNG0133621]
| |
− | |LINC00315
| |
− | |C21orf93,NCRNA00315
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289033 HSALNT0289033]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289033 HSALNG0133612]
| |
− | |LINC00334
| |
− | |C21orf89,NCRNA00334
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289322 HSALNT0289322]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289322 HSALNG0132477]
| |
− | |LINC00314
| |
− | |C21orf94,NCRNA00314
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0271821 HSALNT0271821]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0271821 HSALNG0132261]
| |
− | |LINC00308
| |
− | |C21orf74,NCRNA00308,PRED16
| |
− | |NA
| |
− | |pathogenic process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289023 HSALNT0289023]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289023 HSALNG0132537]
| |
− | |LINC00189
| |
− | |C21orf109,NCRNA00189
| |
− | |NA
| |
− | |pathogenic process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289375 HSALNT0289375]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289375 HSALNG0042788]
| |
− | |NCRUPAR
| |
− | |ncR-uPAR,ncRuPAR,NCRNA00193
| |
− | |transcriptional regulation
| |
− | |developmental process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0273467 HSALNT0273467]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0273467 HSALNG0133048]
| |
− | |DSCR10
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289480 HSALNT0289480]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289480 HSALNG0132984]
| |
− | |DSCR9
| |
− | |NCRNA00038
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290051 HSALNT0290051]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290051 HSALNG0142166]
| |
− | |MDS2
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |myelodysplastic syndrome
| |
− | |Hemic and Lymphatic Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0127810 HSALNT0127810]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0127810 HSALNG0060777]
| |
− | |ST7-AS2
| |
− | |ST7OT2,ST7AS2
| |
− | |NA
| |
− | |pathogenic process
| |
− | |autism
| |
− | |Mental Disorders
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0127813 HSALNT0127813]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0127813 HSALNG0060778]
| |
− | |ST7-OT3
| |
− | |ST7OT3,NCRNA00026
| |
− | |NA
| |
− | |pathogenic process
| |
− | |autism
| |
− | |Mental Disorders
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290258 HSALNT0290258]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290258 HSALNG0142373]
| |
− | |ST7-OT4
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |autism
| |
− | |Mental Disorders
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290257 HSALNT0290257]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290257 HSALNG0142372]
| |
− | |ST7OT
| |
− | |NONHSAT122926
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289372 HSALNT0289372]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289372 HSALNG0074272]
| |
− | |MIR600HG
| |
− | |C9orf45,NCRNA00287,GL012,FLJ22161
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0013239 HSALNT0013239]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0013239 HSALNG0006325]
| |
− | |ATP1A1-AS1
| |
− | |C1orf203,ATP1A1OS,MGC16179
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0048563 HSALNT0048563]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0048563 HSALNG0022910]
| |
− | |SPATA3-AS1
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0050859 HSALNT0050859]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0050859 HSALNG0024100]
| |
− | |LINC00852
| |
− | |C3orf42,GHRLOS2,NAG73,GHRL-AS2
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0069395 HSALNT0069395]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0069395 HSALNG0033002]
| |
− | |LINC01096
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0072367 HSALNT0072367]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0072367 HSALNG0034486]
| |
− | |LINC02260
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0077259 HSALNT0077259]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0077259 HSALNG0036896]
| |
− | |LINC01091
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0096480 HSALNT0096480]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0096480 HSALNG0046004]
| |
− | |SAP30L-AS1
| |
− | |FLJ38109,GALNT10-AS1
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0098558 HSALNT0098558]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0098558 HSALNG0046927]
| |
− | |PRR7-AS1
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0099356 HSALNT0099356]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0099356 HSALNG0047338]
| |
− | |LINC01622
| |
− | |TCONS_00011202
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0113415 HSALNT0113415]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0113415 HSALNG0053588]
| |
− | |LINC01312
| |
− | |MGC34034
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0134652 HSALNT0134652]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0134652 HSALNG0064240]
| |
− | |EXTL3-AS1
| |
− | |C8orf50
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0138253 HSALNT0138253]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0138253 HSALNG0065979]
| |
− | |C8orf34-AS1
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0154876 HSALNT0154876]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0154876 HSALNG0074139]
| |
− | |PSMD5-AS1
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0163228 HSALNT0163228]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0163228 HSALNG0078227]
| |
− | |LINC01553
| |
− | |C10orf40,AC023904.2
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0175689 HSALNT0175689]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0175689 HSALNG0084463]
| |
− | |LINC00301
| |
− | |C11orf64,NCRNA00301,MGC39681
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0247235 HSALNT0247235]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0247235 HSALNG0119722]
| |
− | |DLGAP1-AS3
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0254200 HSALNT0254200]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0254200 HSALNG0123001]
| |
− | |CIRBP-AS1
| |
− | |C19orf23,MGC39338
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0257335 HSALNT0257335]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0257335 HSALNG0124987]
| |
− | |LINC01785
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0261582 HSALNT0261582]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0261582 HSALNG0127139]
| |
− | |LINC01869
| |
− | |MGC45922
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0269743 HSALNT0269743]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0269743 HSALNG0131262]
| |
− | |LINC01711
| |
− | |MGC4294
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288468 HSALNT0288468]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288468 HSALNG0141311]
| |
− | |FAM41AY1
| |
− | |FAM41AY
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288899 HSALNT0288899]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288899 HSALNG0045020]
| |
− | |C5orf66-AS2
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288922 HSALNT0288922]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288922 HSALNG0083517]
| |
− | |CSTF3-AS1
| |
− | |CSTF3-DT
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288923 HSALNT0288923]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288923 HSALNG0014289]
| |
− | |CYP1B1-AS1
| |
− | |C2orf58,MGC34824
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288957 HSALNT0288957]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288957 HSALNG0025315]
| |
− | |ENTPD3-AS1
| |
− | |FLJ36665
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288970 HSALNT0288970]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288970 HSALNG0071511]
| |
− | |FAM27E3
| |
− | |MGC42630
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288972 HSALNT0288972]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288972 HSALNG0000046]
| |
− | |FAM41C
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288977 HSALNT0288977]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288977 HSALNG0007223]
| |
− | |FLG-AS1
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288983 HSALNT0288983]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288983 HSALNG0105871]
| |
− | |GABPB1-IT1
| |
− | |FLJ10038
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289010 HSALNT0289010]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289010 HSALNG0123950]
| |
− | |ILF3-AS1
| |
− | |ILF3-DT
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289034 HSALNT0289034]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289034 HSALNG0097943]
| |
− | |LINC00347
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289039 HSALNT0289039]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289039 HSALNG0004105]
| |
− | |LINC00466
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289040 HSALNT0289040]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289040 HSALNG0022951]
| |
− | |LINC00471
| |
− | |C2orf52,MGC43122
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289044 HSALNT0289044]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289044 HSALNG0119752]
| |
− | |LINC00526
| |
− | |C18orf18,MGC17515,HsT959
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289048 HSALNT0289048]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289048 HSALNG0106873]
| |
− | |LINC00593
| |
− | |C15orf50,MGC42951
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289050 HSALNT0289050]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289050 HSALNG0022320]
| |
− | |LINC00608
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289054 HSALNT0289054]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289054 HSALNG0104144]
| |
− | |LINC00638
| |
− | |MGC23270
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289056 HSALNT0289056]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289056 HSALNG0124410]
| |
− | |LINC00661
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289057 HSALNT0289057]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289057 HSALNG0125113]
| |
− | |LINC00662
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289062 HSALNT0289062]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289062 HSALNG0024755]
| |
− | |LINC00692
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289064 HSALNT0289064]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289064 HSALNG0075805]
| |
− | |LINC00705
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289067 HSALNT0289067]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289067 HSALNG0118878]
| |
− | |LINC00868
| |
− | |C17orf52
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0130693 HSALNT0130693]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0130693 HSALNG0062275]
| |
− | |LINC00996
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289101 HSALNT0289101]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289101 HSALNG0089327]
| |
− | |LINC01252
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289131 HSALNT0289131]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289131 HSALNG0113283]
| |
− | |LINC02135
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289193 HSALNT0289193]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289193 HSALNG0018445]
| |
− | |NIFK-AS1
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289244 HSALNT0289244]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289244 HSALNG0008972]
| |
− | |SMG7-AS1
| |
− | |DKFZP564C196
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0235326 HSALNT0235326]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0235326 HSALNG0113528]
| |
− | |SNAI3-AS1
| |
− | |MGC23284
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0215205 HSALNT0215205]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0215205 HSALNG0103442]
| |
− | |SNHG10
| |
− | |C14orf62,FLJ40557,NCRNA00063,LINC00063
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289290 HSALNT0289290]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289290 HSALNG0109122]
| |
− | |ZNF205-AS1
| |
− | |MGC3771
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289294 HSALNT0289294]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289294 HSALNG0009820]
| |
− | |LINC00260
| |
− | |C1orf217,NCRNA00260,MGC5457
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289295 HSALNT0289295]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289295 HSALNG0000511]
| |
− | |LINC00337
| |
− | |C1orf211,NCRNA00337,MGC40168
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289298 HSALNT0289298]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289298 HSALNG0076905]
| |
− | |WAC-AS1
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289299 HSALNT0289299]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289299 HSALNG0077486]
| |
− | |LINC00839
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289303 HSALNT0289303]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289303 HSALNG0089110]
| |
− | |LINC00612
| |
− | |C12orf33,MGC40170,FLJ41814
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289312 HSALNT0289312]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289312 HSALNG0124755]
| |
− | |LINC00663
| |
− | |MGC39821
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289320 HSALNT0289320]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289320 HSALNG0130611]
| |
− | |LINC00494
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289330 HSALNT0289330]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289330 HSALNG0039733]
| |
− | |LINC01019
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289333 HSALNT0289333]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289333 HSALNG0057380]
| |
− | |LINC00265
| |
− | |NCRNA00265,NCRNA00265-1
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289334 HSALNT0289334]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289334 HSALNG0062824]
| |
− | |LINC00689
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289337 HSALNT0289337]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289337 HSALNG0068847]
| |
− | |LINC01591
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289340 HSALNT0289340]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289340 HSALNG0072666]
| |
− | |LINC01501
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289346 HSALNT0289346]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289346 HSALNG0137712]
| |
− | |LINC01560
| |
− | |CXorf24
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289352 HSALNT0289352]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289352 HSALNG0045051]
| |
− | |LINC01959
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289353 HSALNT0289353]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289353 HSALNG0110333]
| |
− | |LINC02175
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289354 HSALNT0289354]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289354 HSALNG0064321]
| |
− | |LINC02209
| |
− | |FAM183CP
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289359 HSALNT0289359]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289359 HSALNG0107406]
| |
− | |LINGO1-AS1
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289362 HSALNT0289362]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289362 HSALNG0119342]
| |
− | |MAFG-AS1
| |
− | |MAFG-DT
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289373 HSALNT0289373]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289373 HSALNG0139326]
| |
− | |MORF4L2-AS1
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289381 HSALNT0289381]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289381 HSALNG0029035]
| |
− | |NPHP3-AS1
| |
− | |NCRNA00119
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289385 HSALNT0289385]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289385 HSALNG0062543]
| |
− | |PAXIP1-AS1
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289413 HSALNT0289413]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289413 HSALNG0082091]
| |
− | |TOLLIP-AS1
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289416 HSALNT0289416]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289416 HSALNG0113198]
| |
− | |LINC00311
| |
− | |TMEM148,NCRNA00311,MGC22001
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289422 HSALNT0289422]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289422 HSALNG0069500]
| |
− | |ZNF252P-AS1
| |
− | |C8orf77
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289423 HSALNT0289423]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289423 HSALNG0001624]
| |
− | |ZNF436-AS1
| |
− | |C1orf213,FLJ90508
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289429 HSALNT0289429]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289429 HSALNG0029047]
| |
− | |BFSP2-AS1
| |
− | |MGC2848
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289432 HSALNT0289432]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289432 HSALNG0032263]
| |
− | |CTBP1-AS1
| |
− | |C4orf42,CTBP1-DT,CTBP1-DT,MGC21675
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289436 HSALNT0289436]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289436 HSALNG0039444]
| |
− | |EXOC3-AS1
| |
− | |C5orf55
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289441 HSALNT0289441]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289441 HSALNG0049246]
| |
− | |HCG27
| |
− | |bPG299F13.9,bCX101P6.9,bQB115I13.2,FLJ40123
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289450 HSALNT0289450]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289450 HSALNG0067505]
| |
− | |BAALC-AS2
| |
− | |C8orf56,BAALCOS,MGC39526
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289453 HSALNT0289453]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289453 HSALNG0062877]
| |
− | |FAM87A
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289459 HSALNT0289459]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289459 HSALNG0078365]
| |
− | |JMJD1C-AS1
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289465 HSALNT0289465]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289465 HSALNG0092957]
| |
− | |ATP2B1-AS1
| |
− | |LINC00936
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289466 HSALNT0289466]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289466 HSALNG0093183]
| |
− | |CEP83-AS1
| |
− | |CEP83-DT
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289470 HSALNT0289470]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289470 HSALNG0107054]
| |
− | |HEXA-AS1
| |
− | |C15orf34,FLJ13315
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289487 HSALNT0289487]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289487 HSALNG0141598]
| |
− | |BIN3-IT1
| |
− | |FLJ14107
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289490 HSALNT0289490]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289490 HSALNG0141601]
| |
− | |CSNK1G2-AS1
| |
− | |C19orf34,MGC39696
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289508 HSALNT0289508]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289508 HSALNG0141619]
| |
− | |LINC00634
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289510 HSALNT0289510]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289510 HSALNG0141621]
| |
− | |LINC00685
| |
− | |CXYorf10,NCRNA00107,PPP2R3B-AS1,OTTHUMT00000055574
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289515 HSALNT0289515]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289515 HSALNG0141626]
| |
− | |SHANK2-AS3
| |
− | |C11orf76
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290073 HSALNT0290073]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290073 HSALNG0142188]
| |
− | |NCBP2-AS2
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289502 HSALNT0289502]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289502 HSALNG0141613]
| |
− | |KCNIP4-IT1
| |
− | |NCRNA00099,UM9-5
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289856 HSALNT0289856]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289856 HSALNG0141971]
| |
− | |GTSCR1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |Gilles de la Tourette syndrome
| |
− | |Mental Disorders;Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289325 HSALNT0289325]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289325 HSALNG0008917]
| |
− | |LINC00272
| |
− | |C1orf120,NCRNA00272,RP1-223H12.3
| |
− | |NA
| |
− | |pathogenic process
| |
− | |prostate cancer
| |
− | |Male Urogenital Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288512 HSALNT0288512]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288512 HSALNG0141348]
| |
− | |TTTY9B
| |
− | |NCRNA00132
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290155 HSALNT0290155]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290155 HSALNG0142270]
| |
− | |Prion-associated RNAs
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |prion disease
| |
− | |Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289444 HSALNT0289444]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289444 HSALNG0062567]
| |
− | |BLACE
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |acute B lymphoblastic leukemias
| |
− | |Hemic and Lymphatic Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0060411 HSALNT0060411]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0060411 HSALNG0028877]
| |
− | |H1FX-AS1
| |
− | |C3orf47,FLJ34151
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0186668 HSALNT0186668]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0186668 HSALNG0089868]
| |
− | |LINC00477
| |
− | |C12orf67,FLJ32894,FAM191B
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0275096 HSALNT0275096]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0275096 HSALNG0133923]
| |
− | |LINC00528
| |
− | |C22orf37,FLJ40542
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0287824 HSALNT0287824]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0287824 HSALNG0140941]
| |
− | |ASMTL-AS1
| |
− | |CXYorf2,NCRNA00105,ASMTLAS,ASMTL-AS,FLJ13330
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288887 HSALNT0288887]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288887 HSALNG0106820]
| |
− | |ANP32A-IT1
| |
− | |C15orf28,NCRNA00321,FLJ11722,HsT18971
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289370 HSALNT0289370]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289370 HSALNG0010128]
| |
− | |MIR29B2CHG
| |
− | |C1orf132,FLJ35650
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289396 HSALNT0289396]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289396 HSALNG0007497]
| |
− | |RUSC1-AS1
| |
− | |C1orf104,FLJ35976
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0084628 HSALNT0084628]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0084628 HSALNG0040236]
| |
− | |LINC01194
| |
− | |CT49,TAG
| |
− | |NA
| |
− | |pathogenic process
| |
− | |melanoma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289468 HSALNT0289468]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289468 HSALNG0103838]
| |
− | |DIO3OS
| |
− | |C14orf134,NCRNA00041,DIO3-AS1,NONHSAT040032,NONHSAT040039,BC111049
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0121060 HSALNT0121060]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0121060 HSALNG0057178]
| |
− | |NPSR1-AS1
| |
− | |AAA1,IMAGE:4827585
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0074370 HSALNT0074370]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0074370 HSALNG0035535]
| |
− | |LINC00575
| |
− | |C4orf11
| |
− | |NA
| |
− | |pathogenic process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0137345 HSALNT0137345]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0137345 HSALNG0065537]
| |
− | |LINC01602
| |
− | |T1560
| |
− | |NA
| |
− | |pathogenic process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289433 HSALNT0289433]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289433 HSALNG0035768]
| |
− | |FAM13A-AS1
| |
− | |FAM13A1OS,FAM13AOS,NCRNA00039
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289186 HSALNT0289186]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289186 HSALNG0072891]
| |
− | |MIRLET7DHG
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0155254 HSALNT0155254]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0155254 HSALNG0074353]
| |
− | |MIR181A2HG
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289283 HSALNT0289283]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289283 HSALNG0035624]
| |
− | |WDFY3-AS2
| |
− | |C4orf12,NCRNA00247,FBI4
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0154555 HSALNT0154555]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0154555 HSALNG0073990]
| |
− | |PAPPA-AS1
| |
− | |PAPPAS,PAPPA-AS,DIPAS,TAF4B,TAF2C2,TAFII105,NCRNA00156
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0136307 HSALNT0136307]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0136307 HSALNG0065020]
| |
− | |LINC00293
| |
− | |BEYLA
| |
− | |NA
| |
− | |developmental process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0030983 HSALNT0030983]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0030983 HSALNG0014614]
| |
− | |SIX3-AS1
| |
− | |SIX3OS
| |
− | |NA
| |
− | |developmental process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0211503 HSALNT0211503]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0211503 HSALNG0101546]
| |
− | |OTX2-AS1
| |
− | |OTX2OS1
| |
− | |NA
| |
− | |developmental process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0063422 HSALNT0063422]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0063422 HSALNG0030360]
| |
− | |LINC01192
| |
− | |CT64
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0217123 HSALNT0217123]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0217123 HSALNG0104394]
| |
− | |LINC01193
| |
− | |CT60,LOC348120
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289664 HSALNT0289664]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289664 HSALNG0141779]
| |
− | |C1QTNF9B-AS1
| |
− | |PCOTH
| |
− | |NA
| |
− | |pathogenic process
| |
− | |prostate cancer
| |
− | |Male Urogenital Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289623 HSALNT0289623]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289623 HSALNG0141738]
| |
− | |ATP6V1G2-DDX39B
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |dilated cardiomyopathy
| |
− | |Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289498 HSALNT0289498]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289498 HSALNG0141609]
| |
− | |FAM226B
| |
− | |CXorf50B,NCRNA00246B,LINC00246B
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289321 HSALNT0289321]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289321 HSALNG0133590]
| |
− | |LINC00163
| |
− | |C21orf134,NCRNA00163,NLC1-A,NLC1A
| |
− | |NA
| |
− | |pathogenic process
| |
− | |narcolepsy
| |
− | |Mental Disorders;Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289505 HSALNT0289505]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289505 HSALNG0141616]
| |
− | |LINC00165
| |
− | |C21orf135,NCRNA00165,NLC1-B
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290297 HSALNT0290297]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290297 HSALNG0142412]
| |
− | |TEA-ncRNAs
| |
− | |ENSG00000251002
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0274212 HSALNT0274212]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0274212 HSALNG0133403]
| |
− | |LINC00322
| |
− | |C21orf136,NCRNA00322,FLJ16545
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289741 HSALNT0289741]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289741 HSALNG0141856]
| |
− | |DHFR upstream transcripts
| |
− | |DHFR minor transcript 5'-UTR,ENSG00000228716,NONHSAT102417
| |
− | |transcriptional regulation
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289527 HSALNT0289527]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289527 HSALNG0141642]
| |
− | |21A
| |
− | |ncRNA 21A,NONHSAT128494
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289409 HSALNT0289409]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289409 HSALNG0080181]
| |
− | |TLX1NB
| |
− | |TD1,TDI,APT-B7
| |
− | |NA
| |
− | |pathogenic process
| |
− | |leukemogenesis
| |
− | |Hemic and Lymphatic Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289662 HSALNT0289662]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289662 HSALNG0141777]
| |
− | |C15orf2
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |Angelman syndrome
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290097 HSALNT0290097]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290097 HSALNG0142212]
| |
− | |NPAP1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |Angelman syndrome
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0217406 HSALNT0217406]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0217406 HSALNG0104530]
| |
− | |PWRN2
| |
− | |NCRNA00199
| |
− | |NA
| |
− | |pathogenic process
| |
− | |Prader-Willi syndrome
| |
− | |Nutritional and Metabolic Diseases;Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289227 HSALNT0289227]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289227 HSALNG0104528]
| |
− | |PWRN1
| |
− | |NCRNA00198
| |
− | |NA
| |
− | |pathogenic process
| |
− | |Prader-Willi syndrome
| |
− | |Nutritional and Metabolic Diseases;Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0262816 HSALNT0262816]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0262816 HSALNG0127793]
| |
− | |MIMT1
| |
− | |MIM1,NCRNA00067,LINC00067
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289180 HSALNT0289180]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289180 HSALNG0000682]
| |
− | |MIR34AHG
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289357 HSALNT0289357]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289357 HSALNG0049203]
| |
− | |LINC02570
| |
− | |XXbac-BPG27H4.8
| |
− | |NA
| |
− | |pathogenic process
| |
− | |MHC-associated diseases
| |
− | |Immune System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290177 HSALNT0290177]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290177 HSALNG0142292]
| |
− | |RNY1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |cervix cancer;prostate cancer;colorectal cancer;bladder cancer;kidney cancer;lung cancer
| |
− | |Neoplasms;Respiratory Tract Diseases;Male Urogenital Diseases;Female Urogenital Diseases and Pregnancy Complications;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289378 HSALNT0289378]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289378 HSALNG0129114]
| |
− | |NKX2-2-AS1
| |
− | |NKX2-2AS
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290151 HSALNT0290151]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290151 HSALNG0142266]
| |
− | |PR antisense transcripts
| |
− | |FJ515872.1,NONHSAT023851
| |
− | |transcriptional regulation
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0180290 HSALNT0180290]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0180290 HSALNG0086714]
| |
− | |PGR-AS1,PR antisense transcripts
| |
− | |AT1,AT2,AT3
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289607 HSALNT0289607]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289607 HSALNG0141722]
| |
− | |anti-NOS2A
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |meningioma;glioblastoma
| |
− | |Neoplasms;Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289687 HSALNT0289687]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289687 HSALNG0141802]
| |
− | |CDKN1A-AS1
| |
− | |p21NAT
| |
− | |transcriptional regulation
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289166 HSALNT0289166]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289166 HSALNG0103805]
| |
− | |MEG9
| |
− | |LINC00584
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0116668 HSALNT0116668]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0116668 HSALNG0055114]
| |
− | |RPS6KA2-AS1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |breast cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289384 HSALNT0289384]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289384 HSALNG0073983]
| |
− | |PAPPA-AS2
| |
− | |AGU1
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0262802 HSALNT0262802]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0262802 HSALNG0127785]
| |
− | |ZIM2-AS1
| |
− | |ZIM2as
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289824 HSALNT0289824]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289824 HSALNG0141939]
| |
− | |Evf2
| |
− | |Evf-2,Dlx6as1,Dlx6os1,ENSG00000231764, ENST00000430027.2,lnc-DLX5-3:1
| |
− | |transcriptional regulation
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289481 HSALNT0289481]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289481 HSALNG0134495]
| |
− | |ADORA2A-AS1
| |
− | |C22orf45,FLJ34651
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290146 HSALNT0290146]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290146 HSALNG0142261]
| |
− | |POU5F1P4
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |prostate cancer
| |
− | |Male Urogenital Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290033 HSALNT0290033]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290033 HSALNG0142148]
| |
− | |LSINCT1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |lung cancer;breast cancer
| |
− | |Respiratory Tract Diseases;Skin and Connective Tissue Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290034 HSALNT0290034]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290034 HSALNG0142149]
| |
− | |LSINCT10
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |lung cancer;breast cancer
| |
− | |Respiratory Tract Diseases;Skin and Connective Tissue Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290035 HSALNT0290035]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290035 HSALNG0142150]
| |
− | |LSINCT11
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |lung cancer;breast cancer
| |
− | |Respiratory Tract Diseases;Skin and Connective Tissue Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290036 HSALNT0290036]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290036 HSALNG0142151]
| |
− | |LSINCT12
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |lung cancer;breast cancer
| |
− | |Respiratory Tract Diseases;Skin and Connective Tissue Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290037 HSALNT0290037]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290037 HSALNG0142152]
| |
− | |LSINCT2
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |lung cancer;breast cancer
| |
− | |Respiratory Tract Diseases;Skin and Connective Tissue Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290038 HSALNT0290038]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290038 HSALNG0142153]
| |
− | |LSINCT3
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |lung cancer;breast cancer
| |
− | |Respiratory Tract Diseases;Skin and Connective Tissue Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290039 HSALNT0290039]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290039 HSALNG0142154]
| |
− | |LSINCT4
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |lung cancer;breast cancer
| |
− | |Respiratory Tract Diseases;Skin and Connective Tissue Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290041 HSALNT0290041]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290041 HSALNG0142156]
| |
− | |LSINCT6
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |lung cancer;breast cancer
| |
− | |Respiratory Tract Diseases;Skin and Connective Tissue Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290042 HSALNT0290042]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290042 HSALNG0142157]
| |
− | |LSINCT7
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |lung cancer;breast cancer
| |
− | |Respiratory Tract Diseases;Skin and Connective Tissue Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290043 HSALNT0290043]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290043 HSALNG0142158]
| |
− | |LSINCT8
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |lung cancer;breast cancer
| |
− | |Respiratory Tract Diseases;Skin and Connective Tissue Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290044 HSALNT0290044]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290044 HSALNG0142159]
| |
− | |LSINCT9
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |lung cancer;breast cancer
| |
− | |Respiratory Tract Diseases;Skin and Connective Tissue Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289676 HSALNT0289676]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289676 HSALNG0141791]
| |
− | |CAR Intergenic 10
| |
− | |FLJ31066,NONHSAT016928,lnc-FANK1-3:1
| |
− | |transcriptional regulation
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290032 HSALNT0290032]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290032 HSALNG0142147]
| |
− | |LRRC3DN
| |
− | |C21orf30,DKFZP434C128
| |
− | |transcriptional regulation
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0266984 HSALNT0266984]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0266984 HSALNG0129985]
| |
− | |SNHG11
| |
− | |C20orf198,LINC00101,NCRNA00101
| |
− | |NA
| |
− | |pathogenic process
| |
− | |obesity
| |
− | |Nutritional and Metabolic Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289880 HSALNT0289880]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289880 HSALNG0141995]
| |
− | |KRASP1
| |
− | |NONHSAT113225,ENSG00000220635
| |
− | |ceRNA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0006368 HSALNT0006368]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0006368 HSALNG0003376]
| |
− | |CYP4A22-AS1
| |
− | |ncRNA-a3
| |
− | |transcriptional regulation
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0027470 HSALNT0027470]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0027470 HSALNG0013045]
| |
− | |LINC00570
| |
− | |ncRNA-a5
| |
− | |transcriptional regulation
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289066 HSALNT0289066]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289066 HSALNG0003381]
| |
− | |LINC00853
| |
− | |PDZK1IP1-AS1,ncRNA-a4
| |
− | |transcriptional regulation
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289936 HSALNT0289936]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289936 HSALNG0142051]
| |
− | |lincRNA-ROR
| |
− | |ROR,lincRNA-ST8SIA3,ENSG00000258609,NONHSAT059436
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289705 HSALNT0289705]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289705 HSALNG0141820]
| |
− | |CHL1-AS2
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |adolescent idiopathic scoliosis
| |
− | |Musculoskeletal Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0076084 HSALNT0076084]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0076084 HSALNG0036316]
| |
− | |SEC24B-AS1
| |
− | |1/2-SBSRNA4
| |
− | |siRNA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290137 HSALNT0290137]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290137 HSALNG0142252]
| |
− | |PDZRN3-AS1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |type 2 diabetes
| |
− | |Nutritional and Metabolic Diseases;Endocrine System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290237 HSALNT0290237]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290237 HSALNG0142352]
| |
− | |SCAANT1
| |
− | |ATXN7-AS1
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |spinocerebellar ataxia
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289594 HSALNT0289594]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289594 HSALNG0141709]
| |
− | |AK123790
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatocelluar cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289911 HSALNT0289911]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289911 HSALNG0142026]
| |
− | |LINC01451
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatocelluar cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290401 HSALNT0290401]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290401 HSALNG0142516]
| |
− | |ZNF350-AS1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatocelluar cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289845 HSALNT0289845]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289845 HSALNG0141960]
| |
− | |GADD45G
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |pituitary adenoma
| |
− | |Endocrine System Diseases;Neoplasms;Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289410 HSALNT0289410]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289410 HSALNG0043357]
| |
− | |TMEM161B-AS1
| |
− | |AK082072,linc-POLR3G-8,ENSG00000247828
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289736 HSALNT0289736]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289736 HSALNG0141851]
| |
− | |DAPK1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |Pancreatic ductal adenocarcinoma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290048 HSALNT0290048]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290048 HSALNG0142163]
| |
− | |MAP3K14
| |
− | |MAP3K14
| |
− | |NA
| |
− | |pathogenic process
| |
− | |Pancreatic ductal adenocarcinoma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290150 HSALNT0290150]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290150 HSALNG0142265]
| |
− | |PPP3CB
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |Pancreatic ductal adenocarcinoma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0151531 HSALNT0151531]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0151531 HSALNG0072477]
| |
− | |DAPK1-IT1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288990 HSALNT0288990]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288990 HSALNG0041256]
| |
− | |GDNF-AS1
| |
− | |GDNFOS
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |Alzheimer's disease
| |
− | |Mental Disorders;Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0029702 HSALNT0029702]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0029702 HSALNG0014093]
| |
− | |BIRC6-AS2
| |
− | |megamind
| |
− | |NA
| |
− | |developmental process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0029692 HSALNT0029692]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0029692 HSALNG0014085]
| |
− | |BIRC6-AS1
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289310 HSALNT0289310]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289310 HSALNG0116623]
| |
− | |LINC00854
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290332 HSALNT0290332]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290332 HSALNG0142447]
| |
− | |uc.73
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |colorectal cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289841 HSALNT0289841]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289841 HSALNG0141956]
| |
− | |FR0257520
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |prostate cancer
| |
− | |Male Urogenital Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290104 HSALNT0290104]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290104 HSALNG0142219]
| |
− | |NRG1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |lung cancer
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289689 HSALNT0289689]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289689 HSALNG0141804]
| |
− | |CDKN2B-AS11
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process;developmental process
| |
− | |stroke
| |
− | |Cardiovascular Diseases;Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289690 HSALNT0289690]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289690 HSALNG0141805]
| |
− | |CDKN2B-AS12
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |glioma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289691 HSALNT0289691]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289691 HSALNG0141806]
| |
− | |CDKN2B-AS13
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |plexiform neurofibroma
| |
− | |Neoplasms;Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289697 HSALNT0289697]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289697 HSALNG0141812]
| |
− | |CDKN2B-AS7
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |acute lymphoblastic leukemia
| |
− | |Immune System Diseases;Neoplasms;Hemic and Lymphatic Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289826 HSALNT0289826]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289826 HSALNG0141941]
| |
− | |FADS1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |lipid metabolism disorder
| |
− | |Nutritional and Metabolic Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289698 HSALNT0289698]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289698 HSALNG0141813]
| |
− | |CDKN2B-AS8
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |melanoma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289696 HSALNT0289696]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289696 HSALNG0141811]
| |
− | |CDKN2B-AS6
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |neuroblastoma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289699 HSALNT0289699]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289699 HSALNG0141814]
| |
− | |CDKN2B-AS9
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |prostate cancer
| |
− | |Male Urogenital Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289688 HSALNT0289688]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289688 HSALNG0141803]
| |
− | |CDKN2B-AS10
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |stroke
| |
− | |Cardiovascular Diseases;Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288950 HSALNT0288950]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288950 HSALNG0031716]
| |
− | |ENST00000456816
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |clear cell renal cell cancer
| |
− | |Male Urogenital Diseases;Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290021 HSALNT0290021]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290021 HSALNG0142136]
| |
− | |LOC389332
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |clear cell renal cell cancer
| |
− | |Male Urogenital Diseases;Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290306 HSALNT0290306]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290306 HSALNG0142421]
| |
− | |TMEM72
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |clear cell renal cell cancer
| |
− | |Male Urogenital Diseases;Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289641 HSALNT0289641]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289641 HSALNG0141756]
| |
− | |BC029135
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |renal clear cell cancer
| |
− | |Male Urogenital Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290374 HSALNT0290374]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290374 HSALNG0142489]
| |
− | |X91348
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |renal clear cell cancer
| |
− | |Male Urogenital Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289694 HSALNT0289694]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289694 HSALNG0141809]
| |
− | |CDKN2B-AS4
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |cancer
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289692 HSALNT0289692]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289692 HSALNG0141807]
| |
− | |CDKN2B-AS2
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |coronary heart disease
| |
− | |Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289693 HSALNT0289693]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289693 HSALNG0141808]
| |
− | |CDKN2B-AS3
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |intracranial aneurysm
| |
− | |Cardiovascular Diseases;Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289695 HSALNT0289695]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289695 HSALNG0141810]
| |
− | |CDKN2B-AS5
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |type 2 diabetes
| |
− | |Nutritional and Metabolic Diseases;Endocrine System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290319 HSALNT0290319]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290319 HSALNG0142434]
| |
− | |T-UCRs
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |neuroblastoma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289530 HSALNT0289530]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289530 HSALNG0141645]
| |
− | |51A
| |
− | |NA
| |
− | |splicing regulation
| |
− | |pathogenic process
| |
− | |Alzheimer's disease
| |
− | |Mental Disorders;Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290163 HSALNT0290163]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290163 HSALNG0142278]
| |
− | |RAB4B-EGLN2
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |cancer
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290167 HSALNT0290167]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290167 HSALNG0142282]
| |
− | |RERT
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatocellular cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0265263 HSALNT0265263]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0265263 HSALNG0129088]
| |
− | |LINC00237
| |
− | |NCRNA00237
| |
− | |NA
| |
− | |pathogenic process
| |
− | |macrocephaly;obesity
| |
− | |Musculoskeletal Diseases;Pathological Conditions, Signs and Symptoms;Nutritional and Metabolic Diseases;Physiological Phenomena
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0267186 HSALNT0267186]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0267186 HSALNG0130081]
| |
− | |LINC01370
| |
− | |HI-LNC25,HILNC25
| |
− | |NA
| |
− | |pathogenic process
| |
− | |type 2 diabetes
| |
− | |Nutritional and Metabolic Diseases;Endocrine System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289114 HSALNT0289114]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289114 HSALNG0046884]
| |
− | |LINC01574
| |
− | |HI-LNC12,TCONS_00009551
| |
− | |NA
| |
− | |pathogenic process
| |
− | |type 2 diabetes
| |
− | |Nutritional and Metabolic Diseases;Endocrine System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290159 HSALNT0290159]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290159 HSALNG0142274]
| |
− | |PTHLH
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |brachydactyly
| |
− | |Musculoskeletal Diseases;Congenital, Hereditary, and Neonatal Diseases and Abnormalities
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0189394 HSALNT0189394]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0189394 HSALNG0091306]
| |
− | |CISTR
| |
− | |CISTR-ACT,CISTRACT,re52431
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |brachydactyly
| |
− | |Musculoskeletal Diseases;Congenital, Hereditary, and Neonatal Diseases and Abnormalities
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289862 HSALNT0289862]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289862 HSALNG0141977]
| |
− | |HELLPAR
| |
− | |LINC-HELLP
| |
− | |NA
| |
− | |pathogenic process
| |
− | |HELLP syndrome
| |
− | |Female Urogenital Diseases and Pregnancy Complications
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289904 HSALNT0289904]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289904 HSALNG0142019]
| |
− | |LINC01125
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |uremia
| |
− | |Male Urogenital Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289544 HSALNT0289544]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289544 HSALNG0141659]
| |
− | |AC002511.1
| |
− | |LINC01531
| |
− | |NA
| |
− | |pathogenic process
| |
− | |enterovirus 71 infection
| |
− | |Virus Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289609 HSALNT0289609]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289609 HSALNG0141724]
| |
− | |AP000688.29
| |
− | |AP000688.2
| |
− | |NA
| |
− | |pathogenic process
| |
− | |enterovirus 71 infection
| |
− | |Virus Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289832 HSALNT0289832]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289832 HSALNG0141947]
| |
− | |FFAR2
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |enterovirus 71 infection
| |
− | |Virus Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290222 HSALNT0290222]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290222 HSALNG0142337]
| |
− | |RP4-620F22.3
| |
− | |AC099063.2
| |
− | |NA
| |
− | |pathogenic process
| |
− | |enterovirus 71 infection
| |
− | |Virus Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290227 HSALNT0290227]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290227 HSALNG0142342]
| |
− | |RP5-843L14.1
| |
− | |LINC01716
| |
− | |NA
| |
− | |pathogenic process
| |
− | |enterovirus 71 infection
| |
− | |Virus Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0287285 HSALNT0287285]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0287285 HSALNG0140617]
| |
− | |MAGEA8-AS1
| |
− | |RP5-869M20.2
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289019 HSALNT0289019]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289019 HSALNG0094159]
| |
− | |LHX5-AS1
| |
− | |locus4010
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288902 HSALNT0288902]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288902 HSALNG0023597]
| |
− | |CAPN10-AS1
| |
− | |CAPN10-DT,locus959
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289404 HSALNT0289404]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289404 HSALNG0076463]
| |
− | |STAM-AS1
| |
− | |locus3182
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0148276 HSALNT0148276]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0148276 HSALNG0070806]
| |
− | |PTENP1-AS
| |
− | |PTENpg1-asRNA
| |
− | |transcriptional regulation
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289562 HSALNT0289562]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289562 HSALNG0141677]
| |
− | |AF116616
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |osteosarcoma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289589 HSALNT0289589]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289589 HSALNG0141704]
| |
− | |AK094838
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |osteosarcoma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289620 HSALNT0289620]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289620 HSALNG0141735]
| |
− | |ASLNC00339
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |osteosarcoma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289629 HSALNT0289629]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289629 HSALNG0141744]
| |
− | |BC002350
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |osteosarcoma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289651 HSALNT0289651]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289651 HSALNG0141766]
| |
− | |BC091525
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |osteosarcoma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289652 HSALNT0289652]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289652 HSALNG0141767]
| |
− | |BE503655
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |osteosarcoma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289753 HSALNT0289753]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289753 HSALNG0141868]
| |
− | |ENO1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |osteosarcoma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289835 HSALNT0289835]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289835 HSALNG0141950]
| |
− | |FKBP10
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |osteosarcoma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290064 HSALNT0290064]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290064 HSALNG0142179]
| |
− | |MYHAS
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |osteosarcoma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289985 HSALNT0289985]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289985 HSALNG0142100]
| |
− | |LncRNA-LALR1
| |
− | |NA
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |liver cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289934 HSALNT0289934]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289934 HSALNG0142049]
| |
− | |lincRNA-LALR1
| |
− | |NA
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0091577 HSALNT0091577]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0091577 HSALNG0043527]
| |
− | |NR2F1-AS1
| |
− | |FLJ42709
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289709 HSALNT0289709]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289709 HSALNG0141824]
| |
− | |CK19
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |breast cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289943 HSALNT0289943]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289943 HSALNG0142058]
| |
− | |Llme23
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |melanoma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289553 HSALNT0289553]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289553 HSALNG0141668]
| |
− | |AC096655.1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289178 HSALNT0289178]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289178 HSALNG0137593]
| |
− | |MIR222HG
| |
− | |Lnc-Ang362
| |
− | |NA
| |
− | |pathogenic process
| |
− | |Ang II-associated cardiovascular disease
| |
− | |Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289261 HSALNT0289261]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289261 HSALNG0032541]
| |
− | |STX18-AS1
| |
− | |LOC100507266
| |
− | |NA
| |
− | |pathogenic process
| |
− | |atrial septal defect
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289849 HSALNT0289849]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289849 HSALNG0141964]
| |
− | |GHSR
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |non-small cell lung cancer
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289850 HSALNT0289850]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289850 HSALNG0141965]
| |
− | |GHSROS
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |non-small cell lung cancer
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289210 HSALNT0289210]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289210 HSALNG0072923]
| |
− | |PCAT7
| |
− | |PCAN-R2
| |
− | |NA
| |
− | |pathogenic process
| |
− | |prostate cancer
| |
− | |Male Urogenital Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289702 HSALNT0289702]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289702 HSALNG0141817]
| |
− | |CES1P1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |non-small cell lung cancer
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289892 HSALNT0289892]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289892 HSALNG0142007]
| |
− | |LINC00210
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |non-small cell lung cancer
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290006 HSALNT0290006]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290006 HSALNG0142121]
| |
− | |LOC100506974
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |non-small cell lung cancer
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290219 HSALNT0290219]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290219 HSALNG0142334]
| |
− | |RP3-508I15.14
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |non-small cell lung cancer
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290243 HSALNT0290243]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290243 HSALNG0142358]
| |
− | |SLC6A6
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |non-small cell lung cancer
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290342 HSALNT0290342]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290342 HSALNG0142457]
| |
− | |uc003bgl.1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |non-small cell lung cancer
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289075 HSALNT0289075]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289075 HSALNG0008302]
| |
− | |LINC00970
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |non-small cell lung cancer
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0211868 HSALNT0211868]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0211868 HSALNG0101725]
| |
− | |SALRNA1
| |
− | |SAL-RNA1,XLOC_023166
| |
− | |NA
| |
− | |developmental process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0222267 HSALNT0222267]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0222267 HSALNG0106957]
| |
− | |SALRNA3
| |
− | |SAL-RNA3,XLOC_025918
| |
− | |NA
| |
− | |developmental process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0222274 HSALNT0222274]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0222274 HSALNG0106960]
| |
− | |SALRNA2
| |
− | |SAL-RNA2,XLOC_025931
| |
− | |NA
| |
− | |developmental process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289428 HSALNT0289428]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289428 HSALNG0021790]
| |
− | |GPR1-AS
| |
− | |GPR1-AS1,GPR1AS
| |
− | |transcriptional regulation
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0226207 HSALNT0226207]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0226207 HSALNG0108743]
| |
− | |LINC00235
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |anorexia nervosa
| |
− | |Mental Disorders
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289526 HSALNT0289526]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289526 HSALNG0141641]
| |
− | |1B FGF-antisense transcripts
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |endometriosis
| |
− | |Female Urogenital Diseases and Pregnancy Complications
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290171 HSALNT0290171]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290171 HSALNG0142286]
| |
− | |RNA polymerase III-dependent lncRNAs
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |diffuse cerebral hypomyelination
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290168 HSALNT0290168]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290168 HSALNG0142283]
| |
− | |REST/CoREST-regulated lncRNAs
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |Huntington disease
| |
− | |Mental Disorders;Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289606 HSALNT0289606]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289606 HSALNG0141721]
| |
− | |Alu lncRNAs
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |macular degeneration
| |
− | |Eye Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290358 HSALNT0290358]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290358 HSALNG0142473]
| |
− | |UCH1LAS
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |Parkinson's disease
| |
− | |Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290244 HSALNT0290244]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290244 HSALNG0142359]
| |
− | |SLC7A2-IT1A/B
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |progressive encephalopathy with severe infantile anorexia
| |
− | |Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289877 HSALNT0289877]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289877 HSALNG0141992]
| |
− | |Kcna2-AS
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |neuropathic pain
| |
− | |Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289191 HSALNT0289191]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289191 HSALNG0053305]
| |
− | |NCOA7-AS1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290020 HSALNT0290020]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290020 HSALNG0142135]
| |
− | |LOC389023
| |
− | |NA
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |psychiatric disease
| |
− | |Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0175124 HSALNT0175124]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0175124 HSALNG0084108]
| |
− | |PTPRJ-AS1
| |
− | |NA
| |
− | |transcriptional regulation
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289654 HSALNT0289654]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289654 HSALNG0141769]
| |
− | |BM742401
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289331 HSALNT0289331]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289331 HSALNG0049950]
| |
− | |LINC00951
| |
− | |lincRNA-uc003opf.1,FLJ41649
| |
− | |NA
| |
− | |pathogenic process
| |
− | |esophageal squamous cell cancer
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290130 HSALNT0290130]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290130 HSALNG0142245]
| |
− | |PAWR
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |acute lymphoblastic leukemia
| |
− | |Immune System Diseases;Neoplasms;Hemic and Lymphatic Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290264 HSALNT0290264]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290264 HSALNG0142379]
| |
− | |T-ALL-R-LncR1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |acute lymphoblastic leukemia
| |
− | |Immune System Diseases;Neoplasms;Hemic and Lymphatic Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289599 HSALNT0289599]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289599 HSALNG0141714]
| |
− | |AK130977
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |malignant pleural mesothelioma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289625 HSALNT0289625]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289625 HSALNG0141740]
| |
− | |AX746718
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |malignant pleural mesothelioma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289738 HSALNT0289738]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289738 HSALNG0141853]
| |
− | |DDR2
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |malignant pleural mesothelioma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290003 HSALNT0290003]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290003 HSALNG0142118]
| |
− | |LOC100131831
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |malignant pleural mesothelioma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290144 HSALNT0290144]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290144 HSALNG0142259]
| |
− | |POT1-AS1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |malignant pleural mesothelioma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290253 HSALNT0290253]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290253 HSALNG0142368]
| |
− | |SNORA17B
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |malignant pleural mesothelioma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0207421 HSALNT0207421]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0207421 HSALNG0099625]
| |
− | |GAS6-AS1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |non-small cell lung cancer
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289838 HSALNT0289838]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289838 HSALNG0141953]
| |
− | |FMR5
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |fragile X syndrome
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0208907 HSALNT0208907]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0208907 HSALNG0100287]
| |
− | |FOXG1-AS1
| |
− | |FOXG1-AS
| |
− | |NA
| |
− | |pathogenic process
| |
− | |autism spectrum disorder
| |
− | |Mental Disorders
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290263 HSALNT0290263]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290263 HSALNG0142378]
| |
− | |SYNGAP1-AS1
| |
− | |SYNGAP1-AS
| |
− | |NA
| |
− | |pathogenic process
| |
− | |autism spectrum disorder
| |
− | |Mental Disorders
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290176 HSALNT0290176]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290176 HSALNG0142291]
| |
− | |RNase MRP
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |cartilage hair hypoplaisia
| |
− | |Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289469 HSALNT0289469]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289469 HSALNG0105872]
| |
− | |GABPB1-AS1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289009 HSALNT0289009]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289009 HSALNG0075528]
| |
− | |IDI2-AS1
| |
− | |C10orf110,IDI2-A,HT009,Em:AC022536.4
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289093 HSALNT0289093]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289093 HSALNG0044716]
| |
− | |LINC01184
| |
− | |FLJ33630
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290108 HSALNT0290108]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290108 HSALNG0142223]
| |
− | |OGT
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |colorectal cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290077 HSALNT0290077]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290077 HSALNG0142192]
| |
− | |ncNRFR
| |
− | |NA
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |colorectal cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290337 HSALNT0290337]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290337 HSALNG0142452]
| |
− | |uc001lsz
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cancer;prostate cancer;liver cancer;lung cancer
| |
− | |Respiratory Tract Diseases;Male Urogenital Diseases;Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289087 HSALNT0289087]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289087 HSALNG0021008]
| |
− | |LINC01090
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |post-traumatic stress disorder
| |
− | |Mental Disorders
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289746 HSALNT0289746]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289746 HSALNG0141861]
| |
− | |DQ786227
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |lung cancer
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289981 HSALNT0289981]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289981 HSALNG0142096]
| |
− | |lncRNA-DQ786227
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |lung cancer
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289876 HSALNT0289876]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289876 HSALNG0141991]
| |
− | |JADRR
| |
− | |LINC00915,lncRNA-JADE
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |breast cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290254 HSALNT0290254]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290254 HSALNG0142369]
| |
− | |SOX2OT-S1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |esophageal squamous cell cancer
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290404 HSALNT0290404]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290404 HSALNG0142519]
| |
− | |SOX2OT-S2
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289870 HSALNT0289870]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289870 HSALNG0141985]
| |
− | |HOXA13
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatocelluar cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0078946 HSALNT0078946]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0078946 HSALNG0037661]
| |
− | |SMAD1-AS1
| |
− | |ENST00000513542
| |
− | |NA
| |
− | |pathogenic process
| |
− | |ventricular septal defects
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0087329 HSALNT0087329]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0087329 HSALNG0041545]
| |
− | |FGF10-AS1
| |
− | |RP11-473L15.2
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |ventricular septal defects
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290318 HSALNT0290318]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290318 HSALNG0142433]
| |
− | |TUC339
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatocellular cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289819 HSALNT0289819]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289819 HSALNG0141934]
| |
− | |ERICD
| |
− | |LINC01130,TCONS_00014875,ERIC
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |retinoblastoma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289615 HSALNT0289615]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289615 HSALNG0141730]
| |
− | |ARA
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |cancer
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289822 HSALNT0289822]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289822 HSALNG0141937]
| |
− | |ESCCAL-5
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |esophageal squamous cell cancer
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290074 HSALNT0290074]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290074 HSALNG0142189]
| |
− | |ncC11orf49
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |renal cell cancer
| |
− | |Male Urogenital Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290076 HSALNT0290076]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290076 HSALNG0142191]
| |
− | |ncHDAC5
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |renal cell cancer
| |
− | |Male Urogenital Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290078 HSALNT0290078]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290078 HSALNG0142193]
| |
− | |ncRAB31
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |renal cell cancer
| |
− | |Male Urogenital Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290080 HSALNT0290080]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290080 HSALNG0142195]
| |
− | |ncSRPK1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |renal cell cancer
| |
− | |Male Urogenital Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0018253 HSALNT0018253]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0018253 HSALNG0008819]
| |
− | |OVAAL
| |
− | |LINC01131,OVAL
| |
− | |NA
| |
− | |pathogenic process
| |
− | |ovarian cancer
| |
− | |Endocrine System Diseases;Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289884 HSALNT0289884]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289884 HSALNG0141999]
| |
− | |LALR
| |
− | |NA
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |hepatocelluar cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289701 HSALNT0289701]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289701 HSALNG0141816]
| |
− | |CEACAMP8
| |
− | |CEACAMP8
| |
− | |NA
| |
− | |pathogenic process
| |
− | |pre-eclampsia
| |
− | |Female Urogenital Diseases and Pregnancy Complications
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290018 HSALNT0290018]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290018 HSALNG0142133]
| |
− | |LOC284100
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |pre-eclampsia
| |
− | |Female Urogenital Diseases and Pregnancy Complications
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290023 HSALNT0290023]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290023 HSALNG0142138]
| |
− | |LOC391533
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |pre-eclampsia
| |
− | |Female Urogenital Diseases and Pregnancy Complications
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0189558 HSALNT0189558]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0189558 HSALNG0091365]
| |
− | |LINC01154
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0196616 HSALNT0196616]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0196616 HSALNG0094870]
| |
− | |THRIL
| |
− | |BRI3BP-AS1,BRI3BPAS1,Linc1992,TCONS_00020260
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |Kawasaki disease
| |
− | |Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289235 HSALNT0289235]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289235 HSALNG0098080]
| |
− | |RNF219-AS1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |blood pressure
| |
− | |Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289561 HSALNT0289561]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289561 HSALNG0141676]
| |
− | |AF086415
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |nasopharyngeal cancer
| |
− | |Otorhinolaryngologic Diseases;Neoplasms;Stomatognathic Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289583 HSALNT0289583]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289583 HSALNG0141698]
| |
− | |AK056098
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |nasopharyngeal cancer
| |
− | |Otorhinolaryngologic Diseases;Neoplasms;Stomatognathic Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289590 HSALNT0289590]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289590 HSALNG0141705]
| |
− | |AK095147
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |nasopharyngeal cancer
| |
− | |Otorhinolaryngologic Diseases;Neoplasms;Stomatognathic Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289600 HSALNT0289600]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289600 HSALNG0141715]
| |
− | |AK294004
| |
− | |NA
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |nasopharyngeal cancer
| |
− | |Otorhinolaryngologic Diseases;Neoplasms;Stomatognathic Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289612 HSALNT0289612]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289612 HSALNG0141727]
| |
− | |AP5M1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |nasopharyngeal cancer
| |
− | |Otorhinolaryngologic Diseases;Neoplasms;Stomatognathic Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290110 HSALNT0290110]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290110 HSALNG0142225]
| |
− | |ORAOV1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |nasopharyngeal cancer
| |
− | |Otorhinolaryngologic Diseases;Neoplasms;Stomatognathic Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290210 HSALNT0290210]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290210 HSALNG0142325]
| |
− | |RP1-179N16.3
| |
− | |Z95152.1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |nasopharyngeal cancer
| |
− | |Otorhinolaryngologic Diseases;Neoplasms;Stomatognathic Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0037026 HSALNT0037026]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0037026 HSALNG0017545]
| |
− | |LINC01159
| |
− | |linc-Brn1b
| |
− | |NA
| |
− | |developmental process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289014 HSALNT0289014]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289014 HSALNG0137988]
| |
− | |KANTR
| |
− | |KDM5C adjacent non-coding transcript
| |
− | |NA
| |
− | |developmental process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289905 HSALNT0289905]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289905 HSALNG0142020]
| |
− | |LINC01157
| |
− | |TCONS_00010378,linc-Enc1
| |
− | |NA
| |
− | |developmental process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289460 HSALNT0289460]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289460 HSALNG0087416]
| |
− | |APOA1-AS
| |
− | |NA
| |
− | |transcriptional regulation
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290400 HSALNT0290400]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290400 HSALNG0142515]
| |
− | |ZNF300P1
| |
− | |ZNF300P1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |ovarian cancer
| |
− | |Endocrine System Diseases;Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289750 HSALNT0289750]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289750 HSALNG0141865]
| |
− | |EEF1A1P9
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cardia adenocarcinoma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289796 HSALNT0289796]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289796 HSALNG0141911]
| |
− | |ENST00000318333
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cardia adenocarcinoma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289797 HSALNT0289797]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289797 HSALNG0141912]
| |
− | |ENST00000374520
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cardia adenocarcinoma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289800 HSALNT0289800]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289800 HSALNG0141915]
| |
− | |ENST00000422362
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cardia adenocarcinoma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289808 HSALNT0289808]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289808 HSALNG0141923]
| |
− | |ENST00000455912
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cardia adenocarcinoma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289809 HSALNT0289809]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289809 HSALNG0141924]
| |
− | |ENST00000456007
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cardia adenocarcinoma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289810 HSALNT0289810]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289810 HSALNG0141925]
| |
− | |ENST00000456185
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cardia adenocarcinoma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289817 HSALNT0289817]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289817 HSALNG0141932]
| |
− | |EPOR
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cardia adenocarcinoma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289913 HSALNT0289913]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289913 HSALNG0142028]
| |
− | |LINC01550
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cardia adenocarcinoma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290142 HSALNT0290142]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290142 HSALNG0142257]
| |
− | |PMS2P5
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cardia adenocarcinoma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290269 HSALNT0290269]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290269 HSALNG0142384]
| |
− | |TCF7
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cardia adenocarcinoma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290345 HSALNT0290345]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290345 HSALNG0142460]
| |
− | |uc003jfz.2
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cardia adenocarcinoma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289095 HSALNT0289095]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289095 HSALNG0018112]
| |
− | |LINC01191
| |
− | |VIN,lnc-ACTR3
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |influenza A virus
| |
− | |Virus Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288976 HSALNT0288976]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288976 HSALNG0140165]
| |
− | |FIRRE
| |
− | |LINC01200
| |
− | |transcriptional regulation
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289097 HSALNT0289097]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289097 HSALNG0046284]
| |
− | |LINC01202
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290271 HSALNT0290271]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290271 HSALNG0142386]
| |
− | |TCONS_00014512
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatoblastoma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290272 HSALNT0290272]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290272 HSALNG0142387]
| |
− | |TCONS_00014978
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatoblastoma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290274 HSALNT0290274]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290274 HSALNG0142389]
| |
− | |TCONS_00024647
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatoblastoma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290279 HSALNT0290279]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290279 HSALNG0142394]
| |
− | |TCONS_00090092_MEG3
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatoblastoma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290280 HSALNT0290280]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290280 HSALNG0142395]
| |
− | |TCONS_l2_00000179
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatoblastoma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290283 HSALNT0290283]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290283 HSALNG0142398]
| |
− | |TCONS_l2_00004424
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatoblastoma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290284 HSALNT0290284]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290284 HSALNG0142399]
| |
− | |TCONS_l2_00006843
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatoblastoma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290289 HSALNT0290289]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290289 HSALNG0142404]
| |
− | |TCONS_l2_00014091
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatoblastoma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290291 HSALNT0290291]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290291 HSALNG0142406]
| |
− | |TCONS_l2_00018070
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatoblastoma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290292 HSALNT0290292]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290292 HSALNG0142407]
| |
− | |TCONS_l2_00020565
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatoblastoma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290293 HSALNT0290293]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290293 HSALNG0142408]
| |
− | |TCONS_l2_00021262
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatoblastoma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290296 HSALNT0290296]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290296 HSALNG0142411]
| |
− | |TCONS_l2_00030560
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatoblastoma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289927 HSALNT0289927]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289927 HSALNG0142042]
| |
− | |lincRNA1611
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |Pancreatic ductal adenocarcinoma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290149 HSALNT0290149]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290149 HSALNG0142264]
| |
− | |Ppp3ca
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |Pancreatic ductal adenocarcinoma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290265 HSALNT0290265]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290265 HSALNG0142380]
| |
− | |TC0100223
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |epithelial ovarian cancer
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290267 HSALNT0290267]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290267 HSALNG0142382]
| |
− | |TC0101686
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |epithelial ovarian cancer
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290268 HSALNT0290268]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290268 HSALNG0142383]
| |
− | |TC1500845
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |ovarian cancer
| |
− | |Endocrine System Diseases;Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289318 HSALNT0289318]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289318 HSALNG0128589]
| |
− | |LAMP5-AS1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |acute lymphoblastic leukemia
| |
− | |Immune System Diseases;Neoplasms;Hemic and Lymphatic Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0234022 HSALNT0234022]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0234022 HSALNG0112916]
| |
− | |LINC01228
| |
− | |lincRNA-DYNLRB2-2
| |
− | |NA
| |
− | |pathogenic process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0162654 HSALNT0162654]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0162654 HSALNG0077963]
| |
− | |SGMS1-AS1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289206 HSALNT0289206]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289206 HSALNG0126202]
| |
− | |PCAT19
| |
− | |LOC100505495,LINC01190
| |
− | |NA
| |
− | |pathogenic process
| |
− | |prostate cancer
| |
− | |Male Urogenital Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289521 HSALNT0289521]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289521 HSALNG0115583]
| |
− | |ABHD15-AS1
| |
− | |linc-TP53I13,lnc-TP53I13
| |
− | |NA
| |
− | |pathogenic process
| |
− | |cardiometabolic disease
| |
− | |Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289100 HSALNT0289100]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289100 HSALNG0069570]
| |
− | |LINC01230
| |
− | |linc-DMRT2,lnc-DRMT2,TCONS_00015639
| |
− | |NA
| |
− | |pathogenic process
| |
− | |cardiometabolic disease
| |
− | |Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0249183 HSALNT0249183]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0249183 HSALNG0120583]
| |
− | |PCAT18
| |
− | |LINC01092
| |
− | |NA
| |
− | |pathogenic process
| |
− | |prostate cancer
| |
− | |Male Urogenital Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290029 HSALNT0290029]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290029 HSALNG0142144]
| |
− | |LOC728606
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |prostate cancer
| |
− | |Male Urogenital Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288956 HSALNT0288956]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288956 HSALNG0094171]
| |
− | |ENST00000547963.1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |esophageal squamous cell cancer
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289802 HSALNT0289802]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289802 HSALNG0141917]
| |
− | |ENST00000435885
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |oesophageal squamous cell cancer
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0205898 HSALNT0205898]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0205898 HSALNG0098920]
| |
− | |LINC01232
| |
− | |FLJ41590,TCONS_00021520
| |
− | |NA
| |
− | |pathogenic process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0257311 HSALNT0257311]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0257311 HSALNG0124979]
| |
− | |LINC01233
| |
− | |XLOC_013014
| |
− | |NA
| |
− | |pathogenic process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0183247 HSALNT0183247]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0183247 HSALNG0088110]
| |
− | |SENCR
| |
− | |FLI1-AS1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |vascular SMC phenotype
| |
− | |Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289296 HSALNT0289296]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289296 HSALNG0010286]
| |
− | |LINC00467
| |
− | |C1orf97,MGC14801
| |
− | |NA
| |
− | |pathogenic process
| |
− | |neuroblastoma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0143586 HSALNT0143586]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0143586 HSALNG0068435]
| |
− | |CASC21
| |
− | |LINC01244,CARLo-2
| |
− | |NA
| |
− | |pathogenic process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288906 HSALNT0288906]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288906 HSALNG0068424]
| |
− | |CASC19
| |
− | |LINC01245,CARLo-6
| |
− | |NA
| |
− | |pathogenic process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289754 HSALNT0289754]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289754 HSALNG0141869]
| |
− | |ENSG00000135253.9
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hereditary haemorrhagic telangiectasia
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289755 HSALNT0289755]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289755 HSALNG0141870]
| |
− | |ENSG00000147753.5
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hereditary haemorrhagic telangiectasia
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289756 HSALNT0289756]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289756 HSALNG0141871]
| |
− | |ENSG00000196096
| |
− | |AC079610.1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hereditary haemorrhagic telangiectasia
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289757 HSALNT0289757]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289757 HSALNG0141872]
| |
− | |ENSG00000197251.3
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hereditary haemorrhagic telangiectasia
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289758 HSALNT0289758]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289758 HSALNG0141873]
| |
− | |ENSG00000203325
| |
− | |AL445248.1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hereditary haemorrhagic telangiectasia
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289759 HSALNT0289759]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289759 HSALNG0141874]
| |
− | |ENSG00000206129
| |
− | |AC006305.1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hereditary haemorrhagic telangiectasia
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289760 HSALNT0289760]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289760 HSALNG0141875]
| |
− | |ENSG00000215231.3
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hereditary haemorrhagic telangiectasia
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289761 HSALNT0289761]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289761 HSALNG0141876]
| |
− | |ENSG00000215374.4
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hereditary haemorrhagic telangiectasia
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289762 HSALNT0289762]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289762 HSALNG0141877]
| |
− | |ENSG00000215808.2
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hereditary haemorrhagic telangiectasia
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289763 HSALNT0289763]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289763 HSALNG0141878]
| |
− | |ENSG00000226496.1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hereditary haemorrhagic telangiectasia
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289764 HSALNT0289764]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289764 HSALNG0141879]
| |
− | |ENSG00000229563.1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hereditary haemorrhagic telangiectasia
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289765 HSALNT0289765]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289765 HSALNG0141880]
| |
− | |ENSG00000230133.1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hereditary haemorrhagic telangiectasia
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289766 HSALNT0289766]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289766 HSALNG0141881]
| |
− | |ENSG00000230544.1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hereditary haemorrhagic telangiectasia
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289767 HSALNT0289767]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289767 HSALNG0141882]
| |
− | |ENSG00000231133.1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hereditary haemorrhagic telangiectasia
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289768 HSALNT0289768]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289768 HSALNG0141883]
| |
− | |ENSG00000231185
| |
− | |AC010317.1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hereditary haemorrhagic telangiectasia
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289769 HSALNT0289769]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289769 HSALNG0141884]
| |
− | |ENSG00000232021.2
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hereditary haemorrhagic telangiectasia
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289770 HSALNT0289770]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289770 HSALNG0141885]
| |
− | |ENSG00000232046.1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hereditary haemorrhagic telangiectasia
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289771 HSALNT0289771]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289771 HSALNG0141886]
| |
− | |ENSG00000232956.3
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hereditary haemorrhagic telangiectasia
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289772 HSALNT0289772]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289772 HSALNG0141887]
| |
− | |ENSG00000233154.1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hereditary haemorrhagic telangiectasia
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289773 HSALNT0289773]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289773 HSALNG0141888]
| |
− | |ENSG00000233251
| |
− | |AC007743.1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hereditary haemorrhagic telangiectasia
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289774 HSALNT0289774]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289774 HSALNG0141889]
| |
− | |ENSG00000235285.1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hereditary haemorrhagic telangiectasia
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289775 HSALNT0289775]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289775 HSALNG0141890]
| |
− | |ENSG00000237036.3
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hereditary haemorrhagic telangiectasia
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289776 HSALNT0289776]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289776 HSALNG0141891]
| |
− | |ENSG00000237548.1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hereditary haemorrhagic telangiectasia
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289777 HSALNT0289777]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289777 HSALNG0141892]
| |
− | |ENSG00000240453.1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hereditary haemorrhagic telangiectasia
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289778 HSALNT0289778]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289778 HSALNG0141893]
| |
− | |ENSG00000241269.1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hereditary haemorrhagic telangiectasia
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289779 HSALNT0289779]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289779 HSALNG0141894]
| |
− | |ENSG00000245910.3
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hereditary haemorrhagic telangiectasia
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289780 HSALNT0289780]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289780 HSALNG0141895]
| |
− | |ENSG00000248176
| |
− | |AC109349.1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hereditary haemorrhagic telangiectasia
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289781 HSALNT0289781]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289781 HSALNG0141896]
| |
− | |ENSG00000249364
| |
− | |AC112206.2
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hereditary haemorrhagic telangiectasia
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289782 HSALNT0289782]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289782 HSALNG0141897]
| |
− | |ENSG00000249772
| |
− | |AC026427.1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hereditary haemorrhagic telangiectasia
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289783 HSALNT0289783]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289783 HSALNG0141898]
| |
− | |ENSG00000250195
| |
− | |AC109927.1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hereditary haemorrhagic telangiectasia
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289784 HSALNT0289784]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289784 HSALNG0141899]
| |
− | |ENSG00000250608
| |
− | |AC010210.1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hereditary haemorrhagic telangiectasia
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289785 HSALNT0289785]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289785 HSALNG0141900]
| |
− | |ENSG00000254154
| |
− | |AL359075.2
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hereditary haemorrhagic telangiectasia
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289786 HSALNT0289786]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289786 HSALNG0141901]
| |
− | |ENSG00000255471
| |
− | |AP001528.2
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hereditary haemorrhagic telangiectasia
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289787 HSALNT0289787]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289787 HSALNG0141902]
| |
− | |ENSG00000256218
| |
− | |AC007848.2
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hereditary haemorrhagic telangiectasia
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289788 HSALNT0289788]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289788 HSALNG0141903]
| |
− | |ENSG00000259150.1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hereditary haemorrhagic telangiectasia
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289789 HSALNT0289789]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289789 HSALNG0141904]
| |
− | |ENSG00000259334.1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hereditary haemorrhagic telangiectasia
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289790 HSALNT0289790]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289790 HSALNG0141905]
| |
− | |ENSG00000259484.1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hereditary haemorrhagic telangiectasia
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289791 HSALNT0289791]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289791 HSALNG0141906]
| |
− | |ENSG00000259758.1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hereditary haemorrhagic telangiectasia
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289793 HSALNT0289793]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289793 HSALNG0141908]
| |
− | |ENSG00000263753.1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hereditary haemorrhagic telangiectasia
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289794 HSALNT0289794]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289794 HSALNG0141909]
| |
− | |ENSG00000264772
| |
− | |AC016876.2
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hereditary haemorrhagic telangiectasia
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289795 HSALNT0289795]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289795 HSALNG0141910]
| |
− | |ENSG00000266952.1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hereditary haemorrhagic telangiectasia
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289828 HSALNT0289828]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289828 HSALNG0141943]
| |
− | |FAM66B
| |
− | |FAM66E
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hereditary haemorrhagic telangiectasia
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289895 HSALNT0289895]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289895 HSALNG0142010]
| |
− | |LINC00336
| |
− | |C6orf227,NCRNA00336
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hereditary haemorrhagic telangiectasia
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289899 HSALNT0289899]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289899 HSALNG0142014]
| |
− | |LINC00929
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hereditary haemorrhagic telangiectasia
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289906 HSALNT0289906]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289906 HSALNG0142021]
| |
− | |LINC01204
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hereditary haemorrhagic telangiectasia
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289912 HSALNT0289912]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289912 HSALNG0142027]
| |
− | |LINC01538
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hereditary haemorrhagic telangiectasia
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289915 HSALNT0289915]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289915 HSALNG0142030]
| |
− | |LINC01721
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hereditary haemorrhagic telangiectasia
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289916 HSALNT0289916]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289916 HSALNG0142031]
| |
− | |LINC01762
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hereditary haemorrhagic telangiectasia
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289917 HSALNT0289917]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289917 HSALNG0142032]
| |
− | |LINC01798
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hereditary haemorrhagic telangiectasia
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290247 HSALNT0290247]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290247 HSALNG0142362]
| |
− | |SMIM2-IT1
| |
− | |C13orf44-IT1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hereditary haemorrhagic telangiectasia
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290316 HSALNT0290316]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290316 HSALNG0142431]
| |
− | |TTTY7
| |
− | |CLONE795723,LINC00129,NCRNA00129A,TTTY7B,TTY7,TTTY7
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hereditary haemorrhagic telangiectasia
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289872 HSALNT0289872]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289872 HSALNG0141987]
| |
− | |HTTAS_v1
| |
− | |NA
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |Huntington disease
| |
− | |Mental Disorders;Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290175 HSALNT0290175]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290175 HSALNG0142290]
| |
− | |RNA-a
| |
− | |NA
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |Opitz-Kaveggia syndrome
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289525 HSALNT0289525]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289525 HSALNG0141640]
| |
− | |116HG
| |
− | |NA
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |Prader-Willi syndrome
| |
− | |Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290320 HSALNT0290320]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290320 HSALNG0142435]
| |
− | |U1 spliceosomal lncRNA
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |Parkinson's disease
| |
− | |Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289102 HSALNT0289102]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289102 HSALNG0039360]
| |
− | |LINC01262
| |
− | |TCONS_l2_00021807,RP11-462G22.1
| |
− | |ceRNA
| |
− | |pathogenic process
| |
− | |Parkinson's disease
| |
− | |Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289681 HSALNT0289681]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289681 HSALNG0141796]
| |
− | |CCAT1-L
| |
− | |NA
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |colorectal cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290062 HSALNT0290062]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290062 HSALNG0142177]
| |
− | |MT-LIPCAR
| |
− | |uc022bqs.1,LIPCAR
| |
− | |NA
| |
− | |pathogenic process
| |
− | |heart disease
| |
− | |Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289941 HSALNT0289941]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289941 HSALNG0142056]
| |
− | |LIPCAR
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |heart failure
| |
− | |Pathological Conditions, Signs and Symptoms;Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0200965 HSALNT0200965]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0200965 HSALNG0096756]
| |
− | |TUSC8
| |
− | |LINC01071,XLOC_010588
| |
− | |NA
| |
− | |pathogenic process
| |
− | |cervical cancer
| |
− | |Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0161787 HSALNT0161787]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0161787 HSALNG0077519]
| |
− | |LINC01264
| |
− | |RP11-124O11.2
| |
− | |NA
| |
− | |pathogenic process
| |
− | |breast cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289733 HSALNT0289733]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289733 HSALNG0141848]
| |
− | |D4Z4
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process;developmental process
| |
− | |facioscapulohumeral muscular dystrophy
| |
− | |Musculoskeletal Diseases;Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289678 HSALNT0289678]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289678 HSALNG0141793]
| |
− | |CARL
| |
− | |NA
| |
− | |ceRNA
| |
− | |pathogenic process
| |
− | |myocardial infarction
| |
− | |Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289923 HSALNT0289923]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289923 HSALNG0142038]
| |
− | |linc-CBR1-2
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |lung cancer
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0243354 HSALNT0243354]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0243354 HSALNG0117819]
| |
− | |WFDC21P
| |
− | |WAP four-disulfide core domain 21,pseudogene
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |DC dysfunction
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290232 HSALNT0290232]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290232 HSALNG0142347]
| |
− | |RUNX1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |acute myeloid leukemia
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290234 HSALNT0290234]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290234 HSALNG0142349]
| |
− | |RUNXOR
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hematopoietic malignancies
| |
− | |Neoplasms;Hemic and Lymphatic Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289979 HSALNT0289979]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289979 HSALNG0142094]
| |
− | |lncRNA-CIR
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |osteoarthritis
| |
− | |Musculoskeletal Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290368 HSALNT0290368]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290368 HSALNG0142483]
| |
− | |VIM2P
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |osteoarthritis
| |
− | |Musculoskeletal Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289879 HSALNT0289879]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289879 HSALNG0141994]
| |
− | |KRAS1P
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |cancer
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290054 HSALNT0290054]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290054 HSALNG0142169]
| |
− | |MINA
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |esophageal squamous cell cancer;gastric cancer;lung cancer;hepatocelluar cancer
| |
− | |Respiratory Tract Diseases;Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289270 HSALNT0289270]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289270 HSALNG0117279]
| |
− | |TMEM92-AS1
| |
− | |RP11-893F2.9,lncRNA-508851,TCONS_00025237
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatocellular cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288900 HSALNT0288900]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288900 HSALNG0054937]
| |
− | |CAHM
| |
− | |LINC00468
| |
− | |NA
| |
− | |pathogenic process
| |
− | |colorectal cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289593 HSALNT0289593]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289593 HSALNG0141708]
| |
− | |AK123657
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |colorectal cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289659 HSALNT0289659]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289659 HSALNG0141774]
| |
− | |BX648207
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |colorectal cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289660 HSALNT0289660]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289660 HSALNG0141775]
| |
− | |BX649059
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |colorectal cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289846 HSALNT0289846]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289846 HSALNG0141961]
| |
− | |GAS2L3
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |colorectal cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289633 HSALNT0289633]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289633 HSALNG0141748]
| |
− | |BC011663
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289867 HSALNT0289867]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289867 HSALNG0141982]
| |
− | |HIV1230
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290045 HSALNT0290045]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290045 HSALNG0142160]
| |
− | |M14574
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290245 HSALNT0290245]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290245 HSALNG0142360]
| |
− | |SLCO5A1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290326 HSALNT0290326]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290326 HSALNG0142441]
| |
− | |uc.341
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290344 HSALNT0290344]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290344 HSALNG0142459]
| |
− | |uc003iqu
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290346 HSALNT0290346]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290346 HSALNG0142461]
| |
− | |uc003tfx
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289950 HSALNT0289950]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289950 HSALNG0142065]
| |
− | |lnc-AL355149.1-1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |nasopharyngeal cancer
| |
− | |Otorhinolaryngologic Diseases;Neoplasms;Stomatognathic Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290001 HSALNT0290001]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290001 HSALNG0142116]
| |
− | |lnc-ZNF674-1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |nasopharyngeal cancer
| |
− | |Otorhinolaryngologic Diseases;Neoplasms;Stomatognathic Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0286909 HSALNT0286909]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0286909 HSALNG0140423]
| |
− | |LINC00632
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289105 HSALNT0289105]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289105 HSALNG0014134]
| |
− | |LINC01317
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0234804 HSALNT0234804]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0234804 HSALNG0113279]
| |
− | |LINC01081
| |
− | |TCONS_00024764
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |alveolar capillary dysplasia
| |
− | |Respiratory Tract Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289840 HSALNT0289840]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289840 HSALNG0141955]
| |
− | |FOSB
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatocelluar cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289587 HSALNT0289587]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289587 HSALNG0141702]
| |
− | |AK093543
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatocellular cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289732 HSALNT0289732]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289732 HSALNG0141847]
| |
− | |D16366
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatocellular cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289814 HSALNT0289814]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289814 HSALNG0141929]
| |
− | |ENST00000501583
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatocellular cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290273 HSALNT0290273]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290273 HSALNG0142388]
| |
− | |TCONS_00018278
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatocellular cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289907 HSALNT0289907]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289907 HSALNG0142022]
| |
− | |LINC01374
| |
− | |TCONS_00018278
| |
− | |NA
| |
− | |pathogenic process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0231106 HSALNT0231106]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0231106 HSALNG0111452]
| |
− | |CASC22
| |
− | |LINC01373,TCONS_00024290,LincRNA-ENST00000515084
| |
− | |NA
| |
− | |pathogenic process
| |
− | |breast cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0058246 HSALNT0058246]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0058246 HSALNG0027843]
| |
− | |LINC00882
| |
− | |NA
| |
− | |ceRNA
| |
− | |pathogenic process
| |
− | |airway diseases
| |
− | |Respiratory Tract Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0018288 HSALNT0018288]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0018288 HSALNG0008840]
| |
− | |KIAA1614-AS1
| |
− | |RP11-46A10.4
| |
− | |ceRNA
| |
− | |pathogenic process
| |
− | |airway smooth muscle (ASM) disease
| |
− | |Respiratory Tract Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0142310 HSALNT0142310]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0142310 HSALNG0067913]
| |
− | |LINC00536
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |trichorhinophalangeal syndrome
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0034200 HSALNT0034200]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0034200 HSALNG0016063]
| |
− | |LBX2-AS1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |renal cell cancer
| |
− | |Male Urogenital Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0149799 HSALNT0149799]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0149799 HSALNG0071679]
| |
− | |ENST00000414223
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |renal cell cancer
| |
− | |Male Urogenital Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290012 HSALNT0290012]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290012 HSALNG0142127]
| |
− | |LOC105374631
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |renal cell cancer
| |
− | |Male Urogenital Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290305 HSALNT0290305]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290305 HSALNG0142420]
| |
− | |TMEM179
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |renal cell cancer
| |
− | |Male Urogenital Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290315 HSALNT0290315]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290315 HSALNG0142430]
| |
− | |TSPAN8
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |renal cell cancer
| |
− | |Male Urogenital Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290334 HSALNT0290334]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290334 HSALNG0142449]
| |
− | |uc001aka.2
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |renal cell cancer
| |
− | |Male Urogenital Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290339 HSALNT0290339]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290339 HSALNG0142454]
| |
− | |uc001vjj.1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |renal cell cancer
| |
− | |Male Urogenital Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290343 HSALNT0290343]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290343 HSALNG0142458]
| |
− | |uc003erl.1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |renal cell cancer
| |
− | |Male Urogenital Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290354 HSALNT0290354]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290354 HSALNG0142469]
| |
− | |uc009wkz.1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |renal cell cancer
| |
− | |Male Urogenital Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0027893 HSALNT0027893]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0027893 HSALNG0013204]
| |
− | |MYCNUT
| |
− | |MYCNUN,lncUSMycN
| |
− | |NA
| |
− | |pathogenic process
| |
− | |neuroblastoma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0273205 HSALNT0273205]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0273205 HSALNG0132900]
| |
− | |LINC01436
| |
− | |AP000688.8
| |
− | |NA
| |
− | |pathogenic process
| |
− | |Down syndrome
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0266116 HSALNT0266116]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0266116 HSALNG0129435]
| |
− | |MIR663AHG
| |
− | |RP3-410C9.1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |turner syndrome
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Male Urogenital Diseases;Female Urogenital Diseases and Pregnancy Complications;Cardiovascular Diseases;Endocrine System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289108 HSALNT0289108]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289108 HSALNG0080498]
| |
− | |LINC01435
| |
− | |RP11-215N21.1,TCONS_00018040
| |
− | |NA
| |
− | |pathogenic process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289674 HSALNT0289674]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289674 HSALNG0141789]
| |
− | |CADM3-AS1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |bladder cancer
| |
− | |Male Urogenital Diseases;Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289882 HSALNT0289882]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289882 HSALNG0141997]
| |
− | |KRT19P3
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |bladder cancer
| |
− | |Male Urogenital Diseases;Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290310 HSALNT0290310]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290310 HSALNG0142425]
| |
− | |TNXA
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |bladder cancer
| |
− | |Male Urogenital Diseases;Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0008750 HSALNT0008750]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0008750 HSALNG0004412]
| |
− | |ZRANB2-AS2
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289745 HSALNT0289745]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289745 HSALNG0141860]
| |
− | |DMTF1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290059 HSALNT0290059]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290059 HSALNG0142174]
| |
− | |MRUL
| |
− | |NA
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |gastric cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0185163 HSALNT0185163]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0185163 HSALNG0089050]
| |
− | |FAM66C
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289476 HSALNT0289476]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289476 HSALNG0132414]
| |
− | |CYYR1-AS1
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289535 HSALNT0289535]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289535 HSALNG0141650]
| |
− | |AA174084
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0266298 HSALNT0266298]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0266298 HSALNG0129511]
| |
− | |ABALON
| |
− | |INXS
| |
− | |splicing regulation
| |
− | |pathogenic process
| |
− | |renal cell cancer
| |
− | |Male Urogenital Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290370 HSALNT0290370]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290370 HSALNG0142485]
| |
− | |VTRNA2-1
| |
− | |CBL-3,CBL3,MIR886,MIRN886,VTRNA2,hsa-mir-886,hvg-5,nc886,svtRNA2-1a
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289619 HSALNT0289619]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289619 HSALNG0141734]
| |
− | |ASK00420
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |cervical cancer
| |
− | |Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289749 HSALNT0289749]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289749 HSALNG0141864]
| |
− | |EBIC
| |
− | |NA
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |cervical cancer
| |
− | |Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290299 HSALNT0290299]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290299 HSALNG0142414]
| |
− | |TI09485
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |cervical cancer
| |
− | |Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290300 HSALNT0290300]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290300 HSALNG0142415]
| |
− | |TI10124
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |cervical cancer
| |
− | |Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290301 HSALNT0290301]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290301 HSALNG0142416]
| |
− | |TI13831
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |cervical cancer
| |
− | |Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290302 HSALNT0290302]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290302 HSALNG0142417]
| |
− | |TI18318
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |cervical cancer
| |
− | |Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290303 HSALNT0290303]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290303 HSALNG0142418]
| |
− | |TI21327
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |cervical cancer
| |
− | |Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290304 HSALNT0290304]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290304 HSALNG0142419]
| |
− | |TI22687
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |cervical cancer
| |
− | |Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290307 HSALNT0290307]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290307 HSALNG0142422]
| |
− | |TMPOP2
| |
− | |NA
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |cervical cancer
| |
− | |Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289570 HSALNT0289570]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289570 HSALNG0141685]
| |
− | |AK021444
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |colorectal cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289601 HSALNT0289601]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289601 HSALNG0141716]
| |
− | |AK307796
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |colorectal cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289801 HSALNT0289801]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289801 HSALNG0141916]
| |
− | |ENST00000425785
| |
− | |SEC63P1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |colorectal cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289871 HSALNT0289871]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289871 HSALNG0141986]
| |
− | |HOXB-AS3
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |colorectal cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290367 HSALNT0290367]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290367 HSALNG0142482]
| |
− | |URHC
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatocellular cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289085 HSALNT0289085]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289085 HSALNG0098166]
| |
− | |LINC01080
| |
− | |TCONS_00021856
| |
− | |NA
| |
− | |pathogenic process
| |
− | |Alzheimer's disease
| |
− | |Mental Disorders;Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289751 HSALNT0289751]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289751 HSALNG0141866]
| |
− | |EFNA3
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |breast cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289798 HSALNT0289798]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289798 HSALNG0141913]
| |
− | |ENST00000395084
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatocelluar cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289829 HSALNT0289829]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289829 HSALNG0141944]
| |
− | |FAM83A-AS1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatocelluar cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290164 HSALNT0290164]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290164 HSALNG0142279]
| |
− | |RAD1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatocelluar cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289585 HSALNT0289585]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289585 HSALNG0141700]
| |
− | |AK056988
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatocellular cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289638 HSALNT0289638]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289638 HSALNG0141753]
| |
− | |BC017743
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatocellular cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290156 HSALNT0290156]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290156 HSALNG0142271]
| |
− | |PRR26
| |
− | |C10orf108
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatocellular cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290349 HSALNT0290349]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290349 HSALNG0142464]
| |
− | |uc003yqb.1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatocellular cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289675 HSALNT0289675]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289675 HSALNG0141790]
| |
− | |CAI2
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |neuroblastoma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289673 HSALNT0289673]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289673 HSALNG0141788]
| |
− | |CADM1-AS1
| |
− | |NA
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |renal clear cell cancer
| |
− | |Male Urogenital Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290313 HSALNT0290313]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290313 HSALNG0142428]
| |
− | |TSLC1-AS1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |glioma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0013359 HSALNT0013359]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0013359 HSALNG0006378]
| |
− | |LINC01525
| |
− | |lnc-MAN1A2-1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |squamous cell cancer
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0109106 HSALNT0109106]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0109106 HSALNG0051540]
| |
− | |LINC01526
| |
− | |Lnc-FAM46A-1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |squamous cell cancer
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0162774 HSALNT0162774]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0162774 HSALNG0078013]
| |
− | |LINC01468
| |
− | |lnc-MBL2-4
| |
− | |NA
| |
− | |pathogenic process
| |
− | |squamous cell cancer
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289110 HSALNT0289110]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289110 HSALNG0074718]
| |
− | |LINC01503
| |
− | |lnc-PPP2R4-5
| |
− | |NA
| |
− | |pathogenic process
| |
− | |tongue squamous cell cancer
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289968 HSALNT0289968]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289968 HSALNG0142083]
| |
− | |lnc-MBL2-4:3
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |tongue squamous cell cancer
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289993 HSALNT0289993]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289993 HSALNG0142108]
| |
− | |lnc-STXBP5-1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |tongue squamous cell cancer
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289563 HSALNT0289563]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289563 HSALNG0141678]
| |
− | |AF118081
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |lung cancer
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289597 HSALNT0289597]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289597 HSALNG0141712]
| |
− | |AK124939
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |pulmonary adenocarcinoma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290153 HSALNT0290153]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290153 HSALNG0142268]
| |
− | |PRAS
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |colorectal cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290249 HSALNT0290249]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290249 HSALNG0142364]
| |
− | |SNAR-A1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |colorectal cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289929 HSALNT0289929]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289929 HSALNG0142044]
| |
− | |lincRNA-BC2
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |breast cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289930 HSALNT0289930]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289930 HSALNG0142045]
| |
− | |lincRNA-BC4
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |breast cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289931 HSALNT0289931]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289931 HSALNG0142046]
| |
− | |lincRNA-BC5
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |breast cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289932 HSALNT0289932]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289932 HSALNG0142047]
| |
− | |lincRNA-BC8
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |breast cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0083190 HSALNT0083190]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0083190 HSALNG0039551]
| |
− | |LINC01511
| |
− | |RP11-325I22.2
| |
− | |NA
| |
− | |pathogenic process
| |
− | |lung adenocarcinoma
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290026 HSALNT0290026]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290026 HSALNG0142141]
| |
− | |LOC440905
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |lung adenocarcinoma
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0083190 HSALNT0083190]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0083190 HSALNG0039551]
| |
− | |LINC01511
| |
− | |RP11-325I22.2
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289552 HSALNT0289552]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289552 HSALNG0141667]
| |
− | |AC079776.2
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |lung adenocarcinoma
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289720 HSALNT0289720]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289720 HSALNG0141835]
| |
− | |CTA-363E6.2
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |lung adenocarcinoma
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289901 HSALNT0289901]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289901 HSALNG0142016]
| |
− | |LINC00987
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |lung adenocarcinoma
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290185 HSALNT0290185]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290185 HSALNG0142300]
| |
− | |RP11-1C1.7
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |lung adenocarcinoma
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290197 HSALNT0290197]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290197 HSALNG0142312]
| |
− | |RP11-445K13.2
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |lung adenocarcinoma
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290199 HSALNT0290199]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290199 HSALNG0142314]
| |
− | |RP11-473M20.11
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |lung adenocarcinoma
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290213 HSALNT0290213]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290213 HSALNG0142328]
| |
− | |RP11-893F2.6
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |lung adenocarcinoma
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290217 HSALNT0290217]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290217 HSALNG0142332]
| |
− | |RP13-514E23.1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |lung adenocarcinoma
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290218 HSALNT0290218]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290218 HSALNG0142333]
| |
− | |RP1-90D4.3
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |lung adenocarcinoma
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290220 HSALNT0290220]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290220 HSALNG0142335]
| |
− | |RP4-575N6.5
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |lung adenocarcinoma
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290226 HSALNT0290226]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290226 HSALNG0142341]
| |
− | |RP5-826L7.1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |lung adenocarcinoma
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290378 HSALNT0290378]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290378 HSALNG0142493]
| |
− | |XLOC_003286
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |lung adenocarcinoma
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290379 HSALNT0290379]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290379 HSALNG0142494]
| |
− | |XLOC_003405
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |lung adenocarcinoma
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290389 HSALNT0290389]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290389 HSALNG0142504]
| |
− | |XLOC_012255
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |lung adenocarcinoma
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290056 HSALNT0290056]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290056 HSALNG0142171]
| |
− | |MIR21
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |laryngeal squamous cell cancer
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289621 HSALNT0289621]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289621 HSALNG0141736]
| |
− | |ASncmtRNAs
| |
− | |NA
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |cancer
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289316 HSALNT0289316]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289316 HSALNG0022090]
| |
− | |LINC01614
| |
− | |LCAL4,TCONS_00003105
| |
− | |NA
| |
− | |pathogenic process
| |
− | |lung cancer
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289982 HSALNT0289982]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289982 HSALNG0142097]
| |
− | |lncRNA-FER1L4
| |
− | |NA
| |
− | |ceRNA
| |
− | |pathogenic process
| |
− | |gastric cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290016 HSALNT0290016]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290016 HSALNG0142131]
| |
− | |LOC283177
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |diffuse large B-cell lymphoma
| |
− | |Hemic and Lymphatic Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289003 HSALNT0289003]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289003 HSALNG0134860]
| |
− | |HORMAD2-AS1
| |
− | |MTMR3-AS1,NONHSAG033653
| |
− | |NA
| |
− | |pathogenic process
| |
− | |type 1 diabetes;bowel disease
| |
− | |Nutritional and Metabolic Diseases;Endocrine System Diseases;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290372 HSALNT0290372]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290372 HSALNG0142487]
| |
− | |WNT4
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |endometriosis
| |
− | |Female Urogenital Diseases and Pregnancy Complications
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289540 HSALNT0289540]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289540 HSALNG0141655]
| |
− | |AB074278
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |bladder cancer
| |
− | |Male Urogenital Diseases;Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290166 HSALNT0290166]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290166 HSALNG0142281]
| |
− | |RCCRT1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |renal cell cancer
| |
− | |Male Urogenital Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289043 HSALNT0289043]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289043 HSALNG0043862]
| |
− | |LINC00491
| |
− | |BC008363
| |
− | |NA
| |
− | |pathogenic process
| |
− | |pancreatic ductal adenocarcinoma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289632 HSALNT0289632]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289632 HSALNG0141747]
| |
− | |BC008363
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |Pancreatic ductal adenocarcinoma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289858 HSALNT0289858]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289858 HSALNG0141973]
| |
− | |H1.3
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |ovarian cancer
| |
− | |Endocrine System Diseases;Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289896 HSALNT0289896]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289896 HSALNG0142011]
| |
− | |LINC00582
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |endometrial cancer
| |
− | |Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289301 HSALNT0289301]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289301 HSALNG0141635]
| |
− | |LINC01537
| |
− | |RP11-169D4.1-001
| |
− | |NA
| |
− | |pathogenic process
| |
− | |laryngeal squamous cell cancer
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289551 HSALNT0289551]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289551 HSALNG0141666]
| |
− | |AC026166.2
| |
− | |MTCO1P5
| |
− | |NA
| |
− | |pathogenic process
| |
− | |laryngeal squamous cell cancer
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290184 HSALNT0290184]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290184 HSALNG0142299]
| |
− | |RP11-169D4.1-001
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |laryngeal squamous cell cancer
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289545 HSALNT0289545]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289545 HSALNG0141660]
| |
− | |AC006050.3
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |lung squamous cell cancer
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289556 HSALNT0289556]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289556 HSALNG0141671]
| |
− | |AC138128.1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289818 HSALNT0289818]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289818 HSALNG0141933]
| |
− | |ERCC1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290061 HSALNT0290061]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290061 HSALNG0142176]
| |
− | |MT1DP
| |
− | |MT1DP
| |
− | |NA
| |
− | |pathogenic process
| |
− | |liver cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289578 HSALNT0289578]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289578 HSALNG0141693]
| |
− | |AK023096
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |Wilmsâ tumor;uterine leiomyomas
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289112 HSALNT0289112]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289112 HSALNG0003560]
| |
− | |LINC01562
| |
− | |RP11-296A18.3
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |intervertebral disc degeneration
| |
− | |Musculoskeletal Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289567 HSALNT0289567]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289567 HSALNG0141682]
| |
− | |AK000974
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |breast cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289579 HSALNT0289579]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289579 HSALNG0141694]
| |
− | |AK024118
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |breast cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289645 HSALNT0289645]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289645 HSALNG0141760]
| |
− | |BC040204
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |breast cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290321 HSALNT0290321]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290321 HSALNG0142436]
| |
− | |U79277
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |breast cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289869 HSALNT0289869]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289869 HSALNG0141984]
| |
− | |HOST2
| |
− | |NA
| |
− | |ceRNA
| |
− | |pathogenic process
| |
− | |epithelial ovarian cancer
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289368 HSALNT0289368]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289368 HSALNG0135509]
| |
− | |MGAT3-AS1
| |
− | |TapSAKI
| |
− | |NA
| |
− | |pathogenic process
| |
− | |acute kidney injury
| |
− | |Male Urogenital Diseases;Female Urogenital Diseases and Pregnancy Complications
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289624 HSALNT0289624]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289624 HSALNG0141739]
| |
− | |ATXN7L3B
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |spinocerebellar ataxia
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289990 HSALNT0289990]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289990 HSALNG0142105]
| |
− | |lnc-SCA7
| |
− | |NA
| |
− | |ceRNA
| |
− | |pathogenic process
| |
− | |spinocerebellar ataxia
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290004 HSALNT0290004]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290004 HSALNG0142119]
| |
− | |LOC100287482
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |prostate cancer
| |
− | |Male Urogenital Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290383 HSALNT0290383]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290383 HSALNG0142498]
| |
− | |XLOC_007697
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |prostate cancer
| |
− | |Male Urogenital Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290384 HSALNT0290384]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290384 HSALNG0142499]
| |
− | |XLOC_008559
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |prostate cancer
| |
− | |Male Urogenital Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290385 HSALNT0290385]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290385 HSALNG0142500]
| |
− | |XLOC_009911
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |prostate cancer
| |
− | |Male Urogenital Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289813 HSALNT0289813]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289813 HSALNG0141928]
| |
− | |ENST00000480739
| |
− | |RPL13AP23
| |
− | |NA
| |
− | |pathogenic process
| |
− | |Pancreatic ductal adenocarcinoma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290111 HSALNT0290111]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290111 HSALNG0142226]
| |
− | |OS9
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |Pancreatic ductal adenocarcinoma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290324 HSALNT0290324]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290324 HSALNG0142439]
| |
− | |uc.283-plus
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |glioma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289117 HSALNT0289117]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289117 HSALNG0051652]
| |
− | |LINC01611
| |
− | |RP1-90L14.1,TCONS_l2_00025430
| |
− | |NA
| |
− | |pathogenic process
| |
− | |diabetic retinopathy
| |
− | |Endocrine System Diseases;Male Urogenital Diseases;Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289529 HSALNT0289529]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289529 HSALNG0141644]
| |
− | |2900055J20Rik
| |
− | |2900055J20Rik
| |
− | |NA
| |
− | |pathogenic process
| |
− | |left ventricular hypertrophy
| |
− | |Pathological Conditions, Signs and Symptoms;Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289792 HSALNT0289792]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289792 HSALNG0141907]
| |
− | |ENSG00000261777
| |
− | |AC012184.3
| |
− | |NA
| |
− | |pathogenic process
| |
− | |prostate cancer
| |
− | |Male Urogenital Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289618 HSALNT0289618]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289618 HSALNG0141733]
| |
− | |Asb3
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |cardiovascular and renal disease
| |
− | |Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289703 HSALNT0289703]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289703 HSALNG0141818]
| |
− | |Chac2
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |cardiovascular and renal disease
| |
− | |Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290139 HSALNT0290139]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290139 HSALNG0142254]
| |
− | |Pex11b
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |cardiovascular and renal disease
| |
− | |Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290255 HSALNT0290255]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290255 HSALNG0142370]
| |
− | |Sp5
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |cardiovascular and renal disease
| |
− | |Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0211639 HSALNT0211639]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0211639 HSALNG0101614]
| |
− | |PSMA3-AS1
| |
− | |FLJ31306
| |
− | |NA
| |
− | |pathogenic process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289319 HSALNT0289319]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289319 HSALNG0141639]
| |
− | |LINC00493
| |
− | |LOC388789
| |
− | |NA
| |
− | |pathogenic process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288903 HSALNT0288903]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288903 HSALNG0126842]
| |
− | |CARD8-AS1
| |
− | |LOC100505812
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |leukemia and neuroblastoma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0064729 HSALNT0064729]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0064729 HSALNG0030929]
| |
− | |KCNMB2-AS1
| |
− | |RP11-385J1.2
| |
− | |NA
| |
− | |pathogenic process
| |
− | |non-small cell lung cancer
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289548 HSALNT0289548]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289548 HSALNG0141663]
| |
− | |AC013264.2
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |non-small cell lung cancer
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289857 HSALNT0289857]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289857 HSALNG0141972]
| |
− | |GUCY1B2
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |non-small cell lung cancer
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290190 HSALNT0290190]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290190 HSALNG0142305]
| |
− | |RP11-385J1.2
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |non-small cell lung cancer
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290216 HSALNT0290216]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290216 HSALNG0142331]
| |
− | |RP1-317E23.3
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |non-small cell lung cancer
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290317 HSALNT0290317]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290317 HSALNG0142432]
| |
− | |TUBA4B
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |non-small cell lung cancer
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290375 HSALNT0290375]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290375 HSALNG0142490]
| |
− | |XLOC_000371
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |non-small cell lung cancer
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290397 HSALNT0290397]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290397 HSALNG0142512]
| |
− | |Z82214.3
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |non-small cell lung cancer
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289735 HSALNT0289735]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289735 HSALNG0141850]
| |
− | |DALIR
| |
− | |DALI
| |
− | |transcriptional regulation
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290376 HSALNT0290376]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290376 HSALNG0142491]
| |
− | |XLOC_000620
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |H. pylori-related diseases
| |
− | |Bacterial Infections and Mycoses
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290380 HSALNT0290380]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290380 HSALNG0142495]
| |
− | |XLOC_004122
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |H. pylori-related diseases
| |
− | |Bacterial Infections and Mycoses
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290381 HSALNT0290381]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290381 HSALNG0142496]
| |
− | |XLOC_004562
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |H. pylori-related diseases
| |
− | |Bacterial Infections and Mycoses
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290382 HSALNT0290382]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290382 HSALNG0142497]
| |
− | |XLOC_005912
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |H. pylori-related diseases
| |
− | |Bacterial Infections and Mycoses
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290391 HSALNT0290391]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290391 HSALNG0142506]
| |
− | |XLOC_014388
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |H. pylori-related diseases
| |
− | |Bacterial Infections and Mycoses
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290028 HSALNT0290028]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290028 HSALNG0142143]
| |
− | |LOC652276
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |colorectal cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290162 HSALNT0290162]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290162 HSALNG0142277]
| |
− | |R05532
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |colorectal cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0098175 HSALNT0098175]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0098175 HSALNG0046752]
| |
− | |LINC01411
| |
− | |RP11-267A15.1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |prostate cancer
| |
− | |Male Urogenital Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290025 HSALNT0290025]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290025 HSALNG0142140]
| |
− | |LOC401317
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |nasopharyngeal cancer
| |
− | |Otorhinolaryngologic Diseases;Neoplasms;Stomatognathic Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289726 HSALNT0289726]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289726 HSALNG0141841]
| |
− | |CTD-2574D22.4
| |
− | |AC120114.2
| |
− | |NA
| |
− | |pathogenic process
| |
− | |osteoarthritis
| |
− | |Musculoskeletal Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290141 HSALNT0290141]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290141 HSALNG0142256]
| |
− | |PMS2L2
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |osteoarthritis
| |
− | |Musculoskeletal Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289974 HSALNT0289974]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289974 HSALNG0142089]
| |
− | |lncRNA-422
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |colorectal cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289520 HSALNT0289520]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289520 HSALNG0133454]
| |
− | |AATBC
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |bladder cancer
| |
− | |Male Urogenital Diseases;Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289311 HSALNT0289311]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289311 HSALNG0141637]
| |
− | |LINC00974
| |
− | |NA
| |
− | |ceRNA
| |
− | |pathogenic process
| |
− | |hepatocellular cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0089943 HSALNT0089943]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0089943 HSALNG0042820]
| |
− | |ZBED3-AS1
| |
− | |NA
| |
− | |NA
| |
− | |developmental process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289116 HSALNT0289116]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289116 HSALNG0135958]
| |
− | |LINC01589
| |
− | |CTA-941F9.9,TCONS_00029353
| |
− | |NA
| |
− | |pathogenic process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289910 HSALNT0289910]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289910 HSALNG0142025]
| |
− | |LINC01426
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |esophageal squamous cell cancer
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290341 HSALNT0290341]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290341 HSALNG0142456]
| |
− | |uc002yug.2
| |
− | |NA
| |
− | |splicing regulation
| |
− | |pathogenic process
| |
− | |esophageal squamous cell cancer
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290250 HSALNT0290250]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290250 HSALNG0142365]
| |
− | |SNCG
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289949 HSALNT0289949]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289949 HSALNG0142064]
| |
− | |lnc-AF085935
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatocelluar cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289996 HSALNT0289996]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289996 HSALNG0142111]
| |
− | |lnc-uc003wbd
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatocelluar cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289559 HSALNT0289559]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289559 HSALNG0141674]
| |
− | |AF085935
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatocellular cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290347 HSALNT0290347]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290347 HSALNG0142462]
| |
− | |uc003wbd
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatocellular cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290098 HSALNT0290098]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290098 HSALNG0142213]
| |
− | |NR_001284
| |
− | |TNXA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |chronic thromboembolic pulmonary hypertension
| |
− | |Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290327 HSALNT0290327]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290327 HSALNG0142442]
| |
− | |uc.343
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |osteoarthritis
| |
− | |Musculoskeletal Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289196 HSALNT0289196]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289196 HSALNG0094525]
| |
− | |NRAV
| |
− | |DYNLL1-AS1
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |influenza A virus
| |
− | |Virus Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290140 HSALNT0290140]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290140 HSALNG0142255]
| |
− | |PLEC
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |chronic obstructive pulmonary disease
| |
− | |Respiratory Tract Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290172 HSALNT0290172]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290172 HSALNG0142287]
| |
− | |RNA44121|UCSC-2000-3182
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |chronic obstructive pulmonary disease
| |
− | |Respiratory Tract Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290173 HSALNT0290173]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290173 HSALNG0142288]
| |
− | |RNA50010|UCSC-9199-1005
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |chronic obstructive pulmonary disease
| |
− | |Respiratory Tract Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290174 HSALNT0290174]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290174 HSALNG0142289]
| |
− | |RNA58351|CombinedLit_316_550
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |chronic obstructive pulmonary disease
| |
− | |Respiratory Tract Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289714 HSALNT0289714]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289714 HSALNG0141829]
| |
− | |CR613944
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatocelluar cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289933 HSALNT0289933]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289933 HSALNG0142048]
| |
− | |lincRNA-CALCA
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatocelluar cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290200 HSALNT0290200]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290200 HSALNG0142315]
| |
− | |RP11-501G6.1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatocelluar cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290208 HSALNT0290208]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290208 HSALNG0142323]
| |
− | |RP11-672F9.1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatocelluar cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290405 HSALNT0290405]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290405 HSALNG0142520]
| |
− | |C14orf132
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatocelluar cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289937 HSALNT0289937]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289937 HSALNG0142052]
| |
− | |lincRNA-TSPAN8
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatocellular cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290225 HSALNT0290225]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290225 HSALNG0142340]
| |
− | |RP5-1014O16.1
| |
− | |AC244098.1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatocellular cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290275 HSALNT0290275]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290275 HSALNG0142390]
| |
− | |TCONS_00026102
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |atrial fibrillation
| |
− | |Pathological Conditions, Signs and Symptoms;Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290277 HSALNT0290277]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290277 HSALNG0142392]
| |
− | |TCONS_00032546
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |atrial fibrillation
| |
− | |Pathological Conditions, Signs and Symptoms;Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289037 HSALNT0289037]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289037 HSALNG0096978]
| |
− | |LINC00441
| |
− | |RB1-DT,ncRNA-RB1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289661 HSALNT0289661]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289661 HSALNG0141776]
| |
− | |C1401f132
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |non-small cell lung cancer
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289141 HSALNT0289141]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289141 HSALNG0039030]
| |
− | |LINC02365
| |
− | |LVCAT8
| |
− | |NA
| |
− | |pathogenic process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288885 HSALNT0288885]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288885 HSALNG0095161]
| |
− | |ADGRD1-AS1
| |
− | |LACAT8
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289142 HSALNT0289142]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289142 HSALNG0034152]
| |
− | |LINC02475
| |
− | |LVCAT1
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289542 HSALNT0289542]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289542 HSALNG0141657]
| |
− | |Abhd11os
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |neurodegenerative diseases
| |
− | |Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288895 HSALNT0288895]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288895 HSALNG0124521]
| |
− | |BISPR
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |virus infection
| |
− | |Virus Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0233975 HSALNT0233975]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0233975 HSALNG0112910]
| |
− | |MAFTRR
| |
− | |linc-MAF-4
| |
− | |transcriptional regulation
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290058 HSALNT0290058]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290058 HSALNG0142173]
| |
− | |MRAK052686
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |nonalcoholic fatty liver disease
| |
− | |Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290221 HSALNT0290221]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290221 HSALNG0142336]
| |
− | |RP4-583P15.10
| |
− | |AL121845.1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |breast cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0211341 HSALNT0211341]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0211341 HSALNG0101470]
| |
− | |KTN1-AS1
| |
− | |C14orf33,MYCLo-3
| |
− | |NA
| |
− | |pathogenic process
| |
− | |colorectal cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0266752 HSALNT0266752]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0266752 HSALNG0129835]
| |
− | |DLGAP4-AS1
| |
− | |CCAT7
| |
− | |NA
| |
− | |pathogenic process
| |
− | |colorectal cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289682 HSALNT0289682]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289682 HSALNG0141797]
| |
− | |CCAT3
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |colorectal cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289684 HSALNT0289684]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289684 HSALNG0141799]
| |
− | |CCAT8
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |colorectal cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289898 HSALNT0289898]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289898 HSALNG0142013]
| |
− | |LINC00659
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |colorectal cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289683 HSALNT0289683]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289683 HSALNG0141798]
| |
− | |CCAT7
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289627 HSALNT0289627]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289627 HSALNG0141742]
| |
− | |BALR-2
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |B cell acute lymphoblastic leukemia
| |
− | |Immune System Diseases;Neoplasms;Hemic and Lymphatic Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289948 HSALNT0289948]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289948 HSALNG0142063]
| |
− | |lnc-ACACA-1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |clear cell renal cell cancer
| |
− | |Male Urogenital Diseases;Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289953 HSALNT0289953]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289953 HSALNG0142068]
| |
− | |lnc-BMP2-2
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |clear cell renal cell cancer
| |
− | |Male Urogenital Diseases;Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289955 HSALNT0289955]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289955 HSALNG0142070]
| |
− | |lnc-CPN2-1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |clear cell renal cell cancer
| |
− | |Male Urogenital Diseases;Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289958 HSALNT0289958]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289958 HSALNG0142073]
| |
− | |lnc-FOXG1-2
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |clear cell renal cell cancer
| |
− | |Male Urogenital Diseases;Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289960 HSALNT0289960]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289960 HSALNG0142075]
| |
− | |lnc-FZD1-2
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |clear cell renal cell cancer
| |
− | |Male Urogenital Diseases;Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289962 HSALNT0289962]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289962 HSALNG0142077]
| |
− | |lnc-ITPR2-3
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |clear cell renal cell cancer
| |
− | |Male Urogenital Diseases;Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289965 HSALNT0289965]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289965 HSALNG0142080]
| |
− | |lnc-LCP2-2
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |clear cell renal cell cancer
| |
− | |Male Urogenital Diseases;Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289988 HSALNT0289988]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289988 HSALNG0142103]
| |
− | |lnc-RP3-368B9
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |clear cell renal cell cancer
| |
− | |Male Urogenital Diseases;Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289991 HSALNT0289991]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289991 HSALNG0142106]
| |
− | |lnc-SLC30A4-1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |clear cell renal cell cancer
| |
− | |Male Urogenital Diseases;Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289992 HSALNT0289992]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289992 HSALNG0142107]
| |
− | |lnc-SPAM1-6
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |clear cell renal cell cancer
| |
− | |Male Urogenital Diseases;Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289995 HSALNT0289995]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289995 HSALNG0142110]
| |
− | |lnc-TTC34-3
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |clear cell renal cell cancer
| |
− | |Male Urogenital Diseases;Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0222064 HSALNT0222064]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0222064 HSALNG0106856]
| |
− | |DRAIC
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |prostate cancer;glioma;cancer;bladder cancer;renal clear cell cancer;skin melanoma;hepatocellular cancer;lung adenocarcinoma;stomach adenocarcinoma
| |
− | |Neoplasms;Respiratory Tract Diseases;Male Urogenital Diseases;Female Urogenital Diseases and Pregnancy Complications;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0005037 HSALNT0005037]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0005037 HSALNG0002618]
| |
− | |LINC01137
| |
− | |LOC728431
| |
− | |NA
| |
− | |pathogenic process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290390 HSALNT0290390]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290390 HSALNG0142505]
| |
− | |XLOC_014172
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatocelluar cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290014 HSALNT0290014]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290014 HSALNG0142129]
| |
− | |LOC149086
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatocellular cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290183 HSALNT0290183]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290183 HSALNG0142298]
| |
− | |RP11-160H22.5
| |
− | |AL121983.2
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatocellular cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289945 HSALNT0289945]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289945 HSALNG0142060]
| |
− | |LNC00964-3
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |colorectal cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289616 HSALNT0289616]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289616 HSALNG0141731]
| |
− | |Arid2-IR
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |renal inflammation
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289716 HSALNT0289716]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289716 HSALNG0141831]
| |
− | |CR619813
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |pancreatic cancer
| |
− | |Endocrine System Diseases;Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289739 HSALNT0289739]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289739 HSALNG0141854]
| |
− | |DDX6P1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |pancreatic cancer
| |
− | |Endocrine System Diseases;Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289938 HSALNT0289938]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289938 HSALNG0142053]
| |
− | |lincRNA-ZNF532
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |pancreatic cancer
| |
− | |Endocrine System Diseases;Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290011 HSALNT0290011]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290011 HSALNG0142126]
| |
− | |LOC105372753
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |pancreatic cancer
| |
− | |Endocrine System Diseases;Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290013 HSALNT0290013]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290013 HSALNG0142128]
| |
− | |LOC105377769
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |pancreatic cancer
| |
− | |Endocrine System Diseases;Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290205 HSALNT0290205]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290205 HSALNG0142320]
| |
− | |RP11-58D2.1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |pancreatic cancer
| |
− | |Endocrine System Diseases;Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288946 HSALNT0288946]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288946 HSALNG0105101]
| |
− | |ENST00000434223
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |lung adenocarcinoma
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288947 HSALNT0288947]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288947 HSALNG0082178]
| |
− | |ENST00000442037
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |lung adenocarcinoma
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288953 HSALNT0288953]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288953 HSALNG0088449]
| |
− | |ENST00000540136
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |lung adenocarcinoma
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290103 HSALNT0290103]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290103 HSALNG0142218]
| |
− | |NR_038125
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |lung adenocarcinoma
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290136 HSALNT0290136]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290136 HSALNG0142251]
| |
− | |PDLIM3
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |lung adenocarcinoma
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290335 HSALNT0290335]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290335 HSALNG0142450]
| |
− | |uc001gch.1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |lung adenocarcinoma
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290336 HSALNT0290336]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290336 HSALNG0142451]
| |
− | |uc001gzl.3
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |lung adenocarcinoma
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290351 HSALNT0290351]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290351 HSALNG0142466]
| |
− | |uc004bbl.1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |lung adenocarcinoma
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290369 HSALNT0290369]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290369 HSALNG0142484]
| |
− | |VNN2
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |lung adenocarcinoma
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289577 HSALNT0289577]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289577 HSALNG0141692]
| |
− | |AK022798
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289663 HSALNT0289663]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289663 HSALNG0141778]
| |
− | |C1orf74
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289602 HSALNT0289602]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289602 HSALNG0141717]
| |
− | |AKR7L
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289711 HSALNT0289711]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289711 HSALNG0141826]
| |
− | |COL3A1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289878 HSALNT0289878]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289878 HSALNG0141993]
| |
− | |KCNE2
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289636 HSALNT0289636]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289636 HSALNG0141751]
| |
− | |BC015134
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289713 HSALNT0289713]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289713 HSALNG0141828]
| |
− | |CR594506
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289928 HSALNT0289928]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289928 HSALNG0142043]
| |
− | |lincRNA-BBOX1-2
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0271719 HSALNT0271719]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0271719 HSALNG0132223]
| |
− | |LINC00320
| |
− | |PRED14,FLJ37539
| |
− | |NA
| |
− | |pathogenic process;developmental process
| |
− | |cortical white matter
| |
− | |Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289823 HSALNT0289823]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289823 HSALNG0141938]
| |
− | |EVADR
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |pancreatic cancer;lung cancer;colorectal cancer;rectal cancer
| |
− | |Respiratory Tract Diseases;Endocrine System Diseases;Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289944 HSALNT0289944]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289944 HSALNG0142059]
| |
− | |Lnc_bc060912
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |lung cancer
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289952 HSALNT0289952]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289952 HSALNG0142067]
| |
− | |lnc-bc060912
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |lung cancer
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289613 HSALNT0289613]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289613 HSALNG0141728]
| |
− | |APF
| |
− | |NA
| |
− | |ceRNA
| |
− | |pathogenic process
| |
− | |myocardial infarction
| |
− | |Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289617 HSALNT0289617]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289617 HSALNG0141732]
| |
− | |AS Uchl1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |Parkinson's disease
| |
− | |Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289104 HSALNT0289104]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289104 HSALNG0099739]
| |
− | |LINC01296
| |
− | |FLJ39632
| |
− | |NA
| |
− | |pathogenic process
| |
− | |colorectal cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290403 HSALNT0290403]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290403 HSALNG0142518]
| |
− | |ZXF2
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |lung adenocarcinoma
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290113 HSALNT0290113]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290113 HSALNG0142228]
| |
− | |P14695
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatocelluar cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290114 HSALNT0290114]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290114 HSALNG0142229]
| |
− | |P16984
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatocelluar cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290115 HSALNT0290115]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290115 HSALNG0142230]
| |
− | |P19780
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatocelluar cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290116 HSALNT0290116]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290116 HSALNG0142231]
| |
− | |P23099
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatocelluar cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290117 HSALNT0290117]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290117 HSALNG0142232]
| |
− | |P24363
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatocelluar cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290118 HSALNT0290118]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290118 HSALNG0142233]
| |
− | |P28210
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatocelluar cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290120 HSALNT0290120]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290120 HSALNG0142235]
| |
− | |P33863
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatocelluar cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290121 HSALNT0290121]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290121 HSALNG0142236]
| |
− | |P4091
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatocelluar cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290122 HSALNT0290122]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290122 HSALNG0142237]
| |
− | |P6391
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatocelluar cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290123 HSALNT0290123]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290123 HSALNG0142238]
| |
− | |P6488
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatocelluar cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290124 HSALNT0290124]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290124 HSALNG0142239]
| |
− | |P700
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatocelluar cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290125 HSALNT0290125]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290125 HSALNG0142240]
| |
− | |P8611
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatocelluar cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290126 HSALNT0290126]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290126 HSALNG0142241]
| |
− | |P8725
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatocelluar cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290127 HSALNT0290127]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290127 HSALNG0142242]
| |
− | |P8860
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatocelluar cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290128 HSALNT0290128]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290128 HSALNG0142243]
| |
− | |P9745
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatocelluar cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289269 HSALNT0289269]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289269 HSALNG0044864]
| |
− | |TH2LCRR
| |
− | |TH2-LCR
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |allergic asthma
| |
− | |Respiratory Tract Diseases;Immune System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289964 HSALNT0289964]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289964 HSALNG0142079]
| |
− | |lnc-LCE5A-1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |laryngeal cancer;head and neck squamous cell cancer
| |
− | |Respiratory Tract Diseases;Otorhinolaryngologic Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0055198 HSALNT0055198]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0055198 HSALNG0026441]
| |
− | |FAM3D-AS1
| |
− | |lnc-KCTD6-3
| |
− | |NA
| |
− | |pathogenic process
| |
− | |tongue cancer;pharyngeal cancer;head and neck squamous cell cancer;laryngeal cancer
| |
− | |Respiratory Tract Diseases;Otorhinolaryngologic Diseases;Neoplasms;Stomatognathic Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289843 HSALNT0289843]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289843 HSALNG0141958]
| |
− | |FRLnc1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0242005 HSALNT0242005]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0242005 HSALNG0117109]
| |
− | |ENST00000575202
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |colorectal cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288952 HSALNT0288952]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288952 HSALNG0089220]
| |
− | |ENST00000539009
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |colorectal cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288954 HSALNT0288954]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288954 HSALNG0089242]
| |
− | |ENST00000544591
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |colorectal cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289752 HSALNT0289752]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289752 HSALNG0141867]
| |
− | |EHHADH-AS1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |colorectal cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289812 HSALNT0289812]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289812 HSALNG0141927]
| |
− | |ENST00000468960
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |colorectal cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290276 HSALNT0290276]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290276 HSALNG0142391]
| |
− | |TCONS_00026506
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |colorectal cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0189952 HSALNT0189952]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0189952 HSALNG0091595]
| |
− | |LRP1-AS
| |
− | |NA
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |Alzheimer's disease
| |
− | |Mental Disorders;Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0032045 HSALNT0032045]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0032045 HSALNG0015125]
| |
− | |LINC01122
| |
− | |FLJ30838,AC007092.1
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289565 HSALNT0289565]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289565 HSALNG0141680]
| |
− | |AI364715
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289921 HSALNT0289921]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289921 HSALNG0142036]
| |
− | |LINC0949
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |systemic lupus erythematosus
| |
− | |Immune System Diseases;Skin and Connective Tissue Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289680 HSALNT0289680]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289680 HSALNG0141795]
| |
− | |CCAL
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |colorectal cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289079 HSALNT0289079]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289079 HSALNG0077354]
| |
− | |LINC00993
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |breast cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289811 HSALNT0289811]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289811 HSALNG0141926]
| |
− | |ENST00000460164
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |triple-negative breast cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290282 HSALNT0290282]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290282 HSALNG0142397]
| |
− | |TCONS_l2_00003938
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |triple-negative breast cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289888 HSALNT0289888]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289888 HSALNG0142003]
| |
− | |LGALS3
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |papillary thyroid cancer
| |
− | |Endocrine System Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289963 HSALNT0289963]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289963 HSALNG0142078]
| |
− | |lnc-KCMF1-2:1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |papillary thyroid cancer
| |
− | |Endocrine System Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289967 HSALNT0289967]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289967 HSALNG0142082]
| |
− | |lnc-LLPH-2:1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |papillary thyroid cancer
| |
− | |Endocrine System Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289971 HSALNT0289971]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289971 HSALNG0142086]
| |
− | |lnc-PLA2R1-1:1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |papillary thyroid cancer
| |
− | |Endocrine System Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289972 HSALNT0289972]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289972 HSALNG0142087]
| |
− | |lnc-PSD4-1:14
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |papillary thyroid cancer
| |
− | |Endocrine System Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290066 HSALNT0290066]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290066 HSALNG0142181]
| |
− | |n335550
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |papillary thyroid cancer
| |
− | |Endocrine System Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290070 HSALNT0290070]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290070 HSALNG0142185]
| |
− | |n340790
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |papillary thyroid cancer
| |
− | |Endocrine System Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290072 HSALNT0290072]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290072 HSALNG0142187]
| |
− | |n386477
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |papillary thyroid cancer
| |
− | |Endocrine System Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290286 HSALNT0290286]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290286 HSALNG0142401]
| |
− | |TCONS_l2_00010365
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |papillary thyroid cancer
| |
− | |Endocrine System Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288944 HSALNT0288944]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288944 HSALNG0129184]
| |
− | |ENST00000422494
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289118 HSALNT0289118]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289118 HSALNG0038513]
| |
− | |LINC01612
| |
− | |RP11-789C1.1,TCONS_00008319
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289610 HSALNT0289610]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289610 HSALNG0141725]
| |
− | |AP001439.2
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289671 HSALNT0289671]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289671 HSALNG0141786]
| |
− | |CACNAICAS3
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289853 HSALNT0289853]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289853 HSALNG0141968]
| |
− | |GS1-5L10.1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289875 HSALNT0289875]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289875 HSALNG0141990]
| |
− | |INTS7
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290065 HSALNT0290065]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290065 HSALNG0142180]
| |
− | |MYLK-AS1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290157 HSALNT0290157]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290157 HSALNG0142272]
| |
− | |PRSS21
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290202 HSALNT0290202]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290202 HSALNG0142317]
| |
− | |RP11-528G1.2
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290207 HSALNT0290207]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290207 HSALNG0142322]
| |
− | |RP11-643M14.1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290209 HSALNT0290209]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290209 HSALNG0142324]
| |
− | |RP11-789C1.1
| |
− | |LINC01612
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290314 HSALNT0290314]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290314 HSALNG0142429]
| |
− | |TSNAX-DISC1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290386 HSALNT0290386]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290386 HSALNG0142501]
| |
− | |XLOC_010235
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289558 HSALNT0289558]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289558 HSALNG0141673]
| |
− | |AF075041
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |pancreatic cancer
| |
− | |Endocrine System Diseases;Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289564 HSALNT0289564]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289564 HSALNG0141679]
| |
− | |AF339813
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |pancreatic cancer
| |
− | |Endocrine System Diseases;Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289575 HSALNT0289575]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289575 HSALNG0141690]
| |
− | |AK022029
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |pancreatic cancer
| |
− | |Endocrine System Diseases;Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289576 HSALNT0289576]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289576 HSALNG0141691]
| |
− | |AK022159
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |pancreatic cancer
| |
− | |Endocrine System Diseases;Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289604 HSALNT0289604]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289604 HSALNG0141719]
| |
− | |AL389956
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |pancreatic cancer
| |
− | |Endocrine System Diseases;Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289640 HSALNT0289640]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289640 HSALNG0141755]
| |
− | |BC023629
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |pancreatic cancer
| |
− | |Endocrine System Diseases;Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290096 HSALNT0290096]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290096 HSALNG0142211]
| |
− | |NONHSAT125629
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |breast cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290393 HSALNT0290393]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290393 HSALNG0142508]
| |
− | |XR_250621.1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |breast cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288951 HSALNT0288951]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288951 HSALNG0033002]
| |
− | |ENST00000503938
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |triple-negative breast cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290085 HSALNT0290085]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290085 HSALNG0142200]
| |
− | |NONHSAT012762
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |triple-negative breast cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289151 HSALNT0289151]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289151 HSALNG0023952]
| |
− | |LMCD1-AS1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |acute kidney injury
| |
− | |Male Urogenital Diseases;Female Urogenital Diseases and Pregnancy Complications
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289926 HSALNT0289926]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289926 HSALNG0142041]
| |
− | |linc-PXN-1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |prostate cancer
| |
− | |Male Urogenital Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290281 HSALNT0290281]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290281 HSALNG0142396]
| |
− | |TCONS_l2_00001418
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |prostate cancer
| |
− | |Male Urogenital Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290285 HSALNT0290285]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290285 HSALNG0142400]
| |
− | |TCONS_l2_00008237
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |prostate cancer
| |
− | |Male Urogenital Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290287 HSALNT0290287]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290287 HSALNG0142402]
| |
− | |TCONS_l2_00011130
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |prostate cancer
| |
− | |Male Urogenital Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290288 HSALNT0290288]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290288 HSALNG0142403]
| |
− | |TCONS_l2_00013175
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |prostate cancer
| |
− | |Male Urogenital Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290294 HSALNT0290294]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290294 HSALNG0142409]
| |
− | |TCONS_l2_00022611
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |prostate cancer
| |
− | |Male Urogenital Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290295 HSALNT0290295]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290295 HSALNG0142410]
| |
− | |TCONS_l2_00022670
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |prostate cancer
| |
− | |Male Urogenital Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290352 HSALNT0290352]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290352 HSALNG0142467]
| |
− | |uc004bdv.3
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatocelluar cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290363 HSALNT0290363]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290363 HSALNG0142478]
| |
− | |ULK4P2
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatocelluar cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289942 HSALNT0289942]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289942 HSALNG0142057]
| |
− | |LK4P2
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatocellular cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289538 HSALNT0289538]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289538 HSALNG0141653]
| |
− | |AB019562
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hypopharyngeal squamous cell cancer
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0091661 HSALNT0091661]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0091661 HSALNG0043585]
| |
− | |ENST00000503710
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |endometrial cancer
| |
− | |Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289806 HSALNT0289806]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289806 HSALNG0141921]
| |
− | |ENST00000445734
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |endometrial cancer
| |
− | |Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289807 HSALNT0289807]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289807 HSALNG0141922]
| |
− | |ENST00000448093
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |endometrial cancer
| |
− | |Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289815 HSALNT0289815]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289815 HSALNG0141930]
| |
− | |ENST00000502941
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |endometrial cancer
| |
− | |Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290340 HSALNT0290340]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290340 HSALNG0142455]
| |
− | |uc002nbr.3
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |endometrial cancer
| |
− | |Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290348 HSALNT0290348]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290348 HSALNG0142463]
| |
− | |uc003xut.
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |endometrial cancer
| |
− | |Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290356 HSALNT0290356]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290356 HSALNG0142471]
| |
− | |uc021re1.1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |endometrial cancer
| |
− | |Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289549 HSALNT0289549]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289549 HSALNG0141664]
| |
− | |AC016745.3
| |
− | |AC016745.1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |glioma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290180 HSALNT0290180]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290180 HSALNG0142295]
| |
− | |RP11-128A17.1
| |
− | |AC078909.1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |glioma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290377 HSALNT0290377]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290377 HSALNG0142492]
| |
− | |XLOC_001711
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |glioma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289975 HSALNT0289975]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289975 HSALNG0142090]
| |
− | |lncRNA-AK058003
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |breast cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289061 HSALNT0289061]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289061 HSALNG0034072]
| |
− | |LINC00682
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatocellular cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289305 HSALNT0289305]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289305 HSALNG0089456]
| |
− | |LINC01559
| |
− | |FLJ33810
| |
− | |NA
| |
− | |pathogenic process
| |
− | |Huntington disease
| |
− | |Mental Disorders;Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289854 HSALNT0289854]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289854 HSALNG0141969]
| |
− | |GSTT1-AS1
| |
− | |NA
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |mycobacterium tuberculosis infection
| |
− | |Bacterial Infections and Mycoses
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289978 HSALNT0289978]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289978 HSALNG0142093]
| |
− | |lncRNA-CD244
| |
− | |NA
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |tuberculosis infection
| |
− | |Bacterial Infections and Mycoses
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289237 HSALNT0289237]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289237 HSALNG0068014]
| |
− | |SAMD12-AS1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |neuroblastoma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290179 HSALNT0290179]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290179 HSALNG0142294]
| |
− | |RP11-119F7.4
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290278 HSALNT0290278]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290278 HSALNG0142393]
| |
− | |TCONS_00068220
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0285573 HSALNT0285573]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0285573 HSALNG0139654]
| |
− | |DANT1
| |
− | |NA
| |
− | |transcriptional regulation
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288926 HSALNT0288926]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288926 HSALNG0139662]
| |
− | |DANT2
| |
− | |NA
| |
− | |transcriptional regulation
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290399 HSALNT0290399]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290399 HSALNG0142514]
| |
− | |ZMAT1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289554 HSALNT0289554]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289554 HSALNG0141669]
| |
− | |AC100865.1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |coronary artery disease
| |
− | |Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289228 HSALNT0289228]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289228 HSALNG0105273]
| |
− | |RAD51-AS1
| |
− | |TODRA
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |breast cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289743 HSALNT0289743]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289743 HSALNG0141858]
| |
− | |DKFZP434K028
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289630 HSALNT0289630]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289630 HSALNG0141745]
| |
− | |BC002811
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |astrocytoma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290387 HSALNT0290387]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290387 HSALNG0142502]
| |
− | |XLOC_010967
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |astrocytoma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288955 HSALNT0288955]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288955 HSALNG0084672]
| |
− | |ENST00000545440
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |pediatric acute myeloid leukemia
| |
− | |Hemic and Lymphatic Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288981 HSALNT0288981]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288981 HSALNG0133391]
| |
− | |FRGCA
| |
− | |LncRNA-AP001631.9
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289611 HSALNT0289611]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289611 HSALNG0141726]
| |
− | |AP001631.9
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289976 HSALNT0289976]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289976 HSALNG0142091]
| |
− | |LncRNA-AP001631.9
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289686 HSALNT0289686]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289686 HSALNG0141801]
| |
− | |CD99P1
| |
− | |NA
| |
− | |ceRNA
| |
− | |pathogenic process
| |
− | |idiopathic pulmonary fibrosis
| |
− | |Respiratory Tract Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289119 HSALNT0289119]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289119 HSALNG0074097]
| |
− | |LINC01613
| |
− | |n341773
| |
− | |NA
| |
− | |pathogenic process
| |
− | |idiopathic pulmonary fibrosis
| |
− | |Respiratory Tract Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289844 HSALNT0289844]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289844 HSALNG0141959]
| |
− | |FTH1P3
| |
− | |FTH1P3
| |
− | |NA
| |
− | |pathogenic process
| |
− | |oral squamous cell cancer
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289855 HSALNT0289855]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289855 HSALNG0141970]
| |
− | |GTF2IRD2P1
| |
− | |GTF2IRD2P1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |oral squamous cell cancer
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290135 HSALNT0290135]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290135 HSALNG0142250]
| |
− | |PDIA3F
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |oral squamous cell cancer
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289329 HSALNT0289329]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289329 HSALNG0026562]
| |
− | |LINC00994
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |inflammatory bowel disease
| |
− | |Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289208 HSALNT0289208]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289208 HSALNG0077290]
| |
− | |PCAT5
| |
− | |LINC01452,TPCAT-10-36067
| |
− | |NA
| |
− | |pathogenic process
| |
− | |prostate cancer
| |
− | |Male Urogenital Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0114870 HSALNT0114870]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0114870 HSALNG0054158]
| |
− | |LUADT1
| |
− | |NA
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |lung adenocarcinoma
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289154 HSALNT0289154]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289154 HSALNG0107133]
| |
− | |LOXL1-AS1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |exfoliation syndrome
| |
− | |Eye Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289734 HSALNT0289734]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289734 HSALNG0141849]
| |
− | |DACOR1
| |
− | |TCONS_00023265
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |colorectal cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289060 HSALNT0289060]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289060 HSALNG0114548]
| |
− | |LINC00675
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |Pancreatic ductal adenocarcinoma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288889 HSALNT0288889]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288889 HSALNG0070759]
| |
− | |B4GALT1-AS1
| |
− | |NA
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289348 HSALNT0289348]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289348 HSALNG0083371]
| |
− | |LINC01616
| |
− | |n341006
| |
− | |NA
| |
− | |pathogenic process
| |
− | |Alzheimer's disease
| |
− | |Mental Disorders;Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290068 HSALNT0290068]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290068 HSALNG0142183]
| |
− | |n336934
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |Alzheimer's disease
| |
− | |Mental Disorders;Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290240 HSALNT0290240]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290240 HSALNG0142355]
| |
− | |SIRT1-AS
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatocellular cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290198 HSALNT0290198]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290198 HSALNG0142313]
| |
− | |RP11-457M11.2
| |
− | |NA
| |
− | |ceRNA
| |
− | |pathogenic process
| |
− | |lung adenocarcinoma
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0150768 HSALNT0150768]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0150768 HSALNG0072141]
| |
− | |LINC01507
| |
− | |XLOC_000303
| |
− | |NA
| |
− | |pathogenic process
| |
− | |colorectal cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289903 HSALNT0289903]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289903 HSALNG0142018]
| |
− | |LINC01057
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |colorectal cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289914 HSALNT0289914]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289914 HSALNG0142029]
| |
− | |LINC01617
| |
− | |C8orf23,NCRNA00249,XLOC_006844
| |
− | |NA
| |
− | |pathogenic process
| |
− | |colorectal cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290015 HSALNT0290015]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290015 HSALNG0142130]
| |
− | |LOC152578
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |colorectal cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0072252 HSALNT0072252]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0072252 HSALNG0034426]
| |
− | |LINC01618
| |
− | |LOC152578
| |
− | |NA
| |
− | |pathogenic process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0156870 HSALNT0156870]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0156870 HSALNG0075266]
| |
− | |NALT1
| |
− | |MIR4674HG,LINC01573,TCONS_l2_00029132
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |acute lymphoblastic leukemia
| |
− | |Immune System Diseases;Neoplasms;Hemic and Lymphatic Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289083 HSALNT0289083]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289083 HSALNG0045290]
| |
− | |MALINC1
| |
− | |LINC01024,MA-linc1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |human breast and lung cancer
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289902 HSALNT0289902]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289902 HSALNG0142017]
| |
− | |LINC01024
| |
− | |MA-linc1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |osteosarcoma;lung cancer
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289120 HSALNT0289120]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289120 HSALNG0071043]
| |
− | |LINC01627
| |
− | |RP11-397D12.4
| |
− | |NA
| |
− | |pathogenic process
| |
− | |non-small cell lung cancer
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289121 HSALNT0289121]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289121 HSALNG0015617]
| |
− | |LINC01628
| |
− | |AC007403.1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |non-small cell lung cancer
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289820 HSALNT0289820]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289820 HSALNG0141935]
| |
− | |ERICH1-AS1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |non-small cell lung cancer
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290193 HSALNT0290193]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290193 HSALNG0142308]
| |
− | |RP11-397D12.4
| |
− | |LINC01627
| |
− | |NA
| |
− | |pathogenic process
| |
− | |non-small cell lung cancer
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289122 HSALNT0289122]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289122 HSALNG0102605]
| |
− | |LINC01629
| |
− | |linc-KIAA1737-2
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |hypoxic and inflammatory renal epithelial injury
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290161 HSALNT0290161]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290161 HSALNG0142276]
| |
− | |PTPRG-AS1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |breast cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289980 HSALNT0289980]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289980 HSALNG0142095]
| |
− | |lncRNA-DLEU1
| |
− | |NA
| |
− | |ceRNA
| |
− | |pathogenic process
| |
− | |breast cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289983 HSALNT0289983]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289983 HSALNG0142098]
| |
− | |lncRNA-Hh
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |breast cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288986 HSALNT0288986]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288986 HSALNG0072437]
| |
− | |GAS1RR
| |
− | |LncRNA-Hh
| |
− | |NA
| |
− | |pathogenic process
| |
− | |breast cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288908 HSALNT0288908]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288908 HSALNG0005250]
| |
− | |CCDC18-AS1
| |
− | |ENST00000440778.1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |adolescent idiopathic scoliosis
| |
− | |Musculoskeletal Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289055 HSALNT0289055]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289055 HSALNG0132813]
| |
− | |LINC00649
| |
− | |TCONS_00028768
| |
− | |NA
| |
− | |pathogenic process
| |
− | |adolescent idiopathic scoliosis
| |
− | |Musculoskeletal Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289219 HSALNT0289219]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289219 HSALNG0075966]
| |
− | |PRKCQ-AS1
| |
− | |ENST00000414894.1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |adolescent idiopathic scoliosis
| |
− | |Musculoskeletal Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290203 HSALNT0290203]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290203 HSALNG0142318]
| |
− | |RP11-567G11.1
| |
− | |LINC02041
| |
− | |NA
| |
− | |pathogenic process
| |
− | |pancreatic cancer
| |
− | |Endocrine System Diseases;Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289805 HSALNT0289805]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289805 HSALNG0141920]
| |
− | |ENST00000438550
| |
− | |RPS24P1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |nasopharyngeal cancer
| |
− | |Otorhinolaryngologic Diseases;Neoplasms;Stomatognathic Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290083 HSALNT0290083]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290083 HSALNG0142198]
| |
− | |NONHSAG011351
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |type 1 diabetes
| |
− | |Nutritional and Metabolic Diseases;Endocrine System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290049 HSALNT0290049]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290049 HSALNG0142164]
| |
− | |MCHR2-AS1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |psychiatric disease
| |
− | |Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289799 HSALNT0289799]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289799 HSALNG0141914]
| |
− | |ENST00000414355
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |cadmium toxicology
| |
− | |Disorders of Environmental Origin
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290241 HSALNT0290241]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290241 HSALNG0142356]
| |
− | |SKP2
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |non-small cell lung cancer
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289837 HSALNT0289837]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289837 HSALNG0141952]
| |
− | |FLJ90757
| |
− | |NA
| |
− | |ceRNA
| |
− | |pathogenic process
| |
− | |hepatocellular cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290017 HSALNT0290017]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290017 HSALNG0142132]
| |
− | |LOC283663
| |
− | |NA
| |
− | |ceRNA
| |
− | |pathogenic process
| |
− | |hepatocellular cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290019 HSALNT0290019]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290019 HSALNG0142134]
| |
− | |LOC338651
| |
− | |NA
| |
− | |ceRNA
| |
− | |pathogenic process
| |
− | |hepatocellular cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290132 HSALNT0290132]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290132 HSALNG0142247]
| |
− | |PCATs
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |prostate cancer
| |
− | |Male Urogenital Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0086786 HSALNT0086786]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0086786 HSALNG0041277]
| |
− | |EGFLAM-AS1
| |
− | |lncRNA-LOWEG
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290031 HSALNT0290031]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290031 HSALNG0142146]
| |
− | |LOWEG
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289635 HSALNT0289635]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289635 HSALNG0141750]
| |
− | |BC014579
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatocelluar cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289721 HSALNT0289721]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289721 HSALNG0141836]
| |
− | |CTB-167B5.2
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatocelluar cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289863 HSALNT0289863]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289863 HSALNG0141978]
| |
− | |HELLS
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |leukemia
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290195 HSALNT0290195]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290195 HSALNG0142310]
| |
− | |RP11-401P9.4
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatocelluar cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290252 HSALNT0290252]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290252 HSALNG0142367]
| |
− | |SNHG19
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatocelluar cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289557 HSALNT0289557]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289557 HSALNG0141672]
| |
− | |AF070632
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatocellular cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289569 HSALNT0289569]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289569 HSALNG0141684]
| |
− | |AK021443
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatocellular cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289728 HSALNT0289728]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289728 HSALNG0141843]
| |
− | |CTD-3080P12.3
| |
− | |NA
| |
− | |ceRNA
| |
− | |pathogenic process
| |
− | |gastric cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289987 HSALNT0289987]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289987 HSALNG0142102]
| |
− | |lncRNA-n336928
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |bladder cancer
| |
− | |Male Urogenital Diseases;Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289723 HSALNT0289723]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289723 HSALNG0141838]
| |
− | |CTC-523E23.5
| |
− | |AC008555.2
| |
− | |NA
| |
− | |pathogenic process
| |
− | |intervertebral disc degeneration
| |
− | |Musculoskeletal Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289724 HSALNT0289724]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289724 HSALNG0141839]
| |
− | |CTD-2246P4.1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |intervertebral disc degeneration
| |
− | |Musculoskeletal Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290055 HSALNT0290055]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290055 HSALNG0142170]
| |
− | |MIR132
| |
− | |MIRN132,miRNA132,mir-132
| |
− | |NA
| |
− | |pathogenic process
| |
− | |intervertebral disc degeneration
| |
− | |Musculoskeletal Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290189 HSALNT0290189]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290189 HSALNG0142304]
| |
− | |RP11-363G2.4
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |intervertebral disc degeneration
| |
− | |Musculoskeletal Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290191 HSALNT0290191]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290191 HSALNG0142306]
| |
− | |RP11-38F22.1
| |
− | |LINC02424
| |
− | |NA
| |
− | |pathogenic process
| |
− | |intervertebral disc degeneration
| |
− | |Musculoskeletal Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290223 HSALNT0290223]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290223 HSALNG0142338]
| |
− | |RP4-639J15.1
| |
− | |AC006967.2
| |
− | |NA
| |
− | |pathogenic process
| |
− | |intervertebral disc degeneration
| |
− | |Musculoskeletal Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290233 HSALNT0290233]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290233 HSALNG0142348]
| |
− | |RUNX1-IT1
| |
− | |C21orf96
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288943 HSALNT0288943]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288943 HSALNG0053446]
| |
− | |ENST00000415964
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |pediatric acute myeloid leukemia
| |
− | |Hemic and Lymphatic Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290009 HSALNT0290009]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290009 HSALNG0142124]
| |
− | |LOC101927497
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289956 HSALNT0289956]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289956 HSALNG0142071]
| |
− | |lnc-CYP4A22-2/3
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |clear cell renal cell cancer
| |
− | |Male Urogenital Diseases;Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289999 HSALNT0289999]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289999 HSALNG0142114]
| |
− | |lnc-ZNF180-2
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |renal clear cell cancer
| |
− | |Male Urogenital Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290086 HSALNT0290086]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290086 HSALNG0142201]
| |
− | |NONHSAT037832
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |papillary thyroid cancer
| |
− | |Endocrine System Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289658 HSALNT0289658]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289658 HSALNG0141773]
| |
− | |BX647187
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |prostate cancer
| |
− | |Male Urogenital Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288920 HSALNT0288920]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288920 HSALNG0017086]
| |
− | |CNNM3-DT
| |
− | |LOC100506036
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289584 HSALNT0289584]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289584 HSALNG0141699]
| |
− | |AK056155
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |Loeys-Dietz syndrome
| |
− | |Musculoskeletal Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290057 HSALNT0290057]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290057 HSALNG0142172]
| |
− | |MR1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |Loeys-Dietz syndrome
| |
− | |Musculoskeletal Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289543 HSALNT0289543]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289543 HSALNG0141658]
| |
− | |AC002454.1
| |
− | |AC002454.1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |endometriosis
| |
− | |Female Urogenital Diseases and Pregnancy Complications
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289909 HSALNT0289909]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289909 HSALNG0142024]
| |
− | |LINC01420
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |systemic lupus erythematosus
| |
− | |Immune System Diseases;Skin and Connective Tissue Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289531 HSALNT0289531]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289531 HSALNG0141646]
| |
− | |53BP1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |breast cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290101 HSALNT0290101]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290101 HSALNG0142216]
| |
− | |NR_024118
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |rheumatoid arthritis
| |
− | |Immune System Diseases;Musculoskeletal Diseases;Skin and Connective Tissue Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290239 HSALNT0290239]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290239 HSALNG0142354]
| |
− | |SGO1-AS1
| |
− | |SGOL1-AS1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |lung cancer
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289293 HSALNT0289293]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289293 HSALNG0127764]
| |
− | |ZNF667-AS1
| |
− | |MORT
| |
− | |NA
| |
− | |pathogenic process
| |
− | |breast cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289984 HSALNT0289984]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289984 HSALNG0142099]
| |
− | |lncRNA-HIF2PUT
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |colorectal cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288945 HSALNT0288945]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288945 HSALNG0018617]
| |
− | |ENST00000433673
| |
− | |AC068282.1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |polycystic ovary syndrome
| |
− | |Female Urogenital Diseases and Pregnancy Complications
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288948 HSALNT0288948]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288948 HSALNG0008353]
| |
− | |ENST00000454271
| |
− | |AL021940.1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |polycystic ovary syndrome
| |
− | |Female Urogenital Diseases and Pregnancy Complications
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289495 HSALNT0289495]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289495 HSALNG0141606]
| |
− | |ENST00000432431
| |
− | |AC023128.1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |polycystic ovary syndrome
| |
− | |Female Urogenital Diseases and Pregnancy Complications
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289918 HSALNT0289918]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289918 HSALNG0142033]
| |
− | |LINC01828
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |polycystic ovary syndrome
| |
− | |Female Urogenital Diseases and Pregnancy Complications
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290388 HSALNT0290388]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290388 HSALNG0142503]
| |
− | |XLOC_011402
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |polycystic ovary syndrome
| |
− | |Female Urogenital Diseases and Pregnancy Complications
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289873 HSALNT0289873]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289873 HSALNG0141988]
| |
− | |ICAM-1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatocellular cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289668 HSALNT0289668]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289668 HSALNG0141783]
| |
− | |C5T1lncRNA
| |
− | |NA
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |rheumatoid arthritis
| |
− | |Immune System Diseases;Musculoskeletal Diseases;Skin and Connective Tissue Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289667 HSALNT0289667]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289667 HSALNG0141782]
| |
− | |C5T1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289666 HSALNT0289666]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289666 HSALNG0141781]
| |
− | |C5-OT1
| |
− | |C5T1lncRNA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |rheumatoid arthritis
| |
− | |Immune System Diseases;Musculoskeletal Diseases;Skin and Connective Tissue Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289626 HSALNT0289626]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289626 HSALNG0141741]
| |
− | |AX800134
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatocellular cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290338 HSALNT0290338]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290338 HSALNG0142453]
| |
− | |uc001ncr
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatocellular cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290330 HSALNT0290330]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290330 HSALNG0142445]
| |
− | |uc.48+
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |diabetic neuropathic pain
| |
− | |Male Urogenital Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289098 HSALNT0289098]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289098 HSALNG0038313]
| |
− | |LINC01207
| |
− | |NA
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |lung adenocarcinoma
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289628 HSALNT0289628]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289628 HSALNG0141743]
| |
− | |BALR-6
| |
− | |NA
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |B-lymphoblastic leukemia
| |
− | |Hemic and Lymphatic Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290022 HSALNT0290022]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290022 HSALNG0142137]
| |
− | |LOC389641
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |Pancreatic ductal adenocarcinoma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289725 HSALNT0289725]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289725 HSALNG0141840]
| |
− | |CTD-2541M15
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289940 HSALNT0289940]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289940 HSALNG0142055]
| |
− | |LINK-A
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |triple-negative breast cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290107 HSALNT0290107]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290107 HSALNG0142222]
| |
− | |NUTF2P3
| |
− | |NUTF2P3
| |
− | |NA
| |
− | |pathogenic process
| |
− | |pancreatic cancer
| |
− | |Endocrine System Diseases;Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290095 HSALNT0290095]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290095 HSALNG0142210]
| |
− | |NONHSAT123350
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |renal clear cell cancer
| |
− | |Male Urogenital Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290362 HSALNT0290362]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290362 HSALNG0142477]
| |
− | |UHRF1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |colorectal cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290366 HSALNT0290366]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290366 HSALNG0142481]
| |
− | |UPAT
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |colorectal cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289307 HSALNT0289307]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289307 HSALNG0114404]
| |
− | |LINC00324
| |
− | |FLJ34790,MGC104931
| |
− | |NA
| |
− | |pathogenic process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289969 HSALNT0289969]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289969 HSALNG0142084]
| |
− | |lnc-MX1-1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |prostate cancer
| |
− | |Male Urogenital Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290024 HSALNT0290024]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290024 HSALNG0142139]
| |
− | |LOC400891
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |prostate cancer
| |
− | |Male Urogenital Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289883 HSALNT0289883]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289883 HSALNG0141998]
| |
− | |LA16c-313D11.11
| |
− | |NA
| |
− | |ceRNA
| |
− | |pathogenic process
| |
− | |endometrial cancer
| |
− | |Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290192 HSALNT0290192]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290192 HSALNG0142307]
| |
− | |RP11-395G23.3
| |
− | |AC027031.2
| |
− | |NA
| |
− | |pathogenic process
| |
− | |endometrial cancer
| |
− | |Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289742 HSALNT0289742]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289742 HSALNG0141857]
| |
− | |DILC
| |
− | |NA
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |liver cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289957 HSALNT0289957]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289957 HSALNG0142072]
| |
− | |lnc-DILC
| |
− | |NA
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |liver cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289581 HSALNT0289581]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289581 HSALNG0141696]
| |
− | |AK027294
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |colorectal cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290371 HSALNT0290371]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290371 HSALNG0142486]
| |
− | |WISP1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |colorectal cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0206117 HSALNT0206117]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0206117 HSALNG0099020]
| |
− | |FGF14-AS2
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |breast cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290131 HSALNT0290131]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290131 HSALNG0142246]
| |
− | |PCAT2
| |
− | |CARLo-4,PCA2,TCONS_00015167
| |
− | |NA
| |
− | |pathogenic process
| |
− | |prostate cancer
| |
− | |Male Urogenital Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289528 HSALNT0289528]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289528 HSALNG0141643]
| |
− | |2700086A05Rik
| |
− | |2700086A05Rik
| |
− | |NA
| |
− | |pathogenic process
| |
− | |idiopathic pulmonary fibrosis
| |
− | |Respiratory Tract Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290251 HSALNT0290251]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290251 HSALNG0142366]
| |
− | |SNED1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |Idiopathic pulmonary fibrosis
| |
− | |Respiratory Tract Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290333 HSALNT0290333]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290333 HSALNG0142448]
| |
− | |uc.77
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |idiopathic pulmonary fibrosis
| |
− | |Respiratory Tract Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289816 HSALNT0289816]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289816 HSALNG0141931]
| |
− | |ENST00000537266
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |papillary thyroid cancer
| |
− | |Endocrine System Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289860 HSALNT0289860]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289860 HSALNG0141975]
| |
− | |HAGLROS
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |papillary thyroid cancer
| |
− | |Endocrine System Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289881 HSALNT0289881]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289881 HSALNG0141996]
| |
− | |KRT18P55
| |
− | |KRT18P55
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0229266 HSALNT0229266]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0229266 HSALNG0110450]
| |
− | |IL21R-AS1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |coronary artery disease
| |
− | |Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290112 HSALNT0290112]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290112 HSALNG0142227]
| |
− | |OTTHUMT00000387022
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |coronary artery disease
| |
− | |Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0000551 HSALNT0000551]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0000551 HSALNG0000226]
| |
− | |PRKCZ-AS1
| |
− | |RP11-181G12.2
| |
− | |NA
| |
− | |pathogenic process
| |
− | |lung adenocarcinoma
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0030981 HSALNT0030981]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0030981 HSALNG0014612]
| |
− | |LINC01833
| |
− | |RP11-89,K21.1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |lung adenocarcinoma
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290214 HSALNT0290214]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290214 HSALNG0142329]
| |
− | |RP11-89K21
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |lung adenocarcinoma
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0165271 HSALNT0165271]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0165271 HSALNG0079188]
| |
− | |LINC00857
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |lung cancer
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290109 HSALNT0290109]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290109 HSALNG0142224]
| |
− | |OR3A4
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290046 HSALNT0290046]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290046 HSALNG0142161]
| |
− | |MAGI1-IT1
| |
− | |NA
| |
− | |ceRNA
| |
− | |pathogenic process
| |
− | |cardiac hypertrophy
| |
− | |Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290242 HSALNT0290242]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290242 HSALNG0142357]
| |
− | |SLC26A4-AS1
| |
− | |NA
| |
− | |ceRNA
| |
− | |pathogenic process
| |
− | |cardiac hypertrophy
| |
− | |Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289302 HSALNT0289302]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289302 HSALNG0141636]
| |
− | |KRT7-AS
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0218672 HSALNT0218672]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0218672 HSALNG0105101]
| |
− | |LINC01852
| |
− | |ENST00000434223
| |
− | |NA
| |
− | |pathogenic process
| |
− | |non-small cell lung cancer
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290178 HSALNT0290178]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290178 HSALNG0142293]
| |
− | |RP11-1008C21.2
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |non-small cell lung cancer
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289592 HSALNT0289592]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289592 HSALNG0141707]
| |
− | |AK123072
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289573 HSALNT0289573]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289573 HSALNG0141688]
| |
− | |AK021954
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |atherosclerosis
| |
− | |Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288916 HSALNT0288916]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288916 HSALNG0105961]
| |
− | |CERNA1
| |
− | |LOC100129973
| |
− | |ceRNA
| |
− | |pathogenic process
| |
− | |cardiovascular disease
| |
− | |Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0018525 HSALNT0018525]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0018525 HSALNG0008959]
| |
− | |LAMC1-AS1
| |
− | |lnc-LAMC2-1:1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |colorectal cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290087 HSALNT0290087]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290087 HSALNG0142202]
| |
− | |NONHSAT040387
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |atrial fibrillation
| |
− | |Pathological Conditions, Signs and Symptoms;Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290092 HSALNT0290092]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290092 HSALNG0142207]
| |
− | |NONHSAT098586
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |atrial fibrillation
| |
− | |Pathological Conditions, Signs and Symptoms;Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289213 HSALNT0289213]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289213 HSALNG0108626]
| |
− | |PCSK6-AS1
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289637 HSALNT0289637]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289637 HSALNG0141752]
| |
− | |BC016831
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |breast cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289874 HSALNT0289874]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289874 HSALNG0141989]
| |
− | |IGKV
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |breast cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290196 HSALNT0290196]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290196 HSALNG0142311]
| |
− | |RP11-434D9.1
| |
− | |AC112206.2
| |
− | |NA
| |
− | |pathogenic process
| |
− | |breast cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289885 HSALNT0289885]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289885 HSALNG0142000]
| |
− | |LCAL6
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |lung adenocarcinoma
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289650 HSALNT0289650]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289650 HSALNG0141765]
| |
− | |BC088254
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |myocardial hypertrophy
| |
− | |Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289596 HSALNT0289596]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289596 HSALNG0141711]
| |
− | |AK124454
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |breast cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289731 HSALNT0289731]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289731 HSALNG0141846]
| |
− | |CYP4B1-PS1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |diabetic nephropathy
| |
− | |Endocrine System Diseases;Male Urogenital Diseases;Female Urogenital Diseases and Pregnancy Complications
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289106 HSALNT0289106]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289106 HSALNG0094020]
| |
− | |LINC01405
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |breast cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290259 HSALNT0290259]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290259 HSALNG0142374]
| |
− | |ST8SIA6-AS1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |breast cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289278 HSALNT0289278]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289278 HSALNG0047244]
| |
− | |TRIM52-AS1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |renal cell cancer
| |
− | |Male Urogenital Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289634 HSALNT0289634]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289634 HSALNG0141749]
| |
− | |BC012900
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |ulcerative colitis
| |
− | |Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0274011 HSALNT0274011]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0274011 HSALNG0133283]
| |
− | |UMODL1-AS1
| |
− | |FLJ33471
| |
− | |NA
| |
− | |pathogenic process
| |
− | |breast cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289454 HSALNT0289454]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289454 HSALNG0075449]
| |
− | |ARRDC1-AS1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |breast cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289456 HSALNT0289456]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289456 HSALNG0071200]
| |
− | |FAM74A3
| |
− | |OTTHUMG00000067149
| |
− | |NA
| |
− | |pathogenic process
| |
− | |breast cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289834 HSALNT0289834]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289834 HSALNG0141949]
| |
− | |FH
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |Fumarase deficiency
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289961 HSALNT0289961]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289961 HSALNG0142076]
| |
− | |lnc-HOXC4-3:1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |breast cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289994 HSALNT0289994]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289994 HSALNG0142109]
| |
− | |lnc-TEAD4-1:1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |breast cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290270 HSALNT0290270]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290270 HSALNG0142385]
| |
− | |TCONS_00003876
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |breast cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289825 HSALNT0289825]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289825 HSALNG0141940]
| |
− | |EVI1
| |
− | |NA
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |hepatocellular cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290235 HSALNT0290235]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290235 HSALNG0142350]
| |
− | |SARCC
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |renal cell cancer
| |
− | |Male Urogenital Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290360 HSALNT0290360]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290360 HSALNG0142475]
| |
− | |ucoo2kmd.1
| |
− | |NA
| |
− | |ceRNA
| |
− | |pathogenic process
| |
− | |colorectal cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289015 HSALNT0289015]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289015 HSALNG0001020]
| |
− | |KAZN-AS1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |breast cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289722 HSALNT0289722]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289722 HSALNG0141837]
| |
− | |CTB-89H12.4
| |
− | |AC021078.1
| |
− | |ceRNA
| |
− | |pathogenic process
| |
− | |prostate cancer
| |
− | |Male Urogenital Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289496 HSALNT0289496]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289496 HSALNG0141607]
| |
− | |EPB41L4A-AS2
| |
− | |FLJ11235
| |
− | |NA
| |
− | |pathogenic process
| |
− | |lung cancer;breast cancer;kidney cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms;Respiratory Tract Diseases;Male Urogenital Diseases;Female Urogenital Diseases and Pregnancy Complications
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289146 HSALNT0289146]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289146 HSALNG0004554]
| |
− | |LINC02567
| |
− | |ENST00000427806
| |
− | |NA
| |
− | |pathogenic process
| |
− | |attention deficit hyperactivity disorder
| |
− | |Mental Disorders
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289833 HSALNT0289833]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289833 HSALNG0141948]
| |
− | |FGFR3-AS1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |osteosarcoma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289707 HSALNT0289707]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289707 HSALNG0141822]
| |
− | |CILinc01
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |osteoarthritis
| |
− | |Musculoskeletal Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289708 HSALNT0289708]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289708 HSALNG0141823]
| |
− | |CILinc02
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |osteoarthritis
| |
− | |Musculoskeletal Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0286597 HSALNT0286597]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0286597 HSALNG0140235]
| |
− | |LINC00629
| |
− | |LINC00629AB,LINC00629C,LINC00629D,LINC00629
| |
− | |NA
| |
− | |pathogenic process
| |
− | |choriocarcinoma
| |
− | |Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289665 HSALNT0289665]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289665 HSALNG0141780]
| |
− | |C2dat1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |ischemic brain injury
| |
− | |Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289217 HSALNT0289217]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289217 HSALNG0057357]
| |
− | |POU6F2-AS2
| |
− | |FLJ12971
| |
− | |protein localization
| |
− | |pathogenic process
| |
− | |oesophageal squamous cell cancer
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289946 HSALNT0289946]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289946 HSALNG0142061]
| |
− | |lnc13
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |celiac disease
| |
− | |Nutritional and Metabolic Diseases;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289729 HSALNT0289729]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289729 HSALNG0141844]
| |
− | |CTD903
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |colorectal cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290093 HSALNT0290093]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290093 HSALNG0142208]
| |
− | |NONHSAT104436
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |esophageal squamous cell cancer
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289550 HSALNT0289550]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289550 HSALNG0141665]
| |
− | |AC024560.2
| |
− | |AC024560.1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |cervical cancer
| |
− | |Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289483 HSALNT0289483]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289483 HSALNG0134219]
| |
− | |ENST00000436681
| |
− | |AP000552.1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |congenital heart defect
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289536 HSALNT0289536]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289536 HSALNG0141651]
| |
− | |AA584040
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |congenital heart defect
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289537 HSALNT0289537]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289537 HSALNG0141652]
| |
− | |AA709223
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |congenital heart defect
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289657 HSALNT0289657]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289657 HSALNG0141772]
| |
− | |BX478947
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |congenital heart defect
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0247515 HSALNT0247515]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0247515 HSALNG0119819]
| |
− | |LINC00668
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289719 HSALNT0289719]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289719 HSALNG0141834]
| |
− | |CRNDE-h
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |colorectal cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0142879 HSALNT0142879]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0142879 HSALNG0068121]
| |
− | |SMILR
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |vascular pathologies
| |
− | |Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290396 HSALNT0290396]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290396 HSALNG0142511]
| |
− | |Z38
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |breast cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0197213 HSALNT0197213]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0197213 HSALNG0095037]
| |
− | |LINC00507
| |
− | |NA
| |
− | |NA
| |
− | |developmental process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289086 HSALNT0289086]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289086 HSALNG0113270]
| |
− | |LINC01082
| |
− | |TCONSNA00024492
| |
− | |NA
| |
− | |pathogenic process
| |
− | |alveolar capillary dysplasia with misalignment of pulmonary veins
| |
− | |Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289094 HSALNT0289094]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289094 HSALNG0015253]
| |
− | |LINC01185
| |
− | |FLJ16341
| |
− | |NA
| |
− | |pathogenic process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290160 HSALNT0290160]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290160 HSALNG0142275]
| |
− | |PTPRD-AS1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |ovarian cancer
| |
− | |Endocrine System Diseases;Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290186 HSALNT0290186]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290186 HSALNG0142301]
| |
− | |RP11-254I22.1
| |
− | |MIR583HG
| |
− | |NA
| |
− | |pathogenic process
| |
− | |ovarian cancer
| |
− | |Endocrine System Diseases;Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290204 HSALNT0290204]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290204 HSALNG0142319]
| |
− | |RP11-57P19.1
| |
− | |AC009432.1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |ovarian cancer
| |
− | |Endocrine System Diseases;Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290211 HSALNT0290211]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290211 HSALNG0142326]
| |
− | |RP11-80H5.7
| |
− | |AL157400.4
| |
− | |NA
| |
− | |pathogenic process
| |
− | |ovarian cancer
| |
− | |Endocrine System Diseases;Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290215 HSALNT0290215]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290215 HSALNG0142330]
| |
− | |RP1-223E5.4
| |
− | |AL441883.1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |ovarian cancer
| |
− | |Endocrine System Diseases;Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290224 HSALNT0290224]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290224 HSALNG0142339]
| |
− | |RP4-799P18.3
| |
− | |AL122008.4
| |
− | |NA
| |
− | |pathogenic process
| |
− | |ovarian cancer
| |
− | |Endocrine System Diseases;Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289126 HSALNT0289126]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289126 HSALNG0045514]
| |
− | |LINC01844
| |
− | |LOC101926975
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hirschsprung disease
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289947 HSALNT0289947]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289947 HSALNG0142062]
| |
− | |Lnc34a
| |
− | |NA
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |colorectal cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289150 HSALNT0289150]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289150 HSALNG0075977]
| |
− | |LINP1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |breast cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289951 HSALNT0289951]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289951 HSALNG0142066]
| |
− | |lncARSR
| |
− | |NA
| |
− | |ceRNA
| |
− | |pathogenic process
| |
− | |renal cell cancer
| |
− | |Male Urogenital Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289392 HSALNT0289392]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289392 HSALNG0005967]
| |
− | |RBM15-AS1
| |
− | |AS-RBM15
| |
− | |translational control
| |
− | |pathogenic process
| |
− | |acute megakaryocytic leukemia
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290089 HSALNT0290089]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290089 HSALNG0142204]
| |
− | |NONHSAT073641
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |vascular diseases
| |
− | |Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290027 HSALNT0290027]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290027 HSALNG0142142]
| |
− | |LOC572558
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |bladder cancer
| |
− | |Male Urogenital Diseases;Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289582 HSALNT0289582]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289582 HSALNG0141697]
| |
− | |AK033210
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process;developmental process
| |
− | |bronchopulmonary dysplasia
| |
− | |Respiratory Tract Diseases;Congenital, Hereditary, and Neonatal Diseases and Abnormalities
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289848 HSALNT0289848]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289848 HSALNG0141963]
| |
− | |GClnc1
| |
− | |NA
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |gastric cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289572 HSALNT0289572]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289572 HSALNG0141687]
| |
− | |AK021630
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |Parkinson's disease
| |
− | |Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289603 HSALNT0289603]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289603 HSALNG0141718]
| |
− | |AL049437
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |Parkinson's disease
| |
− | |Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290007 HSALNT0290007]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290007 HSALNG0142122]
| |
− | |LOC100507661
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |thyroid cancer
| |
− | |Endocrine System Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289084 HSALNT0289084]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289084 HSALNG0122663]
| |
− | |LINC01029
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |cognitive functions and neuronal plasticity
| |
− | |Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290169 HSALNT0290169]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290169 HSALNG0142284]
| |
− | |RMEL3
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |melanoma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289959 HSALNT0289959]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289959 HSALNG0142074]
| |
− | |lnc-FRG2C-3
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |ankylosing spondylitis
| |
− | |Musculoskeletal Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289966 HSALNT0289966]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289966 HSALNG0142081]
| |
− | |lnc-LIN54-1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |ankylosing spondylitis
| |
− | |Musculoskeletal Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289997 HSALNT0289997]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289997 HSALNG0142112]
| |
− | |lnc-USP50-2
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |ankylosing spondylitis
| |
− | |Musculoskeletal Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290000 HSALNT0290000]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290000 HSALNG0142115]
| |
− | |lnc-ZNF354A-1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |ankylosing spondylitis
| |
− | |Musculoskeletal Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288949 HSALNT0288949]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288949 HSALNG0017887]
| |
− | |ENST00000455309
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |primary Sjögren's syndrome
| |
− | |Immune System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289920 HSALNT0289920]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289920 HSALNG0142035]
| |
− | |LINC02384
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |primary Sjögren's syndrome
| |
− | |Immune System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289998 HSALNT0289998]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289998 HSALNG0142113]
| |
− | |Lnc-UTS2D-1:1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |primary Sjögren's syndrome
| |
− | |Immune System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290067 HSALNT0290067]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290067 HSALNG0142182]
| |
− | |n336161
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |primary Sjögren's syndrome
| |
− | |Immune System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290069 HSALNT0290069]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290069 HSALNG0142184]
| |
− | |n340599
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |primary Sjögren's syndrome
| |
− | |Immune System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290099 HSALNT0290099]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290099 HSALNG0142214]
| |
− | |NR_002712
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |primary Sjögren's syndrome
| |
− | |Immune System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290290 HSALNT0290290]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290290 HSALNG0142405]
| |
− | |TCONS_l2_00014794
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |primary Sjögren's syndrome
| |
− | |Immune System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290170 HSALNT0290170]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290170 HSALNG0142285]
| |
− | |RMRP
| |
− | |CHH,NME1R,RRP2,RMRP
| |
− | |ceRNA
| |
− | |pathogenic process
| |
− | |gastric cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289900 HSALNT0289900]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289900 HSALNG0142015]
| |
− | |LINC00961
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |ovarian cancer
| |
− | |Endocrine System Diseases;Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289077 HSALNT0289077]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289077 HSALNG0068551]
| |
− | |LINC00977
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |primary spontaneous pneumothorax
| |
− | |Respiratory Tract Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289560 HSALNT0289560]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289560 HSALNG0141675]
| |
− | |AF085995
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |lung cancer
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289566 HSALNT0289566]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289566 HSALNG0141681]
| |
− | |AK000053
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |lung cancer
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289571 HSALNT0289571]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289571 HSALNG0141686]
| |
− | |AK021595
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |lung cancer
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289574 HSALNT0289574]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289574 HSALNG0141689]
| |
− | |AK022024
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |lung cancer
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289595 HSALNT0289595]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289595 HSALNG0141710]
| |
− | |AK124307
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |lung cancer
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289639 HSALNT0289639]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289639 HSALNG0141754]
| |
− | |BC020384
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |lung cancer
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289642 HSALNT0289642]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289642 HSALNG0141757]
| |
− | |BC030759
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |lung cancer
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289715 HSALNT0289715]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289715 HSALNG0141830]
| |
− | |CR615992
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |lung cancer
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289954 HSALNT0289954]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289954 HSALNG0142069]
| |
− | |lnc-CC3
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |cervical cancer
| |
− | |Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289614 HSALNT0289614]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289614 HSALNG0141729]
| |
− | |APOC1P1-3
| |
− | |NA
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |breast cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290365 HSALNT0290365]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290365 HSALNG0142480]
| |
− | |UNMIBC
| |
− | |NA
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |bladder cancer
| |
− | |Male Urogenital Diseases;Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290323 HSALNT0290323]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290323 HSALNG0142438]
| |
− | |uc.167
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |ventricular septal defects
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290212 HSALNT0290212]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290212 HSALNG0142327]
| |
− | |RP11-838N2.4
| |
− | |GAPLINC
| |
− | |ceRNA
| |
− | |pathogenic process
| |
− | |glioblastoma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289109 HSALNT0289109]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289109 HSALNG0121223]
| |
− | |LINC01478
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |blood pressure
| |
− | |Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289313 HSALNT0289313]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289313 HSALNG0016990]
| |
− | |LINC00342
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |non-small cell lung cancer
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289677 HSALNT0289677]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289677 HSALNG0141792]
| |
− | |CAR10
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |lung cancer
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289365 HSALNT0289365]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289365 HSALNG0141638]
| |
− | |MAPT-AS1
| |
− | |NA
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |Parkinson's disease
| |
− | |Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289679 HSALNT0289679]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289679 HSALNG0141794]
| |
− | |CAT104
| |
− | |NA
| |
− | |ceRNA
| |
− | |pathogenic process
| |
− | |breast cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290260 HSALNT0290260]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290260 HSALNG0142375]
| |
− | |STXBP5-AS1
| |
− | |NA
| |
− | |ceRNA
| |
− | |pathogenic process
| |
− | |breast cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289861 HSALNT0289861]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289861 HSALNG0141976]
| |
− | |HAR1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |Huntington disease
| |
− | |Mental Disorders;Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290359 HSALNT0290359]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290359 HSALNG0142474]
| |
− | |UCHL1-AS1
| |
− | |NA
| |
− | |translational control
| |
− | |pathogenic process
| |
− | |Parkinson's disease
| |
− | |Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290238 HSALNT0290238]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290238 HSALNG0142353]
| |
− | |SCAANT1-AS
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |spinocerebellar ataxia
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289648 HSALNT0289648]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289648 HSALNG0141763]
| |
− | |BC041488
| |
− | |NA
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |bladder cancer
| |
− | |Male Urogenital Diseases;Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290188 HSALNT0290188]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290188 HSALNG0142303]
| |
− | |RP11-359E19.2
| |
− | |AC022733.1
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |bladder cancer
| |
− | |Male Urogenital Diseases;Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289669 HSALNT0289669]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289669 HSALNG0141784]
| |
− | |C6orf176-TV1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |non-small cell lung cancer
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289670 HSALNT0289670]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289670 HSALNG0141785]
| |
− | |C6orf176-TV2
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |non-small cell lung cancer
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289851 HSALNT0289851]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289851 HSALNG0141966]
| |
− | |GIHCG
| |
− | |NA
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |hepatocellular cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289649 HSALNT0289649]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289649 HSALNG0141764]
| |
− | |BC087858
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |non-small cell lung cancer
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290353 HSALNT0290353]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290353 HSALNG0142468]
| |
− | |uc004cov.4
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hypertrophic cardiomyopathy
| |
− | |Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290357 HSALNT0290357]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290357 HSALNG0142472]
| |
− | |uc022bqu.1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hypertrophic cardiomyopathy
| |
− | |Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0127837 HSALNT0127837]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0127837 HSALNG0060796]
| |
− | |CFTR-AS1
| |
− | |BGas
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |cystic fibrosis
| |
− | |Respiratory Tract Diseases;Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0046367 HSALNT0046367]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0046367 HSALNG0021858]
| |
− | |MYOSLID
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |vascular smooth muscle cell (VSMC) contractile phenotype
| |
− | |Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290331 HSALNT0290331]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290331 HSALNG0142446]
| |
− | |uc.63
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |breast cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290106 HSALNT0290106]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290106 HSALNG0142221]
| |
− | |numb
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |uveal melanoma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289847 HSALNT0289847]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289847 HSALNG0141962]
| |
− | |GCASPC
| |
− | |TCONS_00011605,RP1-56L9.7-001,lnc-SOD2-1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gallbladder cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289568 HSALNT0289568]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289568 HSALNG0141683]
| |
− | |AK001094
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289588 HSALNT0289588]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289588 HSALNG0141703]
| |
− | |AK093735
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289631 HSALNT0289631]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289631 HSALNG0141746]
| |
− | |BC003519
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290100 HSALNT0290100]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290100 HSALNG0142215]
| |
− | |NR_003573
| |
− | |ANXA2P2
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290119 HSALNT0290119]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290119 HSALNG0142234]
| |
− | |P2RX7-V3
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |uveal melanoma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290308 HSALNT0290308]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290308 HSALNG0142423]
| |
− | |TMSB4
| |
− | |NA
| |
− | |ceRNA
| |
− | |pathogenic process
| |
− | |osteoarthritis
| |
− | |Musculoskeletal Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288928 HSALNT0288928]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288928 HSALNG0090163]
| |
− | |DDX11-AS1
| |
− | |CONCR
| |
− | |NA
| |
− | |pathogenic process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290052 HSALNT0290052]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290052 HSALNG0142167]
| |
− | |MELOE
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |melanoma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290231 HSALNT0290231]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290231 HSALNG0142346]
| |
− | |RSU1P2
| |
− | |RSU1P2
| |
− | |ceRNA
| |
− | |pathogenic process
| |
− | |cervical cancer
| |
− | |Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290165 HSALNT0290165]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290165 HSALNG0142280]
| |
− | |RBMY2FP
| |
− | |RBMY2FP
| |
− | |NA
| |
− | |NA
| |
− | |hepatocellular cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290071 HSALNT0290071]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290071 HSALNG0142186]
| |
− | |n375709
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |nasopharyngeal cancer
| |
− | |Otorhinolaryngologic Diseases;Neoplasms;Stomatognathic Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289748 HSALNT0289748]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289748 HSALNG0141863]
| |
− | |DUXAP8
| |
− | |DUXAP8
| |
− | |NA
| |
− | |NA
| |
− | |gastric cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290030 HSALNT0290030]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290030 HSALNG0142145]
| |
− | |LOC729966
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |papillary thyroid cancer
| |
− | |Endocrine System Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290143 HSALNT0290143]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290143 HSALNG0142258]
| |
− | |POIR
| |
− | |NA
| |
− | |ceRNA
| |
− | |pathogenic process
| |
− | |periodontitis
| |
− | |Stomatognathic Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0067481 HSALNT0067481]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0067481 HSALNG0031988]
| |
− | |MELTF-AS1
| |
− | |MFI2-AS1,AC068302.3
| |
− | |NA
| |
− | |pathogenic process
| |
− | |osteosarcoma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290053 HSALNT0290053]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290053 HSALNG0142168]
| |
− | |MFI2
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |osteosarcoma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289922 HSALNT0289922]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289922 HSALNG0142037]
| |
− | |linc-223
| |
− | |NA
| |
− | |ceRNA
| |
− | |pathogenic process
| |
− | |acute myeloid leukemia
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0014603 HSALNT0014603]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0014603 HSALNG0006859]
| |
− | |LINC01138
| |
− | |LINC00875,FLJ39739
| |
− | |NA
| |
− | |pathogenic process
| |
− | |prostate cancer
| |
− | |Male Urogenital Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290262 HSALNT0290262]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290262 HSALNG0142377]
| |
− | |SUZ12P1
| |
− | |SUZ12P1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |prostate cancer
| |
− | |Male Urogenital Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290005 HSALNT0290005]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290005 HSALNG0142120]
| |
− | |LOC100505976
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |laryngeal squamous cell cancer
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290392 HSALNT0290392]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290392 HSALNG0142507]
| |
− | |XLOC_l2_010636
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |laryngeal squamous cell cancer
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0090295 HSALNT0090295]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0090295 HSALNG0043014]
| |
− | |RASGRF2-AS1
| |
− | |CTC-459I6.1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |sepsis-induced endothelial dysfunction
| |
− | |Bacterial Infections and Mycoses
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289852 HSALNT0289852]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289852 HSALNG0141967]
| |
− | |GPC3-AS1
| |
− | |NA
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |hepatocellular cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0189472 HSALNT0189472]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0189472 HSALNG0091321]
| |
− | |HOXC-AS1
| |
− | |NA
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |atherosclerosis
| |
− | |Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289157 HSALNT0289157]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289157 HSALNG0057557]
| |
− | |LUARIS
| |
− | |lncRNA#32
| |
− | |transcriptional regulation
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289371 HSALNT0289371]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289371 HSALNG0044828]
| |
− | |MIR3936HG
| |
− | |LOC553103,SLC22A5-AS1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cancer;nasopharyngeal cancer
| |
− | |Otorhinolaryngologic Diseases;Stomatognathic Diseases;Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290148 HSALNT0290148]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290148 HSALNG0142263]
| |
− | |Ppp1r1b
| |
− | |NA
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |congenital heart defect
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289038 HSALNT0289038]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289038 HSALNG0099182]
| |
− | |LINC00460
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |colorectal cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290194 HSALNT0290194]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290194 HSALNG0142309]
| |
− | |RP1-13P20.6
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |colorectal cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290364 HSALNT0290364]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290364 HSALNG0142479]
| |
− | |Unigene56159
| |
− | |NA
| |
− | |ceRNA
| |
− | |pathogenic process
| |
− | |hepatocellular cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290355 HSALNT0290355]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290355 HSALNG0142470]
| |
− | |uc009yby.1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |renal cell cancer
| |
− | |Male Urogenital Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289406 HSALNT0289406]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289406 HSALNG0048011]
| |
− | |TFAP2A-AS2
| |
− | |HIPSTR
| |
− | |NA
| |
− | |developmental process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289704 HSALNT0289704]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289704 HSALNG0141819]
| |
− | |Chaer
| |
− | |NA
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |cardiac hypertrophy
| |
− | |Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289865 HSALNT0289865]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289865 HSALNG0141980]
| |
− | |HIF-2α
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0211378 HSALNT0211378]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0211378 HSALNG0101489]
| |
− | |LINC00520
| |
− | |C14orf34
| |
− | |NA
| |
− | |pathogenic process
| |
− | |breast cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0087374 HSALNT0087374]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0087374 HSALNG0041561]
| |
− | |MRPS30-DT
| |
− | |BRCAT54
| |
− | |NA
| |
− | |pathogenic process
| |
− | |breast cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289388 HSALNT0289388]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289388 HSALNG0092662]
| |
− | |PPP1R12A-AS1
| |
− | |R12A-AS1
| |
− | |translational control
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289013 HSALNT0289013]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289013 HSALNG0088600]
| |
− | |ITFG2-AS1
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290088 HSALNT0290088]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290088 HSALNG0142203]
| |
− | |NONHSAT041499
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |schizophrenia
| |
− | |Mental Disorders
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290091 HSALNT0290091]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290091 HSALNG0142206]
| |
− | |NONHSAT089447
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |schizophrenia
| |
− | |Mental Disorders
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289970 HSALNT0289970]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289970 HSALNG0142085]
| |
− | |lnc-NKX2-3-1
| |
− | |NA
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |acute lymphoblastic leukemia
| |
− | |Immune System Diseases;Neoplasms;Hemic and Lymphatic Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289989 HSALNT0289989]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289989 HSALNG0142104]
| |
− | |lnc-RTN4R-1
| |
− | |NA
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |acute lymphoblastic leukemia
| |
− | |Immune System Diseases;Neoplasms;Hemic and Lymphatic Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289821 HSALNT0289821]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289821 HSALNG0141936]
| |
− | |ERL
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |Marek's disease
| |
− | |Immune System Diseases;Hemic and Lymphatic Diseases;Virus Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0192459 HSALNT0192459]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0192459 HSALNG0092867]
| |
− | |LINC02258
| |
− | |RP11-248E9.5
| |
− | |NA
| |
− | |pathogenic process
| |
− | |pneumonia
| |
− | |Respiratory Tract Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0241871 HSALNT0241871]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0241871 HSALNG0117085]
| |
− | |SKAP1-AS1
| |
− | |RP11-456D7.1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |pneumonia
| |
− | |Respiratory Tract Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289439 HSALNT0289439]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289439 HSALNG0049760]
| |
− | |DINOL
| |
− | |DINO
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288901 HSALNT0288901]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288901 HSALNG0000547]
| |
− | |CAMTA1-DT
| |
− | |lncCAMTA1
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |liver cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290328 HSALNT0290328]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290328 HSALNG0142443]
| |
− | |uc.345
| |
− | |NA
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |pancreatic cancer
| |
− | |Endocrine System Diseases;Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290060 HSALNT0290060]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290060 HSALNG0142175]
| |
− | |MSNP1AS
| |
− | |NA
| |
− | |translational control
| |
− | |pathogenic process
| |
− | |autism spectrum disorder
| |
− | |Mental Disorders
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289376 HSALNT0289376]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289376 HSALNG0004596]
| |
− | |NEXN-AS1
| |
− | |C1orf118,FLJ90637
| |
− | |NA
| |
− | |pathogenic process
| |
− | |lung cancer
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0183194 HSALNT0183194]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0183194 HSALNG0088083]
| |
− | |LINC02098
| |
− | |RP11-702B10.1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |esophageal cancer
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0198055 HSALNT0198055]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0198055 HSALNG0095473]
| |
− | |PSPC1-AS2
| |
− | |RP11-523H24.3
| |
− | |NA
| |
− | |pathogenic process
| |
− | |esophageal cancer
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289155 HSALNT0289155]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289155 HSALNG0114857]
| |
− | |LRRC75A-AS1
| |
− | |C17orf45,NCRNA00188,C17orf76-AS1,FAM211A-AS1,MGC40157
| |
− | |NA
| |
− | |pathogenic process
| |
− | |rheumatoid arthritis
| |
− | |Immune System Diseases;Musculoskeletal Diseases;Skin and Connective Tissue Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289220 HSALNT0289220]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289220 HSALNG0077999]
| |
− | |PRKG1-AS1
| |
− | |RP11-573I11.2
| |
− | |NA
| |
− | |pathogenic process
| |
− | |rheumatoid arthritis
| |
− | |Immune System Diseases;Musculoskeletal Diseases;Skin and Connective Tissue Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289262 HSALNT0289262]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289262 HSALNG0076970]
| |
− | |SVIL-AS1
| |
− | |RP11-534G20.3
| |
− | |NA
| |
− | |pathogenic process
| |
− | |rheumatoid arthritis
| |
− | |Immune System Diseases;Musculoskeletal Diseases;Skin and Connective Tissue Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289281 HSALNT0289281]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289281 HSALNG0108169]
| |
− | |VPS33B-DT
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |rheumatoid arthritis
| |
− | |Immune System Diseases;Musculoskeletal Diseases;Skin and Connective Tissue Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289804 HSALNT0289804]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289804 HSALNG0141919]
| |
− | |ENST00000438399
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |rheumatoid arthritis
| |
− | |Immune System Diseases;Musculoskeletal Diseases;Skin and Connective Tissue Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290228 HSALNT0290228]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290228 HSALNG0142343]
| |
− | |RPKG1-AS1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |rheumatoid arthritis
| |
− | |Immune System Diseases;Musculoskeletal Diseases;Skin and Connective Tissue Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290350 HSALNT0290350]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290350 HSALNG0142465]
| |
− | |uc004afb.1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |rheumatoid arthritis
| |
− | |Immune System Diseases;Musculoskeletal Diseases;Skin and Connective Tissue Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289398 HSALNT0289398]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289398 HSALNG0135015]
| |
− | |SLC5A4-AS1
| |
− | |RP1-90G24.10
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289411 HSALNT0289411]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289411 HSALNG0063964]
| |
− | |TNFRSF10A-AS1
| |
− | |RP11-1149O23.2
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289727 HSALNT0289727]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289727 HSALNG0141842]
| |
− | |CTD-2616J11.14
| |
− | |AC008750.7
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290182 HSALNT0290182]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290182 HSALNG0142297]
| |
− | |RP11-150O12.3
| |
− | |AC124067.4
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289730 HSALNT0289730]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289730 HSALNG0141845]
| |
− | |CXCL1P1
| |
− | |CXCL1P1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatocellular cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289803 HSALNT0289803]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289803 HSALNG0141918]
| |
− | |ENST00000438347
| |
− | |CCND3P1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatocellular cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289897 HSALNT0289897]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289897 HSALNG0142012]
| |
− | |LINC00601
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatocellular cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289503 HSALNT0289503]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289503 HSALNG0141614]
| |
− | |KIAA0087
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |endometrial cancer
| |
− | |Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289827 HSALNT0289827]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289827 HSALNG0141942]
| |
− | |FAM212B-AS1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |endometrial cancer
| |
− | |Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290010 HSALNT0290010]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290010 HSALNG0142125]
| |
− | |LOC102723552
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |endometrial cancer
| |
− | |Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290181 HSALNT0290181]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290181 HSALNG0142296]
| |
− | |RP11-140I24
| |
− | |LINC01568
| |
− | |NA
| |
− | |pathogenic process
| |
− | |endometrial cancer
| |
− | |Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290201 HSALNT0290201]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290201 HSALNG0142316]
| |
− | |RP11-501O2
| |
− | |LINC02046
| |
− | |NA
| |
− | |pathogenic process
| |
− | |endometrial cancer
| |
− | |Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290206 HSALNT0290206]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290206 HSALNG0142321]
| |
− | |RP11-600K151
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |endometrial cancer
| |
− | |Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290084 HSALNT0290084]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290084 HSALNG0142199]
| |
− | |NONHSAG051968
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |papillary thyroid cancer
| |
− | |Endocrine System Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290090 HSALNT0290090]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290090 HSALNG0142205]
| |
− | |NONHSAT076747
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |papillary thyroid cancer
| |
− | |Endocrine System Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290094 HSALNT0290094]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290094 HSALNG0142209]
| |
− | |NONHSAT122730
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |papillary thyroid cancer
| |
− | |Endocrine System Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0138768 HSALNT0138768]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0138768 HSALNG0066240]
| |
− | |MIR2052HG
| |
− | |NA
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |breast cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289096 HSALNT0289096]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289096 HSALNG0096884]
| |
− | |LINC01198
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |glioma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289274 HSALNT0289274]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289274 HSALNG0096821]
| |
− | |TPT1-AS1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |glioma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289924 HSALNT0289924]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289924 HSALNG0142039]
| |
− | |linc-cdh4-2
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatocellular cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0144641 HSALNT0144641]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0144641 HSALNG0068878]
| |
− | |LINC02055
| |
− | |RP1130-1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatocellular cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289737 HSALNT0289737]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289737 HSALNG0141852]
| |
− | |DBCCR1
| |
− | |NA
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |bladder cancer
| |
− | |Male Urogenital Diseases;Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289547 HSALNT0289547]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289547 HSALNG0141662]
| |
− | |AC012065.7
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |chronic lymphocytic leukemia
| |
− | |Immune System Diseases;Neoplasms;Hemic and Lymphatic Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289229 HSALNT0289229]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289229 HSALNG0116565]
| |
− | |RAMP2-AS1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |glioblastoma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289591 HSALNT0289591]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289591 HSALNG0141706]
| |
− | |AK098081
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |colorectal cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289644 HSALNT0289644]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289644 HSALNG0141759]
| |
− | |BC037331
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |colorectal cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289646 HSALNT0289646]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289646 HSALNG0141761]
| |
− | |BC040303
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |colorectal cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289717 HSALNT0289717]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289717 HSALNG0141832]
| |
− | |CR749831
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |colorectal cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289250 HSALNT0289250]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289250 HSALNG0040073]
| |
− | |SNHG18
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |glioma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0106140 HSALNT0106140]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0106140 HSALNG0050030]
| |
− | |FOXP4-AS1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |colorectal cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0026202 HSALNT0026202]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0026202 HSALNG0012584]
| |
− | |RNASEH1-AS1
| |
− | |LOC100506054
| |
− | |NA
| |
− | |pathogenic process
| |
− | |colorectal cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288993 HSALNT0288993]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288993 HSALNG0088026]
| |
− | |GSEC
| |
− | |ST3GAL4-AS1,DCPS-AS1,FLJ39051
| |
− | |NA
| |
− | |pathogenic process
| |
− | |colorectal cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0060264 HSALNT0060264]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0060264 HSALNG0028799]
| |
− | |DNAJB8-AS1
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0248137 HSALNT0248137]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0248137 HSALNG0120059]
| |
− | |CHMP1B-AS1
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0021970 HSALNT0021970]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0021970 HSALNG0010602]
| |
− | |TGFB2-AS1
| |
− | |NR_046268
| |
− | |NA
| |
− | |pathogenic process
| |
− | |early-onset preeclampsia
| |
− | |Female Urogenital Diseases and Pregnancy Complications
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0078323 HSALNT0078323]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0078323 HSALNG0037356]
| |
− | |SLC7A11-AS1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |early-onset preeclampsia
| |
− | |Female Urogenital Diseases and Pregnancy Complications
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0134663 HSALNT0134663]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0134663 HSALNG0064248]
| |
− | |INTS9-AS1
| |
− | |ENST00000520055
| |
− | |NA
| |
− | |pathogenic process
| |
− | |early-onset preeclampsia
| |
− | |Female Urogenital Diseases and Pregnancy Complications
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0231572 HSALNT0231572]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0231572 HSALNG0111641]
| |
− | |MMP2-AS1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |early-onset preeclampsia
| |
− | |Female Urogenital Diseases and Pregnancy Complications
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0267869 HSALNT0267869]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0267869 HSALNG0130456]
| |
− | |SLC12A5-AS1
| |
− | |RP11-465L10.10
| |
− | |NA
| |
− | |pathogenic process
| |
− | |early-onset preeclampsia
| |
− | |Female Urogenital Diseases and Pregnancy Complications
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288921 HSALNT0288921]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288921 HSALNG0002415]
| |
− | |CSMD2-AS1
| |
− | |ENST00000434181
| |
− | |NA
| |
− | |pathogenic process
| |
− | |early-onset preeclampsia
| |
− | |Female Urogenital Diseases and Pregnancy Complications
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288997 HSALNT0288997]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288997 HSALNG0052934]
| |
− | |HDAC2-AS2
| |
− | |ENST00000421891
| |
− | |NA
| |
− | |pathogenic process
| |
− | |early-onset preeclampsia
| |
− | |Female Urogenital Diseases and Pregnancy Complications
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289012 HSALNT0289012]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289012 HSALNG0105327]
| |
− | |INO80-AS1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |early-onset preeclampsia
| |
− | |Female Urogenital Diseases and Pregnancy Complications
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289140 HSALNT0289140]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289140 HSALNG0075065]
| |
− | |LINC02247
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |early-onset preeclampsia
| |
− | |Female Urogenital Diseases and Pregnancy Complications
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289161 HSALNT0289161]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289161 HSALNG0059170]
| |
− | |MAGI2-AS3
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |early-onset preeclampsia
| |
− | |Female Urogenital Diseases and Pregnancy Complications
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289188 HSALNT0289188]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289188 HSALNG0062699]
| |
− | |MNX1-AS2
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |early-onset preeclampsia
| |
− | |Female Urogenital Diseases and Pregnancy Complications
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289245 HSALNT0289245]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289245 HSALNG0140277]
| |
− | |SMIM10L2B-AS1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |early-onset preeclampsia
| |
− | |Female Urogenital Diseases and Pregnancy Complications
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289407 HSALNT0289407]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289407 HSALNG0102543]
| |
− | |TGFB3-AS1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |early-onset preeclampsia
| |
− | |Female Urogenital Diseases and Pregnancy Complications
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289457 HSALNT0289457]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289457 HSALNG0073036]
| |
− | |HSD17B3-AS1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |early-onset preeclampsia
| |
− | |Female Urogenital Diseases and Pregnancy Complications
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289919 HSALNT0289919]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289919 HSALNG0142034]
| |
− | |LINC02246
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |early-onset preeclampsia
| |
− | |Female Urogenital Diseases and Pregnancy Complications
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289288 HSALNT0289288]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289288 HSALNG0100050]
| |
− | |ZNF710-AS1
| |
− | |ENST00000558334
| |
− | |NA
| |
− | |pathogenic process
| |
− | |early-onset preeclampsia
| |
− | |Female Urogenital Diseases and Pregnancy Complications
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289266 HSALNT0289266]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289266 HSALNG0007188]
| |
− | |TDRKH-AS1
| |
− | |RP11-98D18.9
| |
− | |NA
| |
− | |pathogenic process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289128 HSALNT0289128]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289128 HSALNG0057684]
| |
− | |LINC01952
| |
− | |AC004854.4
| |
− | |NA
| |
− | |pathogenic process
| |
− | |recurrent miscarriage
| |
− | |Female Urogenital Diseases and Pregnancy Complications
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290075 HSALNT0290075]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290075 HSALNG0142190]
| |
− | |NCF4-AS1
| |
− | |CTA-833B7.2
| |
− | |NA
| |
− | |pathogenic process
| |
− | |recurrent miscarriage
| |
− | |Female Urogenital Diseases and Pregnancy Complications
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289360 HSALNT0289360]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289360 HSALNG0029603]
| |
− | |LNCSRLR
| |
− | |lncRNA-SRLR
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |renal cell cancer
| |
− | |Male Urogenital Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288918 HSALNT0288918]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288918 HSALNG0021529]
| |
− | |CFLAR-AS1
| |
− | |ALS2CR10
| |
− | |NA
| |
− | |pathogenic process
| |
− | |esophageal squamous cell cancer
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289710 HSALNT0289710]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289710 HSALNG0141825]
| |
− | |COL1A2-AS1
| |
− | |TCONS_00013888,lncRNA8975-1
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |hypertrophic scar
| |
− | |Skin and Connective Tissue Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0075075 HSALNT0075075]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0075075 HSALNG0035847]
| |
− | |LNCPRESS2
| |
− | |lncPRESS2
| |
− | |transcriptional regulation
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0011289 HSALNT0011289]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0011289 HSALNG0005432]
| |
− | |LINC01930
| |
− | |EU358092
| |
− | |NA
| |
− | |pathogenic process
| |
− | |schizophrenia
| |
− | |Mental Disorders
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0097120 HSALNT0097120]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0097120 HSALNG0046325]
| |
− | |HMMR-AS1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |basal-like breast cancer
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0184498 HSALNT0184498]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0184498 HSALNG0088703]
| |
− | |CCND2-AS1
| |
− | |CCND2-AS2
| |
− | |NA
| |
− | |pathogenic process
| |
− | |glioma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289045 HSALNT0289045]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289045 HSALNG0030884]
| |
− | |LINC00578
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |major depression disorder
| |
− | |Behavior and Behavior Mechanisms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288884 HSALNT0288884]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288884 HSALNG0026576]
| |
− | |ADAMTS9-AS1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |epithelial ovarian cancer
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0080041 HSALNT0080041]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0080041 HSALNG0038152]
| |
− | |FAM198B-AS1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0103007 HSALNT0103007]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0103007 HSALNG0048820]
| |
− | |LINC00240
| |
− | |C6orf41,NCRNA00240,bA373D17.1
| |
− | |ceRNA
| |
− | |pathogenic process
| |
− | |esophageal squamous cell cancer
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289071 HSALNT0289071]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289071 HSALNG0122453]
| |
− | |LINC00909
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289509 HSALNT0289509]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289509 HSALNG0141620]
| |
− | |LINC00680
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0129070 HSALNT0129070]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0129070 HSALNG0061394]
| |
− | |LINC00513
| |
− | |AC016831.7
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289129 HSALNT0289129]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289129 HSALNG0115960]
| |
− | |LINC02001
| |
− | |RP11-1094M14.11
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289215 HSALNT0289215]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289215 HSALNG0092950]
| |
− | |POC1B-AS1
| |
− | |RP11-734K2.4
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289241 HSALNT0289241]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289241 HSALNG0060049]
| |
− | |SLC12A9-AS1
| |
− | |RP11-126L15.4
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289275 HSALNT0289275]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289275 HSALNG0050617]
| |
− | |TRAM2-AS1
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0002243 HSALNT0002243]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0002243 HSALNG0001176]
| |
− | |LINC01772
| |
− | |ENSG00000226029
| |
− | |ceRNA
| |
− | |pathogenic process
| |
− | |oesophageal cancer
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288941 HSALNT0288941]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288941 HSALNG0009693]
| |
− | |ELF3-AS1
| |
− | |ENST00000415582
| |
− | |NA
| |
− | |pathogenic process
| |
− | |papillary thyroid cancer
| |
− | |Endocrine System Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289134 HSALNT0289134]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289134 HSALNG0025450]
| |
− | |LINC02158
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |breast cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289350 HSALNT0289350]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289350 HSALNG0133329]
| |
− | |LINC01671
| |
− | |BC041455
| |
− | |NA
| |
− | |pathogenic process
| |
− | |breast cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289124 HSALNT0289124]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289124 HSALNG0132343]
| |
− | |LINC01684
| |
− | |lnc-JAM2-6
| |
− | |NA
| |
− | |pathogenic process
| |
− | |nonalcoholic fatty liver disease
| |
− | |Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289036 HSALNT0289036]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289036 HSALNG0096092]
| |
− | |LINC00365
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |esophageal cancer
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289111 HSALNT0289111]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289111 HSALNG0043625]
| |
− | |LINC01554
| |
− | |C5orf27,FLJ38821,FIS
| |
− | |NA
| |
− | |pathogenic process
| |
− | |esophageal cancer
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289132 HSALNT0289132]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289132 HSALNG0136701]
| |
− | |LINC02154
| |
− | |GS1-600G8.5
| |
− | |NA
| |
− | |pathogenic process
| |
− | |esophageal cancer
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0137721 HSALNT0137721]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0137721 HSALNG0065704]
| |
− | |LINC02155
| |
− | |RP11-705O24.1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |esophageal cancer
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0225363 HSALNT0225363]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0225363 HSALNG0108398]
| |
− | |LINC02157
| |
− | |RP11-327J17.1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |esophageal cancer
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289133 HSALNT0289133]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289133 HSALNG0090758]
| |
− | |LINC02156
| |
− | |RP1-90J4.1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |esophageal cancer
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0133924 HSALNT0133924]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0133924 HSALNG0063832]
| |
− | |LINC02153
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |major depression disorder
| |
− | |Behavior and Behavior Mechanisms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0181656 HSALNT0181656]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0181656 HSALNG0087394]
| |
− | |LINC02151
| |
− | |TCONS_00019174
| |
− | |NA
| |
− | |pathogenic process
| |
− | |major depression disorder
| |
− | |Behavior and Behavior Mechanisms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0227367 HSALNT0227367]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0227367 HSALNG0109385]
| |
− | |LINC02152
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |major depression disorder
| |
− | |Behavior and Behavior Mechanisms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0029246 HSALNT0029246]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0029246 HSALNG0013844]
| |
− | |BRE-AS1
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289251 HSALNT0289251]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289251 HSALNG0056623]
| |
− | |SNHG26
| |
− | |AC005682.5
| |
− | |NA
| |
− | |pathogenic process
| |
− | |bladder urothelial cancer
| |
− | |Male Urogenital Diseases;Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0252719 HSALNT0252719]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0252719 HSALNG0122284]
| |
− | |LIVAR
| |
− | |lnc18q22.2
| |
− | |NA
| |
− | |pathogenic process
| |
− | |nonalcoholic steatohepatiti
| |
− | |Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289074 HSALNT0289074]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289074 HSALNG0031832]
| |
− | |LINC00969
| |
− | |ENST00000453324
| |
− | |NA
| |
− | |pathogenic process
| |
− | |lung squamous cell cancer
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289138 HSALNT0289138]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289138 HSALNG0140259]
| |
− | |LINC02243
| |
− | |ENST00000441841
| |
− | |NA
| |
− | |pathogenic process
| |
− | |lung squamous cell cancer
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289399 HSALNT0289399]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289399 HSALNG0039449]
| |
− | |SLC9A3-AS1
| |
− | |UC011CLY.2
| |
− | |NA
| |
− | |pathogenic process
| |
− | |lung squamous cell cancer
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288934 HSALNT0288934]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288934 HSALNG0126602]
| |
− | |DM1-AS
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |myotonic dystrophy type 1
| |
− | |Musculoskeletal Diseases;Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0009014 HSALNT0009014]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0009014 HSALNG0004475]
| |
− | |LINC02238
| |
− | |RP4-788P17.1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |B cell lymphoma
| |
− | |Immune System Diseases;Neoplasms;Hemic and Lymphatic Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289163 HSALNT0289163]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289163 HSALNG0043374]
| |
− | |MEF2C-AS2
| |
− | |CTC-467M3.1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |diffuse large B-cell lymphoma
| |
− | |Hemic and Lymphatic Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289181 HSALNT0289181]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289181 HSALNG0003824]
| |
− | |MIR4422HG
| |
− | |RP11-101C11.1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |diffuse large B-cell lymphoma
| |
− | |Hemic and Lymphatic Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289403 HSALNT0289403]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289403 HSALNG0082800]
| |
− | |SPON1-AS1
| |
− | |RP11-21,L19.1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |diffuse large B-cell lymphoma
| |
− | |Hemic and Lymphatic Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289461 HSALNT0289461]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289461 HSALNG0083610]
| |
− | |CD44-AS1
| |
− | |RP1-68D18.4
| |
− | |NA
| |
− | |pathogenic process
| |
− | |diffuse large B-cell lymphoma
| |
− | |Hemic and Lymphatic Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0262277 HSALNT0262277]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0262277 HSALNG0127560]
| |
− | |LILRB1-AS1
| |
− | |AC009892.10
| |
− | |NA
| |
− | |pathogenic process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289546 HSALNT0289546]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289546 HSALNG0141661]
| |
− | |AC009892.10
| |
− | |LILRB1-AS1
| |
− | |NA
| |
− | |NA
| |
− | |B cell lymphoma
| |
− | |Immune System Diseases;Neoplasms;Hemic and Lymphatic Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0282241 HSALNT0282241]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0282241 HSALNG0137635]
| |
− | |LINC01186
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |lung cancer
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289168 HSALNT0289168]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289168 HSALNG0131657]
| |
− | |MHENCR
| |
− | |NA
| |
− | |ceRNA
| |
− | |pathogenic process
| |
− | |melanoma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0072994 HSALNT0072994]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0072994 HSALNG0034801]
| |
− | |LINC02232
| |
− | |RP11-707A18.1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0080161 HSALNT0080161]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0080161 HSALNG0038220]
| |
− | |LINC02233
| |
− | |RP11-6C14.1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0084027 HSALNT0084027]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0084027 HSALNG0039930]
| |
− | |LINC02236
| |
− | |RP11-332J15.1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0091870 HSALNT0091870]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0091870 HSALNG0043678]
| |
− | |LINC02234
| |
− | |RP11-455B3.1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0139521 HSALNT0139521]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0139521 HSALNG0066607]
| |
− | |LINC02235
| |
− | |RP11-354A14.1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0142040 HSALNT0142040]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0142040 HSALNG0067779]
| |
− | |LINC02237
| |
− | |RP11-1101K5.1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289135 HSALNT0289135]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289135 HSALNG0111295]
| |
− | |LINC02179
| |
− | |RP11-189E14.4
| |
− | |NA
| |
− | |pathogenic process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289351 HSALNT0289351]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289351 HSALNG0132340]
| |
− | |LINC01689
| |
− | |AP000469.2
| |
− | |NA
| |
− | |pathogenic process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289137 HSALNT0289137]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289137 HSALNG0091963]
| |
− | |LINC02231
| |
− | |RP11-766N7.4
| |
− | |NA
| |
− | |pathogenic process
| |
− | |Esophageal squamous cell cancer
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0220239 HSALNT0220239]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0220239 HSALNG0105903]
| |
− | |MIR4713HG
| |
− | |RP11-108K3.1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |colorectal cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288967 HSALNT0288967]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288967 HSALNG0037858]
| |
− | |FAM160A1-DT
| |
− | |RP11-610P16.1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |colorectal cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289239 HSALNT0289239]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289239 HSALNG0021423]
| |
− | |SATB2-AS1
| |
− | |NA
| |
− | |translational control
| |
− | |pathogenic process
| |
− | |osteosarcoma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289512 HSALNT0289512]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289512 HSALNG0141623]
| |
− | |LINC01826
| |
− | |lnc-MKI67IP-3
| |
− | |ceRNA
| |
− | |pathogenic process
| |
− | |atherosclerosis
| |
− | |Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289024 HSALNT0289024]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289024 HSALNG0104253]
| |
− | |LINC00226
| |
− | |C14orf97,NCRNA00226
| |
− | |NA
| |
− | |pathogenic process
| |
− | |pancreatic ductaladenocarcinoma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0082192 HSALNT0082192]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0082192 HSALNG0039173]
| |
− | |F11-AS1
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0219108 HSALNT0219108]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0219108 HSALNG0105295]
| |
− | |SPINT1-AS1
| |
− | |RP11-532F12.5
| |
− | |NA
| |
− | |pathogenic process
| |
− | |melanoma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289177 HSALNT0289177]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289177 HSALNG0088950]
| |
− | |MIR200CHG
| |
− | |U47924.27
| |
− | |NA
| |
− | |pathogenic process
| |
− | |melanoma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289328 HSALNT0289328]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289328 HSALNG0031153]
| |
− | |LINC00888
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |melanoma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289309 HSALNT0289309]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289309 HSALNG0116205]
| |
− | |LINC00672
| |
− | |NA
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |endometrial cancer
| |
− | |Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289198 HSALNT0289198]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289198 HSALNG0085691]
| |
− | |P4HA3-AS1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |parkinson's disease
| |
− | |Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0197312 HSALNT0197312]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0197312 HSALNG0095075]
| |
− | |TMEM132D-AS1
| |
− | |LOC283352
| |
− | |NA
| |
− | |pathogenic process
| |
− | |human dermal fibroblasts
| |
− | |Cell Physiological Phenomena
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289472 HSALNT0289472]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289472 HSALNG0113128]
| |
− | |ATP2C2-AS1
| |
− | |RP11-517C16.2-001
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0233849 HSALNT0233849]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0233849 HSALNG0112863]
| |
− | |WWOX-AS1
| |
− | |RP11-190D6.2
| |
− | |NA
| |
− | |pathogenic process
| |
− | |epithelial ovarian cancer
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0128829 HSALNT0128829]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0128829 HSALNG0061246]
| |
− | |FLNC-AS1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |cervical squamous cancer
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289889 HSALNT0289889]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289889 HSALNG0142004]
| |
− | |LIF-AS1
| |
− | |Lnc-LIF-AS
| |
− | |NA
| |
− | |pathogenic process
| |
− | |cervical squamous cancer
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0011283 HSALNT0011283]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0011283 HSALNG0005428]
| |
− | |DPYD-AS2
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |cervical squamous cancer
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289836 HSALNT0289836]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289836 HSALNG0141951]
| |
− | |FLICR
| |
− | |NA
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |autoimmune diabete
| |
− | |Immune System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289356 HSALNT0289356]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289356 HSALNG0090563]
| |
− | |LINC02402
| |
− | |ENST00000550337.1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |diabetes
| |
− | |Endocrine System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0137118 HSALNT0137118]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0137118 HSALNG0065453]
| |
− | |CERNA3
| |
− | |CTA
| |
− | |ceRNA
| |
− | |pathogenic process
| |
− | |osteosarcoma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0090838 HSALNT0090838]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0090838 HSALNG0043312]
| |
− | |LINC02488
| |
− | |CTD-2316B1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0174947 HSALNT0174947]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0174947 HSALNG0083979]
| |
− | |LINC02489
| |
− | |CTD-2589M5
| |
− | |NA
| |
− | |pathogenic process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0220441 HSALNT0220441]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0220441 HSALNG0105991]
| |
− | |LINC02490
| |
− | |RP11-209E8
| |
− | |NA
| |
− | |pathogenic process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289260 HSALNT0289260]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289260 HSALNG0045650]
| |
− | |STK32A-AS1
| |
− | |CTC-255N20
| |
− | |NA
| |
− | |pathogenic process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289143 HSALNT0289143]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289143 HSALNG0055190]
| |
− | |LINC02487
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |squamous cell cancer
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0095585 HSALNT0095585]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0095585 HSALNG0045503]
| |
− | |SPRY4-AS1
| |
− | |THCAT68
| |
− | |NA
| |
− | |pathogenic process
| |
− | |bladder cancer
| |
− | |Male Urogenital Diseases;Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288927 HSALNT0288927]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288927 HSALNG0090908]
| |
− | |DDN-AS1
| |
− | |CAT1507
| |
− | |NA
| |
− | |pathogenic process
| |
− | |bladder cancer
| |
− | |Male Urogenital Diseases;Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0012862 HSALNT0012862]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0012862 HSALNG0006150]
| |
− | |SLC16A1-AS1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |acute myocardial infarction
| |
− | |Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289412 HSALNT0289412]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289412 HSALNG0000276]
| |
− | |TNFRSF14-AS1
| |
− | |ENST00000416860.2
| |
− | |NA
| |
− | |pathogenic process
| |
− | |acute myocardial infarction
| |
− | |Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0259139 HSALNT0259139]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0259139 HSALNG0125745]
| |
− | |LINC00665
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0040268 HSALNT0040268]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0040268 HSALNG0019085]
| |
− | |DARS-AS1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |renal disease
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288913 HSALNT0288913]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288913 HSALNG0125425]
| |
− | |CEBPA-AS1
| |
− | |CEBPA-DT
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289011 HSALNT0289011]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289011 HSALNG0057479]
| |
− | |INHBA-AS1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288988 HSALNT0288988]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288988 HSALNG0067472]
| |
− | |GASAL1
| |
− | |GASL1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |liver cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289127 HSALNT0289127]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289127 HSALNG0021881]
| |
− | |LINC01857
| |
− | |AC079767.4
| |
− | |NA
| |
− | |pathogenic process
| |
− | |tuberculosis
| |
− | |Bacterial Infections and Mycoses
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289091 HSALNT0289091]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289091 HSALNG0004949]
| |
− | |LINC01140
| |
− | |FLJ41676
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0281957 HSALNT0281957]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0281957 HSALNG0137521]
| |
− | |PINCR
| |
− | |NA
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |colorectal cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289344 HSALNT0289344]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289344 HSALNG0139543]
| |
− | |LINC00890
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |leiomyoma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0019828 HSALNT0019828]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0019828 HSALNG0009573]
| |
− | |LINC00862
| |
− | |C1orf98,SMIM16
| |
− | |NA
| |
− | |pathogenic process
| |
− | |cystic fibrosis
| |
− | |Respiratory Tract Diseases;Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0073790 HSALNT0073790]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0073790 HSALNG0035237]
| |
− | |LINC02562
| |
− | |RP11-44F21.5
| |
− | |NA
| |
− | |pathogenic process
| |
− | |cystic fibrosis
| |
− | |Respiratory Tract Diseases;Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0263101 HSALNT0263101]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0263101 HSALNG0127961]
| |
− | |LINC02560
| |
− | |CTD-2619J13.13
| |
− | |NA
| |
− | |pathogenic process
| |
− | |cystic fibrosis
| |
− | |Respiratory Tract Diseases;Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289144 HSALNT0289144]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289144 HSALNG0088252]
| |
− | |LINC02551
| |
− | |RP11-890B15.2
| |
− | |NA
| |
− | |pathogenic process
| |
− | |cystic fibrosis
| |
− | |Respiratory Tract Diseases;Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289458 HSALNT0289458]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289458 HSALNG0078773]
| |
− | |DDIT4-AS1
| |
− | |RP11-442H21.2
| |
− | |NA
| |
− | |pathogenic process
| |
− | |cystic Fibrosis
| |
− | |Respiratory Tract Diseases;Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288992 HSALNT0288992]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288992 HSALNG0089423]
| |
− | |GPRC5D-AS1
| |
− | |RP11-392P7.6
| |
− | |NA
| |
− | |pathogenic process
| |
− | |colorectal cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289386 HSALNT0289386]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289386 HSALNG0015768]
| |
− | |PCBP1-AS1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289405 HSALNT0289405]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289405 HSALNG0044141]
| |
− | |STARD4-AS1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0201547 HSALNT0201547]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0201547 HSALNG0097004]
| |
− | |LINC00462
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatocellular cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0207103 HSALNT0207103]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0207103 HSALNG0099453]
| |
− | |SOX1-OT
| |
− | |LINC00403
| |
− | |NA
| |
− | |pathogenic process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0002131 HSALNT0002131]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0002131 HSALNG0001107]
| |
− | |SLC25A34-AS1
| |
− | |RP11-169K16.4
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289218 HSALNT0289218]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289218 HSALNG0075163]
| |
− | |PPP1R26-AS1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |breast cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289047 HSALNT0289047]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289047 HSALNG0064310]
| |
− | |LINC00589
| |
− | |C8orf75,TSLNC8
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatocellular cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289516 HSALNT0289516]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289516 HSALNG0141627]
| |
− | |TPM1-AS
| |
− | |TPM1-AS1
| |
− | |splicing regulation
| |
− | |pathogenic process
| |
− | |esophageal cancer
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289314 HSALNT0289314]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289314 HSALNG0141631]
| |
− | |LINC01101
| |
− | |FLJ14816
| |
− | |NA
| |
− | |pathogenic process
| |
− | |HPV-induced cervical neoplasia
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289147 HSALNT0289147]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289147 HSALNG0018748]
| |
− | |LINC02572
| |
− | |AC079776.2
| |
− | |NA
| |
− | |pathogenic process
| |
− | |epithelial ovarian cancer
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0096804 HSALNT0096804]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0096804 HSALNG0046188]
| |
− | |LINC02202
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289076 HSALNT0289076]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289076 HSALNG0027511]
| |
− | |LINC00973
| |
− | |CTD-2021J15.2
| |
− | |NA
| |
− | |pathogenic process
| |
− | |colorectal cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288625 HSALNT0288625]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288625 HSALNG0141401]
| |
− | |TTTY10
| |
− | |NCRNA00133
| |
− | |NA
| |
− | |pathogenic process
| |
− | |colorectal cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289323 HSALNT0289323]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289323 HSALNG0133418]
| |
− | |LINC00319
| |
− | |C21orf125,NCRNA00319,PRED49,FLJ38036
| |
− | |ceRNA
| |
− | |pathogenic process
| |
− | |lung cancer
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0015533 HSALNT0015533]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0015533 HSALNG0007394]
| |
− | |IL6R-AS1
| |
− | |RP11-350G8.5
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0090330 HSALNT0090330]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0090330 HSALNG0043020]
| |
− | |CKMT2-AS1
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0012995 HSALNT0012995]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0012995 HSALNG0006203]
| |
− | |HIPK1-AS1
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289216 HSALNT0289216]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289216 HSALNG0050214]
| |
− | |POLH-AS1
| |
− | |RP3-337H4.8
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289276 HSALNT0289276]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289276 HSALNG0053237]
| |
− | |TRDN-AS1
| |
− | |HRAT13
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289159 HSALNT0289159]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289159 HSALNG0069213]
| |
− | |LY6E-DT
| |
− | |LOC100133669
| |
− | |NA
| |
− | |pathogenic process
| |
− | |ovarian cancer
| |
− | |Endocrine System Diseases;Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289434 HSALNT0289434]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289434 HSALNG0040409]
| |
− | |BASP1-AS1
| |
− | |LOC285696
| |
− | |NA
| |
− | |pathogenic process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288991 HSALNT0288991]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288991 HSALNG0069691]
| |
− | |GLIS3-AS1
| |
− | |C9orf70,MGC16153
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288896 HSALNT0288896]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288896 HSALNG0070213]
| |
− | |BNC2-AS1
| |
− | |RP11-62F24.2
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289292 HSALNT0289292]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289292 HSALNG0078947]
| |
− | |ZNF503-AS1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |age-related macular degeneration
| |
− | |Eye Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0159506 HSALNT0159506]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0159506 HSALNG0076434]
| |
− | |VIM-AS1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |endometrial cancer
| |
− | |Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288882 HSALNT0288882]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288882 HSALNG0011058]
| |
− | |ACBD3-AS1
| |
− | |RP11-275I14.4
| |
− | |NA
| |
− | |pathogenic process
| |
− | |endometrial cancer
| |
− | |Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289156 HSALNT0289156]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289156 HSALNG0005074]
| |
− | |LRRC8C-DT
| |
− | |FLJ27354
| |
− | |NA
| |
− | |pathogenic process
| |
− | |endometrial cancer
| |
− | |Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289447 HSALNT0289447]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289447 HSALNG0058889]
| |
− | |ELN-AS1
| |
− | |CTB-51J22.1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |endometrial cancer
| |
− | |Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0076712 HSALNT0076712]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0076712 HSALNG0036645]
| |
− | |LINC02264
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0093666 HSALNT0093666]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0093666 HSALNG0044495]
| |
− | |LINC02201
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0271685 HSALNT0271685]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0271685 HSALNG0132198]
| |
− | |LINC02573
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289125 HSALNT0289125]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289125 HSALNG0015785]
| |
− | |LINC01816
| |
− | |LOC100133985
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289355 HSALNT0289355]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289355 HSALNG0091335]
| |
− | |LINC02381
| |
− | |LOC400043
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289366 HSALNT0289366]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289366 HSALNG0029874]
| |
− | |MBNL1-AS1
| |
− | |LOC401093
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289513 HSALNT0289513]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289513 HSALNG0141624]
| |
− | |MIR4697HG
| |
− | |LINC00947,LOC283174
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289073 HSALNT0289073]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289073 HSALNG0065480]
| |
− | |LINC00968
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |non-small cell lung cancer
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0114453 HSALNT0114453]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0114453 HSALNG0053963]
| |
− | |NMBR-AS1
| |
− | |RP11-137J7.2
| |
− | |NA
| |
− | |pathogenic process
| |
− | |non-melanoma skin cancer
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289300 HSALNT0289300]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289300 HSALNG0077499]
| |
− | |LINC01518
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |non-melanoma skin cancer
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0003783 HSALNT0003783]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0003783 HSALNG0002009]
| |
− | |LINC02574
| |
− | |RP11-288L9.1
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |UVB-irradiated KC & non-melanoma skin cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0032721 HSALNT0032721]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0032721 HSALNG0015486]
| |
− | |LINC02579
| |
− | |AC007365.1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0030828 HSALNT0030828]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0030828 HSALNG0014519]
| |
− | |LINC02580
| |
− | |AC093609.1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |UVB-irradiated KC & non-melanoma skin cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0032808 HSALNT0032808]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0032808 HSALNG0015519]
| |
− | |LINC02576
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |UVB-irradiated KC & non-melanoma skin cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0127022 HSALNT0127022]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0127022 HSALNG0060386]
| |
− | |LINC02577
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |UVB-irradiated KC & non-melanoma skin cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0154722 HSALNT0154722]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0154722 HSALNG0074062]
| |
− | |LINC02578
| |
− | |RP11-127L21.1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |UVB-irradiated KC & non-melanoma skin cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288962 HSALNT0288962]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288962 HSALNG0084388]
| |
− | |FAM111A-DT
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |UVB-irradiated KC & non-melanoma skin cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289148 HSALNT0289148]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289148 HSALNG0133545]
| |
− | |LINC02575
| |
− | |AP001065.15
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |UVB-irradiated KC & non-melanoma skin cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0025249 HSALNT0025249]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0025249 HSALNG0012143]
| |
− | |KIF26B-AS1
| |
− | |RP11-62I21.1
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0177212 HSALNT0177212]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0177212 HSALNG0085146]
| |
− | |RPS6KB2-AS1
| |
− | |AP003419.16
| |
− | |NA
| |
− | |pathogenic process
| |
− | |agingâassociated idiopathic pulmonary fibrosis
| |
− | |Physiological Phenomena
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289072 HSALNT0289072]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289072 HSALNG0090150]
| |
− | |LINC00941
| |
− | |lncRNA-MUF
| |
− | |ceRNA
| |
− | |pathogenic process
| |
− | |hepatocellular cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289338 HSALNT0289338]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289338 HSALNG0075045]
| |
− | |LINC00094
| |
− | |FLJ35348,bA374P20.3
| |
− | |NA
| |
− | |pathogenic process
| |
− | |lung squamous cell cancer
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0114192 HSALNT0114192]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0114192 HSALNG0053894]
| |
− | |FILNC1
| |
− | |NA
| |
− | |translational control
| |
− | |pathogenic process
| |
− | |renal tumor
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289199 HSALNT0289199]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289199 HSALNG0128600]
| |
− | |PARAL1
| |
− | |NA
| |
− | |ceRNA
| |
− | |pathogenic process
| |
− | |obesity
| |
− | |Pathological Conditions, Signs and Symptoms;Nutritional and Metabolic Diseases;Physiological Phenomena
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0244832 HSALNT0244832]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0244832 HSALNG0118528]
| |
− | |SOX9-AS1
| |
− | |FLJ37644
| |
− | |transcriptional regulation
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289236 HSALNT0289236]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289236 HSALNG0118528]
| |
− | |ROCR
| |
− | |LINC02095
| |
− | |transcriptional regulation
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0056667 HSALNT0056667]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0056667 HSALNG0027060]
| |
− | |LINC02027
| |
− | |LOC728290
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatocellular cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289424 HSALNT0289424]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289424 HSALNG0141124]
| |
− | |TTTY22
| |
− | |NCRNA00147
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289069 HSALNT0289069]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289069 HSALNG0030090]
| |
− | |LINC00880
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0252974 HSALNT0252974]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0252974 HSALNG0122396]
| |
− | |LINC02582
| |
− | |CTD-2354A18.1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |colorectal cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289035 HSALNT0289035]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289035 HSALNG0097712]
| |
− | |LINC00364
| |
− | |LncRNA00364
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatocellular cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0060981 HSALNT0060981]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0060981 HSALNG0029189]
| |
− | |NCK1-DT
| |
− | |NCK1-AS1,SLC35G2-AS1
| |
− | |ceRNA
| |
− | |pathogenic process
| |
− | |cervical cancer
| |
− | |Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288890 HSALNT0288890]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288890 HSALNG0067505]
| |
− | |BAALC-AS1
| |
− | |lncFZD6,FZD6-DT
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |liver cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0046602 HSALNT0046602]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0046602 HSALNG0021972]
| |
− | |CPS1-IT1
| |
− | |CPS1-IT,CPS1IT,CPS1IT1,PRO0132
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatocellular cancer;lung cancer;intrahepatic cholangiocarcinoma
| |
− | |Respiratory Tract Diseases;Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289445 HSALNT0289445]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289445 HSALNG0059740]
| |
− | |DLX6-AS1
| |
− | |DLX6-A, DLX6A, Evf-2,NCRNA00212,NCRNA00212,FLJ34048
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |split hand/split foot malformation disorder;lung adenocarcinoma
| |
− | |Respiratory Tract Diseases;Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289891 HSALNT0289891]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289891 HSALNG0142006]
| |
− | |LINC00114
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289415 HSALNT0289415]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289415 HSALNG0138601]
| |
− | |TSIX
| |
− | |LINC00013,NCRNA00013,XIST-A, XIST-AS1,XISTAS
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |systemic sclerosis
| |
− | |Skin and Connective Tissue Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0217334 HSALNT0217334]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0217334 HSALNG0104503]
| |
− | |MKRN3-AS1
| |
− | |ZNF127A, MKRN3A, MKRN3-A,FNZ127,NCRNA00009,ZNF127-AS
| |
− | |NA
| |
− | |pathogenic process
| |
− | |Prader-Willi syndrome
| |
− | |Nutritional and Metabolic Diseases;Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290256 HSALNT0290256]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290256 HSALNG0142371]
| |
− | |SRA
| |
− | |lnc-SRA1-1:1,SRA1,ENSG00000213523
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |nonalcoholic fatty liver disease;polycystic ovary syndrome;ovarian cancer;dilated cardiomyopathy;cardiomyopathy;breast cancer;laryngeal squamous cell cancer;uterus cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms;Cardiovascular Diseases;Female Urogenital Diseases and Pregnancy Complications;Endocrine System Diseases;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289442 HSALNT0289442]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289442 HSALNG0049271]
| |
− | |HCP5
| |
− | |6S2650E,D6S2650E,P5-1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |AIDS
| |
− | |Immune System Diseases;Virus Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289284 HSALNT0289284]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289284 HSALNG0083476]
| |
− | |WT1-AS
| |
− | |WIT1,WIT-1,WT1A, WT1-AS1
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |gastric cancer;primary myelofibrosis;hepatocellular cancer;Wilms' tumor;acute myeloid leukemia
| |
− | |Neoplasms;Hemic and Lymphatic Diseases;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289421 HSALNT0289421]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289421 HSALNG0082235]
| |
− | |KCNQ1OT1
| |
− | |KCNQ1-AS2,KCNQ10T1,Kncq1,KvDMR1,KvLQT1-A, LIT1,NCRNA00012
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |prostate cancer;colorectal cancer;hepatocelluar cancer;acute myocardial infarction;kidney cancer;Beckwith-Wiedemann syndrome;breast cancer
| |
− | |Skin and Connective Tissue Diseases;Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Neoplasms;Male Urogenital Diseases;Female Urogenital Diseases and Pregnancy Complications;Cardiovascular Diseases;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0263784 HSALNT0263784]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0263784 HSALNG0128372]
| |
− | |PCNA-AS1
| |
− | |PCNAA, PCNA-AS
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |gastric cancer;hepatocelluar cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289524 HSALNT0289524]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289524 HSALNG0049107]
| |
− | |HCG9
| |
− | |PERB11,HCGIX,HCGIX4,HCGIX-4
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289264 HSALNT0289264]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289264 HSALNG0103448]
| |
− | |TCL6
| |
− | |TCL6e1,TNG2,TNG1
| |
− | |NA
| |
− | |pathogenic process;developmental process
| |
− | |renal cell cancer;leukemia
| |
− | |Male Urogenital Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289203 HSALNT0289203]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289203 HSALNG0072040]
| |
− | |PCA3
| |
− | |DD3,NCRNA00019,PCAT3
| |
− | |transcriptional regulation;ceRNA
| |
− | |pathogenic process
| |
− | |prostate cancer
| |
− | |Male Urogenital Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289462 HSALNT0289462]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289462 HSALNG0082178]
| |
− | |H19
| |
− | |ASM,ASM1,BW, D11S813E,LINC00008,NCRNA00008,WT2
| |
− | |transcriptional regulation;ceRNA
| |
− | |developmental process;pathogenic process
| |
− | |prostate cancer;glioma;cancer;breast cancer;ovarian cancer;Marek's disease;gestational trophoblastic diseases;glioblastoma;non-small cell lung cancer;hyperhomocysteinemia;congenital heart defect;congenital hyperinsulinism;pancreatic cancer;Beckwith-Wiedemann syndrome;endometriosis;trophoblastic tumor;adrenocortical cancer;coronary artery disease;Wiedemann-Beckwith syndrome;bladder cancer;melanoma;myeloproliferative polycythaemia vera;hepatocelluar cancer;meningioma;breast adenocarcinoma;neuroblastoma;embryonal cancer;osteosarcoma;esophageal cancer;kidney cancer;malignant digestive cancer;chronic myeloid leukemia;mullerian aplasia;malignant hematopoiesis;gastric cardia adenocarcinoma;cervical cancer;gallbladder cancer;pheochromocytoma;germ cell tumor;colorectal cancer;hydatidiform mole;Pancreatic ductal adenocarcinoma;pre-eclampsia;atherosclerosis;esophageal squamous cell cancer;calcific aortic valve disease;gastric cancer;osteoarthritis;choriocarcinoma;chronic myeloproliferative disorders;neural tube defects;skin cancer;ulcerative colitis;type 2 diabetes;thyroid cancer;pneumoconiosis;infertility;liver cancer;heart failure;medulloblastoma;laryngeal squamous cell cancer;Silver-Russell syndrome;pituitary adenoma;hepatocellular cancer;nasopharyngeal cancer;growth restriction;Prader-Willi syndrome;diabetic cardiomyopathy;obesity;lung cancer;Parkinson's disease;renal cell cancer;Wilms' tumor
| |
− | |Nutritional and Metabolic Diseases;Cell Physiological Phenomena;Virus Diseases;Female Urogenital Diseases and Pregnancy Complications;Cardiovascular Diseases;Physiological Phenomena;Neoplasms;Male Urogenital Diseases;Endocrine System Diseases;Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Immune System Diseases;Hemic and Lymphatic Diseases;Musculoskeletal Diseases;Nervous System Diseases;Digestive System Diseases;Skin and Connective Tissue Diseases;Pathological Conditions, Signs and Symptoms;Respiratory Tract Diseases;Occupational Diseases;Otorhinolaryngologic Diseases;Stomatognathic Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288932 HSALNT0288932]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288932 HSALNG0097105]
| |
− | |DLEU1
| |
− | |BCM, BCMS1,DLB1,LEU1,LEU2,LINC00021,NCRNA00021,XTP6
| |
− | |transcriptional regulation;ceRNA
| |
− | |pathogenic process
| |
− | |lymphocytic leukemia;B-cell chronic lymphocytic leukemia;myeloma;multiple myeloma;hematopoietic and solid tumors;chronic lymphocytic leukemia;inherited bone marrow failure disorder;lymphoma;breast cancer;head and neck squamous cell cancer
| |
− | |Skin and Connective Tissue Diseases;Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Neoplasms;Immune System Diseases;Hemic and Lymphatic Diseases;Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289493 HSALNT0289493]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289493 HSALNG0141604]
| |
− | |DBH-AS1
| |
− | |NCRNA00118,BPR
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatocellular cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0088415 HSALNT0088415]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0088415 HSALNG0042101]
| |
− | |PART1
| |
− | |DKFZP586D0823,NCRNA00206
| |
− | |NA
| |
− | |pathogenic process
| |
− | |prostate cancer;glioblastoma
| |
− | |Male Urogenital Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289463 HSALNT0289463]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289463 HSALNG0082197]
| |
− | |IGF2-AS
| |
− | |IGF2A,PEG8,IGF2-AS1
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |liver cancer;type 1 diabetes;prostate cancer;Wilms' tumor;hepatocelluar cancer
| |
− | |Neoplasms;Nutritional and Metabolic Diseases;Male Urogenital Diseases;Endocrine System Diseases;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0269786 HSALNT0269786]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0269786 HSALNG0131285]
| |
− | |GNAS-AS1
| |
− | |GNASA, GNAS-A,SANG,NESP-A, NESPA, GNAS1A, NCRNA00075
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |non-small cell lung cancer;pseudohypoparathyroidism type Ib
| |
− | |Musculoskeletal Diseases;Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289252 HSALNT0289252]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289252 HSALNG0051709]
| |
− | |SNHG5
| |
− | |C6orf160,MGC16362,bA33E24.2,U50HG,NCRNA00044,LINC00044
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cancer;lymphoma;melanoma
| |
− | |Immune System Diseases;Neoplasms;Hemic and Lymphatic Diseases;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0023827 HSALNT0023827]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0023827 HSALNG0011462]
| |
− | |DISC2
| |
− | |DISC1-AS1,DISC1O, NCRNA00015
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |bipolar disorder;affective disorder;major depressive affective disorder;schizophrenia;autism spectrum disorder;depression
| |
− | |Bacterial Infections and Mycoses;Mental Disorders;Behavior and Behavior Mechanisms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0203415 HSALNT0203415]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0203415 HSALNG0097806]
| |
− | |ATXN8OS
| |
− | |SCA8,KLHL1A,NCRNA00003
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |spinocerebellar ataxia;spinocerebellar ataxia
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290312 HSALNT0290312]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290312 HSALNG0142427]
| |
− | |TRAF3IP2-AS1
| |
− | |C6UA, C6orf3,NCRNA00248,TRAF3IP2-AS2
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |schizophrenia;cocaine abuse
| |
− | |Chemically-Induced Disorders;Mental Disorders
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289008 HSALNT0289008]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289008 HSALNG0054049]
| |
− | |HYMAI
| |
− | |NCRNA00020
| |
− | |NA
| |
− | |pathogenic process
| |
− | |transient neonatal diabetes
| |
− | |Nutritional and Metabolic Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288968 HSALNT0288968]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288968 HSALNG0071146]
| |
− | |FAM201A
| |
− | |C9orf122
| |
− | |NA
| |
− | |pathogenic process
| |
− | |leukemia
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288969 HSALNT0288969]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288969 HSALNG0093910]
| |
− | |FAM222A-AS1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289484 HSALNT0289484]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289484 HSALNG0138575]
| |
− | |FAM226A
| |
− | |CXorf50,NCRNA00246,NCRNA00246A,LINC00246A,MGC34827
| |
− | |NA
| |
− | |pathogenic process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289497 HSALNT0289497]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289497 HSALNG0141608]
| |
− | |FAM215A
| |
− | |C17orf88,APR-2,LINC00530
| |
− | |NA
| |
− | |pathogenic process
| |
− | |ovarian cancer;leukemia
| |
− | |Endocrine System Diseases;Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289230 HSALNT0289230]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289230 HSALNG0025991]
| |
− | |RBM5-AS1
| |
− | |LUST
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |tumor
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0002923 HSALNT0002923]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0002923 HSALNG0001554]
| |
− | |LINC00339
| |
− | |NCRNA00339,HSPC157
| |
− | |NA
| |
− | |pathogenic process;developmental process
| |
− | |Pancreatic ductal adenocarcinoma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0144027 HSALNT0144027]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0144027 HSALNG0068615]
| |
− | |ASAP1-IT1
| |
− | |ASAP1-IT,ASAP1IT,ASAP1IT1,DDEF1IT1,HSPC054,NCRNA00050
| |
− | |NA
| |
− | |pathogenic process
| |
− | |ovarian cancer
| |
− | |Endocrine System Diseases;Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289212 HSALNT0289212]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289212 HSALNG0021208]
| |
− | |PCGEM1
| |
− | |NCRNA00071,LINC00071,PCAT9
| |
− | |transcriptional regulation;ceRNA
| |
− | |pathogenic process
| |
− | |osteoarthritis;prostate cancer;glioma
| |
− | |Musculoskeletal Diseases;Male Urogenital Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289016 HSALNT0289016]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289016 HSALNG0082243]
| |
− | |KCNQ1DN
| |
− | |BWRT,HSA404617
| |
− | |NA
| |
− | |pathogenic process
| |
− | |aging;Wilms' tumor
| |
− | |Physiological Phenomena;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288933 HSALNT0288933]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288933 HSALNG0097101]
| |
− | |DLEU2
| |
− | |DLB2,BCMSUN,RFP2O,LEU2,TRIM13O, NCRNA00022,LINC00022,MIR15AHG
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |lymphocytic leukemia;B-cell chronic lymphocytic leukemia;myeloma;multiple myeloma;chronic lymphocytic leukemia;non-small cell lung cancer
| |
− | |Neoplasms;Respiratory Tract Diseases;Immune System Diseases;Hemic and Lymphatic Diseases;Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0217624 HSALNT0217624]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0217624 HSALNG0104558]
| |
− | |PWAR4
| |
− | |PAR4,PAR-4
| |
− | |NA
| |
− | |pathogenic process
| |
− | |Prader-Willi syndrome and Angelman syndrome
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289165 HSALNT0289165]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289165 HSALNG0103778]
| |
− | |MEG8
| |
− | |SNHG23,SNHG24,NCRNA00024,Irm,Rian,Bsr,LINC00024,AL132709.8,lnc-MGC
| |
− | |NA
| |
− | |pathogenic process
| |
− | |Prader-Willi syndrome and Angelman syndrome;temple syndrome
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289482 HSALNT0289482]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289482 HSALNG0133856]
| |
− | |CECR7
| |
− | |SAHL1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatocellular cancer;cat eye syndrome
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0074223 HSALNT0074223]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0074223 HSALNG0035451]
| |
− | |PCAT4
| |
− | |GDEP,PCAN1,PCA4
| |
− | |NA
| |
− | |pathogenic process
| |
− | |prostate cancer
| |
− | |Male Urogenital Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0061175 HSALNT0061175]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0061175 HSALNG0029318]
| |
− | |PISRT1
| |
− | |NCRNA00195
| |
− | |transcriptional regulation
| |
− | |developmental process;pathogenic process
| |
− | |blepharophimosis syndrome
| |
− | |Eye Diseases;Congenital, Hereditary, and Neonatal Diseases and Abnormalities
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0190912 HSALNT0190912]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0190912 HSALNG0092137]
| |
− | |IFNG-AS1
| |
− | |Tmevpg1,LincR-Ifng-3'A, NEST
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |Hashimoto's thyroiditis;primary immune thrombocytopenia;multiple sclerosis;Sjögren syndrome
| |
− | |Immune System Diseases ;Immune System Diseases;Endocrine System Diseases;Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0038178 HSALNT0038178]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0038178 HSALNG0018067]
| |
− | |FAM138B
| |
− | |F379
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0145703 HSALNT0145703]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0145703 HSALNG0069515]
| |
− | |FAM138C
| |
− | |F379
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288963 HSALNT0288963]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288963 HSALNG0000006]
| |
− | |FAM138A
| |
− | |F379
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0183947 HSALNT0183947]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0183947 HSALNG0088434]
| |
− | |FAM138D
| |
− | |F379
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0226092 HSALNT0226092]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0226092 HSALNG0108677]
| |
− | |FAM138E
| |
− | |F379
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0253925 HSALNT0253925]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0253925 HSALNG0122829]
| |
− | |FAM138F
| |
− | |F379
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289326 HSALNT0289326]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289326 HSALNG0141632]
| |
− | |LINC00312
| |
− | |LOH3CR2A,NCRNA00312,NAG7,NAG-7,ERR10,ERR-10,LMCD1DN
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |nasopharyngeal cancer;bladder cancer;non-small cell lung cancer
| |
− | |Neoplasms;Respiratory Tract Diseases;Male Urogenital Diseases;Female Urogenital Diseases and Pregnancy Complications;Otorhinolaryngologic Diseases;Stomatognathic Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288886 HSALNT0288886]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288886 HSALNG0054798]
| |
− | |AIRN
| |
− | |AIR,NCRNA00088,IGF2RA, IGF2R-AS1
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0254857 HSALNT0254857]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0254857 HSALNG0123415]
| |
− | |MIR7-3HG
| |
− | |C19orf30,NCRNA00306,LINC00306,PGSF1,PGSF1a,PGSF1b,Huh7,uc002mbe.2
| |
− | |NA
| |
− | |pathogenic process
| |
− | |liver cancer;hepatocelluar cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0185751 HSALNT0185751]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0185751 HSALNG0089375]
| |
− | |LOH12CR2
| |
− | |LOH2CR12
| |
− | |NA
| |
− | |pathogenic process
| |
− | |pre-B acute lymphoblastic leukaemia
| |
− | |Hemic and Lymphatic Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289479 HSALNT0289479]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289479 HSALNG0133055]
| |
− | |DSCR8
| |
− | |C21orf65,MTAG2,CT25.1a,CT25.1b,MMA-1a,MMA-1b
| |
− | |NA
| |
− | |pathogenic process
| |
− | |Down syndrome;melanoma
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Neoplasms;Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289030 HSALNT0289030]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289030 HSALNG0133422]
| |
− | |LINC00313
| |
− | |C21orf84,NCRNA00313,
| |
− | |NA
| |
− | |pathogenic process
| |
− | |lung cancer
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289029 HSALNT0289029]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289029 HSALNG0132830]
| |
− | |LINC00310
| |
− | |C21orf82,NCRNA00310
| |
− | |NA
| |
− | |pathogenic process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0272435 HSALNT0272435]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0272435 HSALNG0132500]
| |
− | |LINC00161
| |
− | |C21orf100,NCRNA00161
| |
− | |ceRNA
| |
− | |pathogenic process
| |
− | |osteosarcoma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289184 HSALNT0289184]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289184 HSALNG0132027]
| |
− | |MIR99AHG
| |
− | |C21orf35,FLJ38295,C21orf34,LINC00478,MONC
| |
− | |NA
| |
− | |pathogenic process
| |
− | |myeloid leukemia
| |
− | |Hemic and Lymphatic Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289005 HSALNT0289005]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289005 HSALNG0056865]
| |
− | |HOXA11-AS
| |
− | |HOXA11A,HOXA11-AS1,HOXA11, HOXA-AS5,NCRNA00076
| |
− | |ceRNA
| |
− | |pathogenic process
| |
− | |uterine cervix cancer;ovarian cancer;glioma;cervical cancer;gastric cancer
| |
− | |Endocrine System Diseases;Female Urogenital Diseases and Pregnancy Complications;Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0193654 HSALNT0193654]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0193654 HSALNG0093342]
| |
− | |RMST
| |
− | |NCRM, NCRNA00054,LINC00054
| |
− | |transcriptional regulation
| |
− | |developmental process;pathogenic process
| |
− | |breast cancer;rhabdomyosarcoma
| |
− | |Skin and Connective Tissue Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290079 HSALNT0290079]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290079 HSALNG0142194]
| |
− | |ncR-PAR
| |
− | |NCRUPAR,ENSG00000225407
| |
− | |transcriptional regulation
| |
− | |developmental process;pathogenic process
| |
− | |gastric cancer;colorectal cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289167 HSALNT0289167]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289167 HSALNG0061370]
| |
− | |MESTIT1
| |
− | |MEST-AS1,MEST-IT,MEST-IT1,NCRNA00040,PEG1-AS
| |
− | |NA
| |
− | |pathogenic process
| |
− | |Silver-Russell syndrome
| |
− | |Musculoskeletal Diseases;Congenital, Hereditary, and Neonatal Diseases and Abnormalities
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0273791 HSALNT0273791]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0273791 HSALNG0133168]
| |
− | |DSCAM-AS1
| |
− | |M41
| |
− | |NA
| |
− | |pathogenic process
| |
− | |adolescent idiopathic scoliosis;breast cancer
| |
− | |Musculoskeletal Diseases;Skin and Connective Tissue Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289391 HSALNT0289391]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289391 HSALNG0104546]
| |
− | |PWARSN
| |
− | |PAR-SN,PARSN
| |
− | |NA
| |
− | |pathogenic process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0127791 HSALNT0127791]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0127791 HSALNG0060774]
| |
− | |ST7-AS1
| |
− | |ST7OT1,ST7AS1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |glioma;autism
| |
− | |Mental Disorders;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0206298 HSALNT0206298]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0206298 HSALNG0099122]
| |
− | |DAOA-AS1
| |
− | |DAOAA, DAOA-A,G30
| |
− | |NA
| |
− | |pathogenic process
| |
− | |panic disorder;schizophrenia;bipolar disorder
| |
− | |Mental Disorders
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0167060 HSALNT0167060]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0167060 HSALNG0080104]
| |
− | |OLMALINC
| |
− | |C10orf75,NCRNA00263,LINC00263,bA34D15.5,FLJ12974,HI-LNC80
| |
− | |NA
| |
− | |pathogenic process
| |
− | |type 2 diabetes
| |
− | |Nutritional and Metabolic Diseases;Endocrine System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0026878 HSALNT0026878]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0026878 HSALNG0012802]
| |
− | |LINC00299
| |
− | |C2orf46,NCRNA00299,FLJ45673
| |
− | |NA
| |
− | |pathogenic process;developmental process
| |
− | |intellectual and developmental disability;neurodevelopmental disabilities
| |
− | |Mental Disorders;Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289081 HSALNT0289081]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289081 HSALNG0039816]
| |
− | |LINC01020
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hereditary haemorrhagic telangiectasia
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0101186 HSALNT0101186]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0101186 HSALNG0048016]
| |
− | |LINC00518
| |
− | |C6orf218,MGC40222
| |
− | |NA
| |
− | |pathogenic process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0083960 HSALNT0083960]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0083960 HSALNG0039909]
| |
− | |LINC01018
| |
− | |SRHC
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatocellular cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289361 HSALNT0289361]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289361 HSALNG0031463]
| |
− | |LPP-AS2
| |
− | |MYCLo-5,MYCLo-6
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0143233 HSALNT0143233]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0143233 HSALNG0068292]
| |
− | |LINC00964
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |colorectal cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289364 HSALNT0289364]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289364 HSALNG0094063]
| |
− | |MAPKAPK5-AS1
| |
− | |C12orf47,FLJ39616
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatocellular cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289053 HSALNT0289053]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289053 HSALNG0027872]
| |
− | |LINC00635
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |lung cancer
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289327 HSALNT0289327]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289327 HSALNG0141633]
| |
− | |LINC00636
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |breast cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0262657 HSALNT0262657]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0262657 HSALNG0127758]
| |
− | |ZNF582-AS1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |colorectal cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289020 HSALNT0289020]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289020 HSALNG0000022]
| |
− | |LINC00115
| |
− | |NCRNA00115,FLJ22639
| |
− | |ceRNA
| |
− | |pathogenic process
| |
− | |lung adenocarcinoma
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289254 HSALNT0289254]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289254 HSALNG0075291]
| |
− | |SNHG7
| |
− | |MGC16037,NCRNA00061
| |
− | |NA
| |
− | |pathogenic process
| |
− | |lung cancer
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289162 HSALNT0289162]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289162 HSALNG0020412]
| |
− | |MAP3K20-AS1
| |
− | |MLK7-AS1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0145357 HSALNT0145357]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0145357 HSALNG0069280]
| |
− | |RHPN1-AS1
| |
− | |C8orf51,MGC3113
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289343 HSALNT0289343]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289343 HSALNG0138602]
| |
− | |XIST
| |
− | |DXS399E,NCRNA00001,DXS1089,swd66,LINC00001
| |
− | |transcriptional regulation;ceRNA
| |
− | |pathogenic process
| |
− | |non-small cell lung cancer;B-cell acute lymphoblastic leukemia;bladder cancer;testicular germ cell tumor;colorectal cancer;cancer;ovarian cancer;female cancers;renal collecting duct cancer;membranous nephropathy;Trisomy 21;gastric cancer;hepatocellular cancer;nasopharyngeal cancer;Klinefelter's syndrome;glioblastoma;breast cancer;cystic fibrosis
| |
− | |Skin and Connective Tissue Diseases;Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Neoplasms;Respiratory Tract Diseases;Immune System Diseases;Male Urogenital Diseases;Stomatognathic Diseases;Hemic and Lymphatic Diseases;Female Urogenital Diseases and Pregnancy Complications;Nervous System Diseases;Otorhinolaryngologic Diseases;Endocrine System Diseases;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289389 HSALNT0289389]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289389 HSALNG0128330]
| |
− | |PRNT
| |
− | |M8
| |
− | |NA
| |
− | |pathogenic process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288942 HSALNT0288942]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288942 HSALNG0080912]
| |
− | |EMX2OS
| |
− | |NCRNA00045,EMX2-AS1
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0200443 HSALNT0200443]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0200443 HSALNG0096546]
| |
− | |LINC00598
| |
− | |TTL
| |
− | |NA
| |
− | |pathogenic process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289517 HSALNT0289517]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289517 HSALNG0141628]
| |
− | |TTTY17A
| |
− | |NCRNA00140
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0027901 HSALNT0027901]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0027901 HSALNG0013206]
| |
− | |MYCNOS
| |
− | |NCYM,N-CYM,MYCN-AS1
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |neuroblastoma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0047175 HSALNT0047175]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0047175 HSALNG0022192]
| |
− | |DIRC3
| |
− | |FLJ14199
| |
− | |NA
| |
− | |pathogenic process
| |
− | |familial renal cell cancer;breast cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289363 HSALNT0289363]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289363 HSALNG0084905]
| |
− | |MALAT1
| |
− | |PRO1073,MALAT-1,NCRNA00047,HCN,NEAT2,LINC00047,mascRNA
| |
− | |splicing regulation;;translational control;transcriptional regulation;protein localization;ceRNA
| |
− | |pathogenic process
| |
− | |prostate cancer;glioma;cancer;breast cancer;ovarian cancer;amyotrophic lateral sclerosis;proliferative vitreoretinopathy;glioblastoma;endometrial stromal sarcoma;oral squamous cell cancer;acute myocardial infarction;hemangioma;pancreatic cancer;endometrioid endometrial cancer;melanoma;tongue squamous cell cancer;HIV;hepatocelluar cancer;bladder cancer;neuroblastoma;lung cancer;nasopharyngeal cancer;osteosarcoma;esophageal cancer;kidney cancer;hepatic steatosis;urothelial cancer;diabetes;triple-negative breast cancer;liver fibrosis;cervical cancer;uterus cancer;gallbladder cancer;decreased myogenesis;esophageal squamous cell cancer;fibrosarcoma;colorectal cancer;Pancreatic ductal adenocarcinoma;pre-eclampsia;retinal neurodegeneration;small cell lung cancer;multiple myeloma;gastric cancer;lung adenocarcinoma;uveal melanoma;epithelial ovarian cancer;TDP-43-associated pathological states;thyroid cancer;congenital microtia;liver cancer;renal clear cell cancer;laryngeal squamous cell cancer;pituitary adenoma;hepatocellular cancer;non-small cell lung cancer;pulmonary arterial hypertension;diabetic cardiomyopathy;vulvar squamous cell cancer;hyperglycaemia;papillary thyroid cancer;Parkinson's disease;renal cell cancer;lung cancer brain metastasis
| |
− | |Eye Diseases;Skin and Connective Tissue Diseases;Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Neoplasms;Respiratory Tract Diseases;Nutritional and Metabolic Diseases;Male Urogenital Diseases;Cell Physiological Phenomena;Immune System Diseases;Hemic and Lymphatic Diseases;Virus Diseases;Stomatognathic Diseases;Cardiovascular Diseases;Female Urogenital Diseases and Pregnancy Complications;Otorhinolaryngologic Diseases;Endocrine System Diseases;Digestive System Diseases;Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289744 HSALNT0289744]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289744 HSALNG0141859]
| |
− | |DLG2-AS1
| |
− | |DLG2A, DLG2-A,PSZA11q14,SZ-1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |schizophrenia;myotonic dystrophy type 1;heart failure
| |
− | |Pathological Conditions, Signs and Symptoms;Musculoskeletal Diseases;Mental Disorders;Cardiovascular Diseases;Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289164 HSALNT0289164]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289164 HSALNG0103778]
| |
− | |MEG3
| |
− | |FP504,GTL2,LINC00023,NCRNA00023,PRO0518,PRO2160,onco-lncRNA-83,prebp1
| |
− | |translational control;transcriptional regulation;ceRNA
| |
− | |pathogenic process
| |
− | |oral squamous cell cancer;phaeochromocytoma;prostate cancer;testicular germ cell tumor;glioma;cancer;osteosarcoma;non-functioning pituitary adenoma;heroin abuse;stroke;non-small cell lung cancer;thrombocytopenic purpura;acute myeloid leukemia;pancreatic cancer;bladder cancer;tongue squamous cell cancer;hepatocelluar cancer;meningioma;drug abuse;liver fibrosis;pancreatic neuroendocrine tumor;esophageal squamous cell cancer;myelodysplastic syndrome;retinoblastoma;chronic myeloid leukemia;type 1 diabetes;breast cancer;cervical cancer;kidney cancer;gallbladder cancer;cholestatic liver injury;colorectal cancer;neuroblastoma;multiple myeloma;gastric cancer;osteoarthritis;lung adenocarcinoma;endometrial cancer;Huntington disease;diabetes;type 2 diabetes;lung cancer;epithelial ovarian cancer;primary myelofibrosis;metabolic syndrome;pituitary adenoma;hepatocellular cancer;nasopharyngeal cancer;vulvar squamous cell cancer;papillary thyroid cancer;renal cell cancer;Wilms' tumor
| |
− | |Skin and Connective Tissue Diseases;Pathological Conditions, Signs and Symptoms;Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Neoplasms;Respiratory Tract Diseases;Nutritional and Metabolic Diseases;Male Urogenital Diseases;Immune System Diseases;Stomatognathic Diseases;Hemic and Lymphatic Diseases;Chemically-Induced Disorders;Musculoskeletal Diseases;Mental Disorders;Female Urogenital Diseases and Pregnancy Complications;Cardiovascular Diseases;Otorhinolaryngologic Diseases;Endocrine System Diseases;Digestive System Diseases;Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290298 HSALNT0290298]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290298 HSALNG0142413]
| |
− | |TERC
| |
− | |DKCA1,PFBMFT2,SCARNA19,TR,TRC3,hTR
| |
− | |NA
| |
− | |pathogenic process
| |
− | |prostate cancer;dyskeratosis congenita;lung squamous cell cancer
| |
− | |Skin and Connective Tissue Diseases;Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Neoplasms;Respiratory Tract Diseases;Male Urogenital Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288907 HSALNT0288907]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288907 HSALNG0080948]
| |
− | |CASC2
| |
− | |NA
| |
− | |ceRNA
| |
− | |pathogenic process
| |
− | |colorectal cancer;gastric cancer;endometrial cancer;lung cancer;renal cell cancer;glioma
| |
− | |Neoplasms;Respiratory Tract Diseases;Male Urogenital Diseases;Female Urogenital Diseases and Pregnancy Complications;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0205332 HSALNT0205332]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0205332 HSALNG0098601]
| |
− | |MIR17HG
| |
− | |C13orf25,MIRHG1,FLJ14178,MIRH1,MIHG1,NCRNA00048,miR-17-92,LINC00048
| |
− | |NA
| |
− | |pathogenic process
| |
− | |diffuse large B-cell lymphoma;syndromic developmental defect;cancer
| |
− | |Neoplasms;Hemic and Lymphatic Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288716 HSALNT0288716]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288716 HSALNG0141456]
| |
− | |TTTY6
| |
− | |TTY6,TTTY6A,LINC00127
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288731 HSALNT0288731]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288731 HSALNG0141468]
| |
− | |TTTY4
| |
− | |TTY4,TTTY4A,LINC00123
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288815 HSALNT0288815]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288815 HSALNG0141548]
| |
− | |TTTY3
| |
− | |TTY3,TTTY3A,LINC00121
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288703 HSALNT0288703]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288703 HSALNG0141450]
| |
− | |TTTY5
| |
− | |TTY5,LINC00126
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289255 HSALNT0289255]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289255 HSALNG0036656]
| |
− | |SNHG8
| |
− | |NCRNA00060,LINC00060
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cancer;malignant pleural mesothelioma
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289486 HSALNT0289486]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289486 HSALNG0141597]
| |
− | |BCYRN1
| |
− | |BC200,BC200a,NCRNA00004,LINC00004
| |
− | |splicing regulation;translational control
| |
− | |pathogenic process
| |
− | |aging;lung cancer;glioma;ovarian cancer;esophageal squamous cell cancer;non-small cell lung cancer;esophageal cancer;Alzheimer's disease;tongue cancer;parotid cancer;breast cancer;cervical cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms;Respiratory Tract Diseases;Stomatognathic Diseases;Mental Disorders;Female Urogenital Diseases and Pregnancy Complications;Physiological Phenomena;Endocrine System Diseases;Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0144426 HSALNT0144426]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0144426 HSALNG0068805]
| |
− | |ZFAT-AS1
| |
− | |ZFATAS,ZFAT-AS,SAS-ZFAT,NCRNA00070
| |
− | |NA
| |
− | |pathogenic process
| |
− | |autoimmune disease
| |
− | |Immune System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289285 HSALNT0289285]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289285 HSALNG0077083]
| |
− | |ZEB1-AS1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |esophageal squamous cell cancer;autoimmune thyroid disease;hepatocelluar cancer
| |
− | |Immune System Diseases;Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289185 HSALNT0289185]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289185 HSALNG0135987]
| |
− | |MIRLET7BHG
| |
− | |linc-Ppara
| |
− | |NA
| |
− | |developmental process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289374 HSALNT0289374]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289374 HSALNG0116616]
| |
− | |NBR2
| |
− | |NCRNA00192
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |gastric cancer;breast cancer;cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289417 HSALNT0289417]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289417 HSALNG0134930]
| |
− | |TUG1
| |
− | |FLJ20618,NCRNA00080,LINC00080
| |
− | |transcriptional regulation;ceRNA
| |
− | |pathogenic process
| |
− | |osteosarcoma;prostate cancer;glioma;ovarian cancer;glioblastoma;non-small cell lung cancer;B-cell neoplasms;chronic kidney disease;melanoma;bladder cancer;urothelial cancer of the bladder;esophageal squamous cell cancer;multiple sclerosis;breast cancer;hepatoblastoma;colorectal cancer;multiple myeloma;gastric cancer;Huntington disease;hepatocellular cancer;oesophageal squamous cell cancer;renal cell cancer
| |
− | |Skin and Connective Tissue Diseases;Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Neoplasms;Respiratory Tract Diseases;Immune System Diseases;Male Urogenital Diseases;Hemic and Lymphatic Diseases;Cardiovascular Diseases;Female Urogenital Diseases and Pregnancy Complications;Mental Disorders;Endocrine System Diseases;Digestive System Diseases;Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288973 HSALNT0288973]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288973 HSALNG0079552]
| |
− | |FAS-AS1
| |
− | |FASA, FAS-A,SAF
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |ataxia telangiectasia
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Immune System Diseases;Nutritional and Metabolic Diseases;Cardiovascular Diseases;Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288996 HSALNT0288996]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288996 HSALNG0068110]
| |
− | |HAS2-AS1
| |
− | |HAS2A, HAS2-A,HASNT,NCRNA00077
| |
− | |transcriptional regulation
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289390 HSALNT0289390]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289390 HSALNG0049245]
| |
− | |PSORS1C3
| |
− | |NCRNA00196
| |
− | |NA
| |
− | |pathogenic process
| |
− | |rheumatoid arthritis;psoriasis
| |
− | |Immune System Diseases;Musculoskeletal Diseases;Skin and Connective Tissue Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289868 HSALNT0289868]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289868 HSALNG0141983]
| |
− | |HLA-AS1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |psoriasis;liver injury;multiple sclerosis;AIDS
| |
− | |Skin and Connective Tissue Diseases;Immune System Diseases;Virus Diseases;Digestive System Diseases;Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290154 HSALNT0290154]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290154 HSALNG0142269]
| |
− | |PRINS
| |
− | |NCRNA00074
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |psoriasis;prostate cancer
| |
− | |Skin and Connective Tissue Diseases;Male Urogenital Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0262809 HSALNT0262809]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0262809 HSALNG0127790]
| |
− | |PEG3-AS1
| |
− | |PEG3AS,PEG3-AS,APEG3,NCRNA00155
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289533 HSALNT0289533]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289533 HSALNG0141648]
| |
− | |7SL
| |
− | |7S RNA,SRP RNA,4.5S SRP RNA,4.5S RNA,RN7SL1 RNA,ENSG00000258486,lnc-LRR1-1:1
| |
− | |protein localization
| |
− | |pathogenic process
| |
− | |AIDS;Leishmaniasis;dermatomyositis;polymyositis
| |
− | |Skin and Connective Tissue Diseases;Immune System Diseases;Virus Diseases;Musculoskeletal Diseases;Parasitic Diseases;Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290081 HSALNT0290081]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290081 HSALNG0142196]
| |
− | |NDM29
| |
− | |29A,lnc-C11orf16-1:1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |neuroblastoma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289382 HSALNT0289382]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289382 HSALNG0074439]
| |
− | |NRON
| |
− | |NCRNA00194
| |
− | |NA
| |
− | |pathogenic process
| |
− | |AIDS;Down syndrome;HIV
| |
− | |Immune System Diseases;Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Nervous System Diseases;Virus Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289253 HSALNT0289253]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289253 HSALNG0065926]
| |
− | |SNHG6
| |
− | |U87HG,HBII-276HG,NCRNA00058
| |
− | |translational control;ceRNA
| |
− | |pathogenic process
| |
− | |hepatocellular cancer;hereditary haemorrhagic telangiectasia
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Cardiovascular Diseases;Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289653 HSALNT0289653]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289653 HSALNG0141768]
| |
− | |Beta-globin transcript
| |
− | |AY195961.1,NONHSAT017674,AY034469.1,NONHSAT017675,AY034470.1,NONHSAT017676
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290398 HSALNT0290398]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290398 HSALNG0142513]
| |
− | |Zfhx2as
| |
− | |Zfh-5AS,ENSG00000157306,ENST00000554403.1
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0011306 HSALNT0011306]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0011306 HSALNG0005433]
| |
− | |MIR137HG
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |schizophrenia;lung cancer;malignant lymphoma
| |
− | |Respiratory Tract Diseases;Mental Disorders;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289449 HSALNT0289449]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289449 HSALNG0056858]
| |
− | |HOXA-AS3
| |
− | |HOXA6as
| |
− | |NA
| |
− | |pathogenic process
| |
− | |glioma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289451 HSALNT0289451]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289451 HSALNG0068551]
| |
− | |CCDC26
| |
− | |MGC27434,RAM
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |hematological malignancies;glioma;acute myeloid leukemia;leukemia;pancreatic cancer;breast cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms;Hemic and Lymphatic Diseases;Endocrine System Diseases;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289893 HSALNT0289893]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289893 HSALNG0142008]
| |
− | |LINC00271
| |
− | |C6orf217,NCRNA00271
| |
− | |NA
| |
− | |pathogenic process
| |
− | |type 2 diabetes;schizophrenia
| |
− | |Nutritional and Metabolic Diseases;Mental Disorders;Endocrine System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288892 HSALNT0288892]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288892 HSALNG0109621]
| |
− | |BCAR4
| |
− | |NA
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |osteosarcoma;breast cancer;colorectal cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289890 HSALNT0289890]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289890 HSALNG0142005]
| |
− | |LINC00032
| |
− | |C9orf14,NCRNA00032
| |
− | |NA
| |
− | |pathogenic process
| |
− | |narcolepsy;melanoma
| |
− | |Mental Disorders;Neoplasms;Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0274572 HSALNT0274572]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0274572 HSALNG0133591]
| |
− | |PICSAR
| |
− | |C21orf113,LINC00162,NCRNA00162,NLC1-C,NLC1C,PRED74
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |testicular embryonal cancer;narcolepsy;cutaneous squamous cell cancer
| |
− | |Male Urogenital Diseases;Mental Disorders;Neoplasms;Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0256354 HSALNT0256354]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0256354 HSALNG0124398]
| |
− | |UCA1
| |
− | |CUDR,LINC00178,NCRNA00178,UCAT1,onco-lncRNA-36
| |
− | |transcriptional regulation;ceRNA
| |
− | |developmental process;pathogenic process
| |
− | |oral squamous cell cancer;osteosarcoma;prostate cancer;ovarian cancer;non-small cell lung cancer;acute myocardial infarction;pancreaticobiliary maljunction;pancreatic cancer;melanoma;tongue squamous cell cancer;hepatocelluar cancer;bladder cancer;acute myeloid leukemia;esophageal squamous cell cancer;esophageal cancer;liver cancer;colorectal cancer;Pancreatic ductal adenocarcinoma;urinary bladder;gastric cancer;endometrial cancer;breast cancer;hepatocellular cancer;squamous cell cancer;lung cancer;renal cell cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms;Respiratory Tract Diseases;Male Urogenital Diseases;Female Urogenital Diseases and Pregnancy Complications;Cardiovascular Diseases;Endocrine System Diseases;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0003871 HSALNT0003871]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0003871 HSALNG0002066]
| |
− | |SNHG3
| |
− | |NCRNA00014,RNU17C,RNU17D,U17HG,U17HG-A,U17HG-AB
| |
− | |NA
| |
− | |pathogenic process
| |
− | |ovarian cancer;hepatocellular cancer;colorectal cancer;Alzheimer's disease
| |
− | |Neoplasms;Male Urogenital Diseases;Female Urogenital Diseases and Pregnancy Complications;Mental Disorders;Endocrine System Diseases;Digestive System Diseases;Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289475 HSALNT0289475]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289475 HSALNG0131591]
| |
− | |HAR1A
| |
− | |HAR1F,NCRNA00064,LINC00064
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |Huntington disease;Alzheimer's disease
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Mental Disorders;Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288995 HSALNT0288995]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288995 HSALNG0131589]
| |
− | |HAR1B
| |
− | |HAR1R,NCRNA00065,LINC00065
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |Huntington disease;hereditary haemorrhagic telangiectasia;Alzheimer's disease
| |
− | |Mental Disorders;Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Cardiovascular Diseases;Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288958 HSALNT0288958]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288958 HSALNG0044150]
| |
− | |EPB41L4A-AS1
| |
− | |C5orf26,NCRNA00219,TIGA1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |lung cancer;cancer
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289170 HSALNT0289170]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289170 HSALNG0134655]
| |
− | |MIAT
| |
− | |C22orf35,FLJ25967,Rncr2,gomafu,NCRNA00066,LINC00066,lncRNA-MIAT
| |
− | |splicing regulation;ceRNA
| |
− | |pathogenic process
| |
− | |prostate cancer;chronic lymphocytic leukemia;cancer;drug abuse;diabetes-induced microvascular dysfunction;schizophrenia;acute myocardial infarction;dilated cardiomyopathy;lung adenocarcinoma;diabetic retinopathy;myocardial infarction;Alzheimer's disease
| |
− | |Neoplasms;Respiratory Tract Diseases;Immune System Diseases;Male Urogenital Diseases;Chemically-Induced Disorders;Hemic and Lymphatic Diseases;Cardiovascular Diseases;Mental Disorders;Endocrine System Diseases;Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289007 HSALNT0289007]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289007 HSALNG0047947]
| |
− | |HULC
| |
− | |NCRNA00078,LINC00078,HCCAT1
| |
− | |transcriptional regulation;ceRNA
| |
− | |pathogenic process
| |
− | |prostate cancer;glioma;hepatocelluar cancer;osteosarcoma;atherosclerosis;gastric cancer;hepatocellular cancer;esophageal cancer;liver cirrhosis;diffuse large B-cell lymphoma;pancreatic cancer;papillary thyroid cancer;liver cancer;cervical cancer;colorectal cancer
| |
− | |Neoplasms;Male Urogenital Diseases;Hemic and Lymphatic Diseases;Cardiovascular Diseases;Female Urogenital Diseases and Pregnancy Complications;Endocrine System Diseases;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288940 HSALNT0288940]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288940 HSALNG0023880]
| |
− | |EGOT
| |
− | |EGO,NCRNA00190
| |
− | |NA
| |
− | |pathogenic process;developmental process
| |
− | |prostate cancer;breast cancer
| |
− | |Skin and Connective Tissue Diseases;Male Urogenital Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289387 HSALNT0289387]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289387 HSALNG0001461]
| |
− | |PINK1-AS
| |
− | |PINK1-AS1,FLJ00387,PINK1A, naPINK1
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |glucose metabolism disorder;Parkinson's disease;diabetes
| |
− | |Nutritional and Metabolic Diseases;Endocrine System Diseases;Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289225 HSALNT0289225]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289225 HSALNG0068477]
| |
− | |PVT1
| |
− | |NCRNA00079,LINC00079,onco-lncRNA-100,MIR1204HG,PVT
| |
− | |transcriptional regulation;translational control
| |
− | |pathogenic process
| |
− | |murine plasmacytomas;prostate cancer;cancer;ovarian cancer;renal cancer;B-cell lymphoma;non-small cell lung cancer;pancreatic cancer;Hodgkin's lymphoma;asthma;hepatocelluar cancer;bladder cancer;plasmacytoma;cleft lip;acute promyelocytic leukemia;diabetic nephropathy;esophageal cancer;kidney cancer;type 1 diabetes;breast cancer;cervical cancer;diabetic kidney disease;hematological malignancies;colorectal cancer;neuroblastoma;cardiac hypertrophy;multiple myeloma;gastric cancer;lymphoma;type 2 diabetes;thyroid cancer;pleural mesothelioma;lung squamous cell cancer;Burkitt lymphoma;hepatocellular cancer;renal cell cancer
| |
− | |Skin and Connective Tissue Diseases;Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Neoplasms;Respiratory Tract Diseases;Nutritional and Metabolic Diseases;Male Urogenital Diseases;Immune System Diseases;Stomatognathic Diseases;Hemic and Lymphatic Diseases;Virus Diseases;Female Urogenital Diseases and Pregnancy Complications;Cardiovascular Diseases;Endocrine System Diseases;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289189 HSALNT0289189]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289189 HSALNG0073233]
| |
− | |NAMA
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |papillary thyroid cancer
| |
− | |Endocrine System Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0246525 HSALNT0246525]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0246525 HSALNG0119442]
| |
− | |NARF-AS1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatocellular cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0147433 HSALNT0147433]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0147433 HSALNG0070397]
| |
− | |CDKN2B-AS1
| |
− | |CDKN2BA,ANRIL,RP11-145E5.4,NCRNA00089,p15A, CDKN2B-A, PCAT12
| |
− | |siRNA;transcriptional regulation;ceRNA
| |
− | |pathogenic process
| |
− | |glaucoma;prostate cancer;glioma;cancer;osteosarcoma;neurofibromatosis;ischemic heart failure;stroke;non-small cell lung cancer;hypertension;intracranial aneurysm;aortic aneurysm;periodontitis;acute lymphoblastic leukemia;Alzheimer's disease;coronary artery disease;melanoma;bladder cancer;abdominal aortic aneurysm;ovarian cancer;esophageal cancer;basal cell cancer;breast cancer;cervical cancer;coronary heart disease;gallbladder cancer;acute myocardial infarction;colorectal cancer;neuroblastoma;peripheral artery disease;esophageal squamous cell cancer;atherosclerosis;leukemia;hereditary cutaneous malignant melanoma;gastric cancer;cardiovascular disease;coronary disease;frailty;diabetes;type 2 diabetes;thyroid cancer;primary open-angle glaucoma;ischemic stroke;plexiform neurofibroma;laryngeal squamous cell cancer;hepatocellular cancer;nasopharyngeal cancer;myocardial infarction;lung cancer;endometriosis;primary myelofibrosis
| |
− | |Eye Diseases;Skin and Connective Tissue Diseases;Pathological Conditions, Signs and Symptoms;Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Neoplasms;Respiratory Tract Diseases;Nutritional and Metabolic Diseases;Male Urogenital Diseases;Stomatognathic Diseases;Immune System Diseases;Hemic and Lymphatic Diseases;Female Urogenital Diseases and Pregnancy Complications;Cardiovascular Diseases;Mental Disorders;Nervous System Diseases;Otorhinolaryngologic Diseases;Endocrine System Diseases;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0050854 HSALNT0050854]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0050854 HSALNG0024099]
| |
− | |GHRLOS
| |
− | |NCRNA00068,GHRL-AS1
| |
− | |transcriptional regulation
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288959 HSALNT0288959]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288959 HSALNG0026279]
| |
− | |ESRG
| |
− | |HESRG
| |
− | |NA
| |
− | |pathogenic process
| |
− | |embryonal cancer
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0287173 HSALNT0287173]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0287173 HSALNG0140560]
| |
− | |FMR1-AS1
| |
− | |FMR1A, FMR1-A,ASFMR1,FMR4
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |fragile X syndrome;neurological disorder
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289499 HSALNT0289499]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289499 HSALNG0141610]
| |
− | |HCG4
| |
− | |HCGIV-10,HCGIV.9
| |
− | |NA
| |
− | |pathogenic process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288994 HSALNT0288994]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288994 HSALNG0038609]
| |
− | |HAND2-AS1
| |
− | |DEIN,NBLA00301,FLJ11539
| |
− | |NA
| |
− | |pathogenic process
| |
− | |neuroblastoma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289286 HSALNT0289286]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289286 HSALNG0019362]
| |
− | |ZEB2-AS1
| |
− | |ZEB2A, ZEB2-A,ZEB2NAT
| |
− | |splicing regulation
| |
− | |pathogenic process
| |
− | |bladder cancer;hepatocellular cancer
| |
− | |Male Urogenital Diseases;Female Urogenital Diseases and Pregnancy Complications;Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0017702 HSALNT0017702]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0017702 HSALNG0008545]
| |
− | |GAS5
| |
− | |SNHG2,NCRNA00030
| |
− | |transcriptional regulation;ceRNA
| |
− | |pathogenic process
| |
− | |varicose great saphenous veins;prostate cancer;glioma;cancer;ovarian cancer;non-small cell lung cancer;hypertension;pancreatic cancer;B-cell neoplasms;melanoma;head and neck cancer;hepatocelluar cancer;bladder cancer;autoimmune disease;liver fibrosis;kidney cancer;breast cancer;cervical cancer;colorectal cancer;multiple myeloma;gastric cancer;osteoarthritis;endometrial cancer;lymphoma;type 2 diabetes;pleural mesothelioma;hepatocellular cancer;lung adenocarcinoma;lung cancer;renal cell cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms;Respiratory Tract Diseases;Immune System Diseases;Male Urogenital Diseases;Nutritional and Metabolic Diseases;Hemic and Lymphatic Diseases;Musculoskeletal Diseases;Cardiovascular Diseases;Female Urogenital Diseases and Pregnancy Complications;Endocrine System Diseases;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288891 HSALNT0288891]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288891 HSALNG0087449]
| |
− | |BACE1-AS
| |
− | |BACE1A,FJ573250,NCRNA00177,BACE1-AS1
| |
− | |translational control;transcriptional regulation
| |
− | |pathogenic process
| |
− | |ovarian cancer;colorectal cancer;Alzheimer's disease
| |
− | |Neoplasms;Female Urogenital Diseases and Pregnancy Complications;Mental Disorders;Nervous System Diseases;Endocrine System Diseases;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289414 HSALNT0289414]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289414 HSALNG0133533]
| |
− | |TRPM2-AS
| |
− | |TRPM2-AS1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |melanoma;prostate cancer
| |
− | |Male Urogenital Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288935 HSALNT0288935]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288935 HSALNG0008462]
| |
− | |DNM3OS
| |
− | |DNM3-AS1,MIR199A2HG
| |
− | |NA
| |
− | |pathogenic process
| |
− | |epithelial ovarian cancer
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288930 HSALNT0288930]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288930 HSALNG0133982]
| |
− | |DGCR5
| |
− | |NCRNA00037,LINC00037
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |Huntington disease;DiGeorge syndrome;velocardiofacial syndrome;clear cell renal cell cancer
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Neoplasms;Male Urogenital Diseases;Hemic and Lymphatic Diseases;Musculoskeletal Diseases;Cardiovascular Diseases;Female Urogenital Diseases and Pregnancy Complications;Mental Disorders;Endocrine System Diseases;Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288893 HSALNT0288893]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288893 HSALNG0083307]
| |
− | |BDNF-AS
| |
− | |BDNFO,BT2A,BT2B,BT2C,BT2D,NCRNA00049,BDNF-AS1,BDNFAS
| |
− | |siRNA;transcriptional regulation
| |
− | |developmental process;pathogenic process
| |
− | |Huntington disease;schizophrenia;psychiatric disease;obesity
| |
− | |Pathological Conditions, Signs and Symptoms;Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Nutritional and Metabolic Diseases;Mental Disorders;Physiological Phenomena;Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0120317 HSALNT0120317]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0120317 HSALNG0056850]
| |
− | |HOTAIRM1
| |
− | |HOXA-AS1,NCRNA00179,HOXA1-AS1
| |
− | |transcriptional regulation
| |
− | |pathogenic process;developmental process
| |
− | |colorectal cancer;Pancreatic ductal adenocarcinoma;promyelocytic leukemia;acute myeloid leukemia;infiltrating ductal cancers ;acute promyelocytic leukemia;leukemia;glioma
| |
− | |Neoplasms;Hemic and Lymphatic Diseases;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290158 HSALNT0290158]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290158 HSALNG0142273]
| |
− | |PTCSC1
| |
− | |PTCSC,AK023948,NCRNA00197
| |
− | |NA
| |
− | |pathogenic process
| |
− | |papillary thyroid cancer
| |
− | |Endocrine System Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289004 HSALNT0289004]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289004 HSALNG0091318]
| |
− | |HOTAIR
| |
− | |HOXC-AS4,HOXC11-AS1,NCRNA00072
| |
− | |siRNA;transcriptional regulation;ceRNA
| |
− | |pathogenic process
| |
− | |oral squamous cell cancer;prostate cancer;glioma;cancer;breast cancer;osteosarcoma;renal cancer;glioblastoma;non-small cell lung cancer;sarcoma;pancreatic cancer;large B-Cell lymphoma;bladder transitional cell cancer;B-cell neoplasms;melanoma;asthenozoospermia;hepatocelluar cancer;bladder cancer;acute myeloid leukemia;aortic valve calcification;infiltrating ductal cancers ;ovarian cancer;diffuse large B-cell lymphoma;gastrointestinal stromal tumor;atypical teratoid rhabdoid tumor;urothelial cancer;triple-negative breast cancer;gastric cardia adenocarcinoma;cervical cancer;temporomandibular joint osteoarthritis;gallbladder cancer;esophageal squamous cell cancer;colorectal cancer;Pancreatic ductal adenocarcinoma;rheumatoid arthritis;gastric cancer ;pre-eclampsia;acute leukemia;small cell lung cancer;multiple myeloma;gastric cancer;osteoarthritis;LPS-induced sepsis;endometrial cancer;head and neck squamous cell cancer;gastric adenocarcinoma;lung cancer;liver cancer;ischemic stroke;ischemic heart failure;laryngeal squamous cell cancer;pituitary adenoma;hepatocellular cancer;nasopharyngeal cancer;lung adenocarcinoma;papillary thyroid cancer;Parkinson's disease;renal cell cancer;gastrointestinal cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms;Respiratory Tract Diseases;Immune System Diseases;Male Urogenital Diseases;Stomatognathic Diseases;Hemic and Lymphatic Diseases;Virus Diseases;Musculoskeletal Diseases;Female Urogenital Diseases and Pregnancy Complications;Cardiovascular Diseases;Otorhinolaryngologic Diseases;Endocrine System Diseases;Digestive System Diseases;Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289192 HSALNT0289192]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289192 HSALNG0084892]
| |
− | |NEAT1
| |
− | |NCRNA00084,TncRNA,MENepsilon/beta,LINC00084,VINC
| |
− | |transcriptional regulation;ceRNA
| |
− | |pathogenic process
| |
− | |oral squamous cell cancer;glioma;ovarian cancer;amyotrophic lateral sclerosis;paraspeckle disintegration;nasopharyngeal cancer;AIDS;frontotemporal lobar degeneration;prostate cancer;systemic lupus erythematosus;renal syndrome;TDP-43-associated pathological states;HIV;Huntington disease;chronic lymphocytic leukemia;acute promyelocytic leukemia;esophageal squamous cell cancer;multiple sclerosis;breast cancer;intrauterine growth restriction;colorectal cancer;leukemia;gastric cancer;malignant pleural mesothelioma;endometrial cancer;gastric adenocarcinoma;papillary thyroid cancer;infertility;bladder cancer;hepatocellular cancer;non-small cell lung cancer;obesity;lung cancer;Parkinson's disease;laryngeal squamous cell cancer
| |
− | |Skin and Connective Tissue Diseases;Pathological Conditions, Signs and Symptoms;Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Neoplasms;Respiratory Tract Diseases;Immune System Diseases;Male Urogenital Diseases;Nutritional and Metabolic Diseases;Stomatognathic Diseases;Hemic and Lymphatic Diseases;Virus Diseases;Female Urogenital Diseases and Pregnancy Complications;Mental Disorders;Physiological Phenomena;Nervous System Diseases;Otorhinolaryngologic Diseases;Endocrine System Diseases;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0095094 HSALNT0095094]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0095094 HSALNG0045213]
| |
− | |SNHG4
| |
− | |U19H,NCRNA00059
| |
− | |NA
| |
− | |pathogenic process
| |
− | |myelodysplastic syndrome
| |
− | |Hemic and Lymphatic Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0245443 HSALNT0245443]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0245443 HSALNG0118855]
| |
− | |SNHG16
| |
− | |ncRAN,Nbla12061,Nbla10727
| |
− | |NA
| |
− | |pathogenic process
| |
− | |bladder cancer;bladder cancer;colorectal cancer;neuroblastoma
| |
− | |Male Urogenital Diseases;Female Urogenital Diseases and Pregnancy Complications;Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288897 HSALNT0288897]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288897 HSALNG0023698]
| |
− | |BOK-AS1
| |
− | |BOKA,NCRNA00151,NAToB
| |
− | |NA
| |
− | |pathogenic process
| |
− | |esophageal squamous cell cancer;testicular cancer;cancer
| |
− | |Male Urogenital Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289532 HSALNT0289532]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289532 HSALNG0141647]
| |
− | |7SK
| |
− | |7-3 RNA,K-RNA,7SK-RNA,7SK snRNA,RN7SK,ENSG00000202198,NONHSAT113149
| |
− | |transcriptional regulation
| |
− | |developmental process;pathogenic process
| |
− | |cancer;cardiac hypertrophy;gastric cancer;AIDS;multiple sclerosis;colorectal adenocarcinoma
| |
− | |Neoplasms;Immune System Diseases;Virus Diseases;Cardiovascular Diseases;Digestive System Diseases;Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289182 HSALNT0289182]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289182 HSALNG0017872]
| |
− | |MIR4435-2HG
| |
− | |MIR4435-1HG,LINC00978,AGD2,AK001796,lncRNA-AWPPH,MORRBID
| |
− | |NA
| |
− | |pathogenic process
| |
− | |lung cancer
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289200 HSALNT0289200]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289200 HSALNG0016500]
| |
− | |PARTICL
| |
− | |PARTICLE
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |low-dose irradiation
| |
− | |Disorders of Environmental Origin
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289172 HSALNT0289172]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289172 HSALNG0069266]
| |
− | |MINCR
| |
− | |LINC01604,TCONS_00015189
| |
− | |transcriptional regulation;ceRNA
| |
− | |pathogenic process
| |
− | |gallbladder cancer;Burkitt lymphoma
| |
− | |Neoplasms;Immune System Diseases;Hemic and Lymphatic Diseases;Virus Diseases;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0001792 HSALNT0001792]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0001792 HSALNG0000905]
| |
− | |NPPA-AS1
| |
− | |NPPAA, NPPA-AS
| |
− | |splicing regulation
| |
− | |pathogenic process
| |
− | |cardiovascular disease
| |
− | |Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290230 HSALNT0290230]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290230 HSALNG0142345]
| |
− | |RRP1B
| |
− | |NA
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |spinocerebellar ataxia;laryngeal squamous cell cancer;cancer
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Neoplasms;Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289467 HSALNT0289467]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289467 HSALNG0093062]
| |
− | |CLLU1
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289173 HSALNT0289173]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289173 HSALNG0087764]
| |
− | |MIR100HG
| |
− | |AGD1,lncRNA-N2,linc-NeD125
| |
− | |NA
| |
− | |developmental process;pathogenic process
| |
− | |myeloid leukemia;myopia;cervical cancer;neuroblastoma
| |
− | |Eye Diseases;Female Urogenital Diseases and Pregnancy Complications;Neoplasms;Hemic and Lymphatic Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0059175 HSALNT0059175]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0059175 HSALNG0028235]
| |
− | |TUSC7
| |
− | |LINC00902,LSAMP-AS1,LSAMP-AS3,LSAMPAS3,NCRNA00295
| |
− | |transcriptional regulation;ceRNA
| |
− | |pathogenic process
| |
− | |glioma;Pancreatic ductal adenocarcinoma;osteosarcoma;esophageal squamous cell cancer;ischemic heart failure;gastric cancer;hepatocellular cancer;non-small cell lung cancer;acute myeloid leukemia;colorectal cancer
| |
− | |Respiratory Tract Diseases;Cardiovascular Diseases;Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289647 HSALNT0289647]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289647 HSALNG0141762]
| |
− | |BC040587
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |osteosarcoma;breast cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0059186 HSALNT0059186]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0059186 HSALNG0028242]
| |
− | |LINC00901
| |
− | |LSAMP-AS4,TCONS_00005428,BC040587
| |
− | |NA
| |
− | |pathogenic process
| |
− | |osteosarcoma;gastric cancer;breast cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0233366 HSALNT0233366]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0233366 HSALNG0112604]
| |
− | |HCCAT5
| |
− | |HTA,FJ222407
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatocellular cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290040 HSALNT0290040]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290040 HSALNG0142155]
| |
− | |LSINCT5
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |chronic heart failure;colorectal cancer;ovarian cancer;gastric cancer;lung cancer;breast cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms;Respiratory Tract Diseases;Cardiovascular Diseases;Female Urogenital Diseases and Pregnancy Complications;Endocrine System Diseases;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0179611 HSALNT0179611]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0179611 HSALNG0086377]
| |
− | |DISC1FP1
| |
− | |Boymaw
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |schizophrenia
| |
− | |Mental Disorders
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0217643 HSALNT0217643]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0217643 HSALNG0104567]
| |
− | |SNHG14
| |
− | |115HG,IC-SNURF-SNRPN,LNCAT,NCRNA00214,U-UBE3A-AT, UBE3A-A, UBE3A-AS1,UBE3AATS
| |
− | |ceRNA
| |
− | |pathogenic process
| |
− | |Angelman syndrome;cerebral infarction;Prader-Willi syndrome
| |
− | |Nutritional and Metabolic Diseases;Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Cardiovascular Diseases;Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289273 HSALNT0289273]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289273 HSALNG0000343]
| |
− | |TP73-AS1
| |
− | |KIAA0495,PDAM
| |
− | |NA
| |
− | |pathogenic process
| |
− | |esophageal squamous cell cancer;oligodendroglial tumors;non-small cell lung cancer;glioblastoma;multiple myeloma
| |
− | |Neoplasms;Respiratory Tract Diseases;Immune System Diseases;Hemic and Lymphatic Diseases;Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290311 HSALNT0290311]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290311 HSALNG0142426]
| |
− | |TP53COR1
| |
− | |Trp53cor1
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |prostate cancer;colorectal cancer;hepatocelluar cancer;atherosclerosis;Burkitt lymphoma;chronic lymphocytic leukemia;B cell lymphoma;lung cancer;cervical cancer
| |
− | |Neoplasms;Respiratory Tract Diseases;Immune System Diseases;Male Urogenital Diseases;Hemic and Lymphatic Diseases;Virus Diseases;Cardiovascular Diseases;Female Urogenital Diseases and Pregnancy Complications;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289221 HSALNT0289221]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289221 HSALNG0068414]
| |
− | |PRNCR1
| |
− | |CARLo-3,PCAT8
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |gastric cancer;prostate cancer;glioma;colorectal cancer
| |
− | |Male Urogenital Diseases;Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0020131 HSALNT0020131]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0020131 HSALNG0009743]
| |
− | |PCAT6
| |
− | |KDM5B-AS1,ncRNA-a2,PCAN-R1,KDM5BAS1,onco-lncRNA-96
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |prostate cancer;triple-negative breast cancer;lung cancer
| |
− | |Respiratory Tract Diseases;Skin and Connective Tissue Diseases;Male Urogenital Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289277 HSALNT0289277]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289277 HSALNG0130723]
| |
− | |TRERNA1
| |
− | |LINC00651,ncRNA-a7,treRNA
| |
− | |transcriptional regulation
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0014972 HSALNT0014972]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0014972 HSALNG0007045]
| |
− | |FALEC
| |
− | |LINC00568,ncRNA-a1,FAL1
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |ovarian cancer;thyroid cancer
| |
− | |Female Urogenital Diseases and Pregnancy Complications;Endocrine System Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290008 HSALNT0290008]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290008 HSALNG0142123]
| |
− | |LOC100887755
| |
− | |Noncoding RNA activating7: ncRNA-a7,ENST00000431460.1,ENSG00000231265,TRERNA1
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |hepatocellular cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290248 HSALNT0290248]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290248 HSALNG0142363]
| |
− | |snaR
| |
− | |EU035784.1,lnc-BSPH1-1:1
| |
− | |transcriptional regulation
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289342 HSALNT0289342]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289342 HSALNG0138609]
| |
− | |JPX
| |
− | |NCRNA00183,ENOX,LINC00183,DCBALD06
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |hepatocellular cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289231 HSALNT0289231]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289231 HSALNG0001716]
| |
− | |RCAN3AS
| |
− | |TCONS_00001428
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289280 HSALNT0289280]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289280 HSALNG0069631]
| |
− | |VLDLR-AS1
| |
− | |lincRNA-VLDLR
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatocelluar cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288982 HSALNT0288982]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288982 HSALNG0138614]
| |
− | |FTX
| |
− | |NCRNA00182,MIR374AHG,LINC00182,FLJ33139
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |hepatocellular cancer;breast cancer;colorectal cancer;hepatocelluar cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0091079 HSALNT0091079]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0091079 HSALNG0043383]
| |
− | |MEF2C-AS1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cancer;Prader-Willi syndrome and Angelman syndrome
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Neoplasms;Digestive System Diseases;Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0189341 HSALNT0189341]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0189341 HSALNG0091277]
| |
− | |PCBP2-OT1
| |
− | |TUC338
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatocellular cancer;tongue squamous cell cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290373 HSALNT0290373]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290373 HSALNG0142488]
| |
− | |WRAP53
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatocellular cancer;cancer;dyskeratosis congenita
| |
− | |Skin and Connective Tissue Diseases;Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289265 HSALNT0289265]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289265 HSALNG0049949]
| |
− | |TDRG1
| |
− | |LINC00532,lincRNA-NRNA024015
| |
− | |NA
| |
− | |pathogenic process
| |
− | |esophageal squamous cell cancer;gastric cancer;testicular cancer;aplastic anemia
| |
− | |Male Urogenital Diseases;Neoplasms;Hemic and Lymphatic Diseases;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289175 HSALNT0289175]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289175 HSALNG0132382]
| |
− | |MIR155HG
| |
− | |MIRHG2,BIC,NCRNA00172
| |
− | |NA
| |
− | |pathogenic process
| |
− | |B-cell chronic lymphocytic leukemia;chronic lymphocytic leukemia;breast cancer;glioma
| |
− | |Immune System Diseases;Skin and Connective Tissue Diseases;Neoplasms;Hemic and Lymphatic Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289051 HSALNT0289051]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289051 HSALNG0024293]
| |
− | |LINC00620
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |cervical cancer
| |
− | |Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0120390 HSALNT0120390]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0120390 HSALNG0056871]
| |
− | |HOTTIP
| |
− | |NCRNA00213,HOXA-AS6,RP1-170O19.3,HOXA13-AS1
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |hirschsprung disease;colorectal cancer;prostate cancer;tongue squamous cell cancer;Pancreatic ductal adenocarcinoma;osteosarcoma;hepatocelluar cancer;gastric cancer;hepatocellular cancer;non-small cell lung cancer;pancreatic cancer;lung cancer;glioma
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Neoplasms;Respiratory Tract Diseases;Male Urogenital Diseases;Endocrine System Diseases;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289287 HSALNT0289287]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289287 HSALNG0130661]
| |
− | |ZFAS1
| |
− | |C20orf199,NCRNA00275,ZNFX1-AS1,HSUP1,HSUP2
| |
− | |transcriptional regulation;ceRNA
| |
− | |pathogenic process
| |
− | |gastric cancer;hepatocellular cancer;ductal cancer;colorectal cancer;breast cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289259 HSALNT0289259]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289259 HSALNG0045502]
| |
− | |SPRY4-IT1
| |
− | |SPRIGHTLY
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |prostate cancer;melanoma;glioma;esophageal squamous cell cancer;pre-eclampsia;bladder cancer;renal clear cell cancer;gastric cancer;hepatocellular cancer;non-small cell lung cancer;lung cancer;breast cancer;cervical cancer;colorectal cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms;Respiratory Tract Diseases;Male Urogenital Diseases;Female Urogenital Diseases and Pregnancy Complications;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0105595 HSALNT0105595]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0105595 HSALNG0049759]
| |
− | |PANDAR
| |
− | |PANDA
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |colorectal cancer;cancer;bladder cancer;gastric cancer;hepatocellular cancer;non-small cell lung cancer;p53-associated pathological states;breast cancer;renal cell cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms;Respiratory Tract Diseases;Male Urogenital Diseases;Female Urogenital Diseases and Pregnancy Complications;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0068185 HSALNT0068185]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0068185 HSALNG0032415]
| |
− | |HTT-AS
| |
− | |HTT-AS1,HTTAS
| |
− | |NA
| |
− | |pathogenic process
| |
− | |Huntington disease
| |
− | |Mental Disorders;Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0099036 HSALNT0099036]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0099036 HSALNG0047200]
| |
− | |HEIH
| |
− | |LINC-HEIH,lncRNA-HEIH,LINC00848,HCCAT2
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatocelluar cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0222533 HSALNT0222533]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0222533 HSALNG0107117]
| |
− | |NPTN-IT1
| |
− | |lncRNA-LET
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gallbladder cancer;colorectal cancer;hepatocelluar cancer;esophageal squamous cell cancer;lung squamous cell cancer;nasopharyngeal cancer;gastric cancer;hypoxia;squamous cell lung cancer;cervical cancer
| |
− | |Pathological Conditions, Signs and Symptoms;Neoplasms;Respiratory Tract Diseases;Stomatognathic Diseases;Female Urogenital Diseases and Pregnancy Complications;Otorhinolaryngologic Diseases;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289747 HSALNT0289747]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289747 HSALNG0141862]
| |
− | |DQ786243
| |
− | |NA
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |crohn's disease;colorectal cancer;hepatocelluar cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289204 HSALNT0289204]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289204 HSALNG0068414]
| |
− | |PCAT1
| |
− | |PCAT-1,PCA1
| |
− | |transcriptional regulation;ceRNA
| |
− | |pathogenic process
| |
− | |prostate cancer;colorectal cancer;esophageal squamous cell cancer;bladder cancer;hepatocellular cancer;lung cancer
| |
− | |Neoplasms;Respiratory Tract Diseases;Male Urogenital Diseases;Female Urogenital Diseases and Pregnancy Complications;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0275894 HSALNT0275894]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0275894 HSALNG0134403]
| |
− | |PCAT14
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |prostate cancer
| |
− | |Male Urogenital Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0211999 HSALNT0211999]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0211999 HSALNG0101780]
| |
− | |HIF1A-AS2
| |
− | |3'aHIF-1A,aHIF
| |
− | |translational control
| |
− | |pathogenic process
| |
− | |bladder cancer;osteosarcoma;renal cancer;glioblastoma;gastric cancer;acute myocardial infarction;kidney cancer;breast cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms;Male Urogenital Diseases;Cardiovascular Diseases;Female Urogenital Diseases and Pregnancy Complications;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288999 HSALNT0288999]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288999 HSALNG0101776]
| |
− | |HIF1A-AS1
| |
− | |5'aHIF-1A,5'aHIF1alpha
| |
− | |NA
| |
− | |pathogenic process
| |
− | |acute myocardial infarction;non-small cell lung cancer;cardiovascular disease;aortic aneurysm;thoracoabdominal aorta aneurysm;kidney cancer
| |
− | |Neoplasms;Respiratory Tract Diseases;Male Urogenital Diseases;Cardiovascular Diseases;Female Urogenital Diseases and Pregnancy Complications
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289258 HSALNT0289258]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289258 HSALNG0031034]
| |
− | |SOX2-OT
| |
− | |SOX2OT,DKFZp761J1324,NCRNA00043
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |colorectal cancer;esophageal squamous cell cancer;lung squamous cell cancer;retinal neurodegeneration;neurodevelopmental syndromes associated with the SOX2 locus;hepatocellular cancer;lung cancer;breast cancer;Alzheimer's disease
| |
− | |Eye Diseases;Skin and Connective Tissue Diseases;Neoplasms;Respiratory Tract Diseases;Mental Disorders;Digestive System Diseases;Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289700 HSALNT0289700]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289700 HSALNG0141815]
| |
− | |CDR1-AS
| |
− | |CDR1NAT,ciRS-7,CDR1as
| |
− | |ceRNA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289149 HSALNT0289149]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289149 HSALNG0050599]
| |
− | |LINCMD1
| |
− | |MIR133BHG,LINC-MD1
| |
− | |ceRNA
| |
− | |developmental process;pathogenic process
| |
− | |Duchenne muscular dystrophy
| |
− | |Musculoskeletal Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288894 HSALNT0288894]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288894 HSALNG0082362]
| |
− | |BGLT3
| |
− | |LINC01083,BGL3,lncRNA-BGL3
| |
− | |ceRNA
| |
− | |pathogenic process
| |
− | |chronic myeloid leukemia
| |
− | |Neoplasms;Hemic and Lymphatic Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289042 HSALNT0289042]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289042 HSALNG0055058]
| |
− | |LINC00473
| |
− | |C6orf176,bA142J11.1
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |non-small cell lung cancer;renal cell cancer
| |
− | |Respiratory Tract Diseases;Male Urogenital Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0101681 HSALNT0101681]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0101681 HSALNG0048223]
| |
− | |LINC01108
| |
− | |LncRNA-ES1
| |
− | |NA
| |
− | |developmental process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289418 HSALNT0289418]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289418 HSALNG0103465]
| |
− | |TUNAR
| |
− | |LINC00617,TUNA,HI-LNC78
| |
− | |transcriptional regulation
| |
− | |developmental process;pathogenic process
| |
− | |breast cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289197 HSALNT0289197]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289197 HSALNG0105343]
| |
− | |OIP5-AS1
| |
− | |cyrano,linc-OIP5
| |
− | |NA
| |
− | |developmental process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289046 HSALNT0289046]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289046 HSALNG0048515]
| |
− | |LINC00581
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |West Syndrome;West syndrome
| |
− | |Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289656 HSALNT0289656]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289656 HSALNG0141771]
| |
− | |BX118339
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |West syndrome
| |
− | |Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0021726 HSALNT0021726]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0021726 HSALNG0010465]
| |
− | |LINC00538
| |
− | |Yiya,PROX1UT
| |
− | |NA
| |
− | |pathogenic process
| |
− | |colorectal cancer;cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0273249 HSALNT0273249]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0273249 HSALNG0132926]
| |
− | |CBR3-AS1
| |
− | |PlncRNA-1,PlncRNA1
| |
− | |ceRNA
| |
− | |pathogenic process
| |
− | |esophageal squamous cell cancer;hepatocellular cancer;prostate cancer
| |
− | |Male Urogenital Diseases;Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289179 HSALNT0289179]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289179 HSALNG0070363]
| |
− | |MIR31HG
| |
− | |LOC554202,hsa-lnc-31,LncHIFCAR
| |
− | |ceRNA
| |
− | |pathogenic process
| |
− | |bladder cancer;gastric cancer;breast cancer;colorectal cancer;Pancreatic ductal adenocarcinoma
| |
− | |Skin and Connective Tissue Diseases;Neoplasms;Male Urogenital Diseases;Female Urogenital Diseases and Pregnancy Complications;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288925 HSALNT0288925]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288925 HSALNG0034419]
| |
− | |DANCR
| |
− | |KIAA0114,SNHG13,ANCR,AGU2,lncRNA-ANCR
| |
− | |transcriptional regulation
| |
− | |developmental process;pathogenic process
| |
− | |prostate cancer;colorectal cancer;osteosarcoma;bone diseases;postmenopausal osteoporosis;hepatocellular cancer;breast cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms;Male Urogenital Diseases;Musculoskeletal Diseases;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290329 HSALNT0290329]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290329 HSALNG0142444]
| |
− | |uc.388
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |colorectal cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289842 HSALNT0289842]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289842 HSALNG0141957]
| |
− | |FR0348383
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |prostate cancer
| |
− | |Male Urogenital Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289279 HSALNT0289279]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289279 HSALNG0141211]
| |
− | |TTTY15
| |
− | |DKFZP434I143,NCRNA00138
| |
− | |NA
| |
− | |pathogenic process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289718 HSALNT0289718]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289718 HSALNG0141833]
| |
− | |CRNDE
| |
− | |LOC643911,LINC00180,CRNDEP
| |
− | |transcriptional regulation;ceRNA
| |
− | |pathogenic process
| |
− | |gallbladder cancer;colorectal cancer;ovarian cancer;medulloblastoma;chronic lymphocytic leukemia;renal cell cancer;glioma
| |
− | |Neoplasms;Immune System Diseases;Male Urogenital Diseases;Hemic and Lymphatic Diseases;Female Urogenital Diseases and Pregnancy Complications;Endocrine System Diseases;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289685 HSALNT0289685]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289685 HSALNG0141800]
| |
− | |CCND1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |tumor;cervical cancer
| |
− | |Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289935 HSALNT0289935]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289935 HSALNG0142050]
| |
− | |lincRNA-p21
| |
− | |NA
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |lung cancer;cancer
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290134 HSALNT0290134]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290134 HSALNG0142249]
| |
− | |PCNCR1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |prostate cancer
| |
− | |Male Urogenital Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289492 HSALNT0289492]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289492 HSALNG0141603]
| |
− | |DBET
| |
− | |DBE-T,DUX4L30
| |
− | |transcriptional regulation
| |
− | |developmental process;pathogenic process
| |
− | |facioscapulohumeral muscular dystrophy
| |
− | |Musculoskeletal Diseases;Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289455 HSALNT0289455]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289455 HSALNG0071734]
| |
− | |BANCR
| |
− | |LINC00586
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |osteosarcoma ;lung cancer;melanoma;colorectal cancer;osteosarcoma;esophageal squamous cell cancer;bladder cancer;eosinophilic esophagitis;gastric cancer;hepatocellular cancer;non-small cell lung cancer;retinoblastoma;papillary thyroid cancer
| |
− | |Neoplasms;Respiratory Tract Diseases;Immune System Diseases;Male Urogenital Diseases;Hemic and Lymphatic Diseases;Female Urogenital Diseases and Pregnancy Complications;Endocrine System Diseases;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0209589 HSALNT0209589]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0209589 HSALNG0100636]
| |
− | |PTCSC3
| |
− | |NA
| |
− | |ceRNA
| |
− | |pathogenic process
| |
− | |papillary thyroid cancer;thyroid cancer
| |
− | |Endocrine System Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290063 HSALNT0290063]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290063 HSALNG0142178]
| |
− | |MVIH
| |
− | |NA
| |
− | |ceRNA
| |
− | |pathogenic process
| |
− | |hepatocellular cancer;non-small cell lung cancer;breast cancer;microvascular invasion in hepatocellular cancer;hepatocelluar cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms;Respiratory Tract Diseases;Cardiovascular Diseases;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289103 HSALNT0289103]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289103 HSALNG0052921]
| |
− | |LINC01268
| |
− | |LOC285758
| |
− | |NA
| |
− | |pathogenic process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289070 HSALNT0289070]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289070 HSALNG0031716]
| |
− | |LINC00887
| |
− | |linc-ATP13A4-8,HEIRCC
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |hypoxic and inflammatory renal epithelial injury;renal clear cell cancer
| |
− | |Male Urogenital Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288931 HSALNT0288931]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288931 HSALNG0100075]
| |
− | |DHRS4-AS1
| |
− | |C14orf167,PRO1488,AS1DHRS4
| |
− | |transcriptional regulation
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288974 HSALNT0288974]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288974 HSALNG0113304]
| |
− | |FENDRR
| |
− | |FOXF1-AS1,TCONS_00024240,lincFOXF1,onco-lncRNA-21
| |
− | |transcriptional regulation
| |
− | |developmental process;pathogenic process
| |
− | |osteosarcoma;gastric cancer;non-small cell lung cancer;lung cancer
| |
− | |Respiratory Tract Diseases;Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0106473 HSALNT0106473]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0106473 HSALNG0050235]
| |
− | |LINC01512
| |
− | |LOC100132354,TCONS_00011120,HI-LNC77
| |
− | |NA
| |
− | |pathogenic process
| |
− | |lung adenocarcinoma;type 2 diabetes
| |
− | |Respiratory Tract Diseases;Nutritional and Metabolic Diseases;Endocrine System Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289059 HSALNT0289059]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289059 HSALNG0118547]
| |
− | |LINC00673
| |
− | |HI-LNC75,HILNC75,LUCAIR1,SLNCR,SLNCR1
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |pancreatic cancer;type 2 diabetes;non-small cell lung cancer;melanoma;Pancreatic ductal adenocarcinoma
| |
− | |Neoplasms;Respiratory Tract Diseases;Nutritional and Metabolic Diseases;Endocrine System Diseases;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289107 HSALNT0289107]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289107 HSALNG0128306]
| |
− | |LINC01433
| |
− | |LOC728228
| |
− | |NA
| |
− | |pathogenic process
| |
− | |lung cancer
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0143571 HSALNT0143571]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0143571 HSALNG0068424]
| |
− | |CCAT1
| |
− | |CARLo-5,onco-lncRNA-40
| |
− | |ceRNA
| |
− | |pathogenic process
| |
− | |gallbladder cancer;glioma;hepatocelluar cancer;ovarian cancer;acute myeloid leukemia;gastric cancer;hepatocellular cancer;non-small cell lung cancer;lung adenocarcinoma;endometrial cancer;lung cancer;breast cancer;colorectal cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms;Respiratory Tract Diseases;Female Urogenital Diseases and Pregnancy Complications;Endocrine System Diseases;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289408 HSALNT0289408]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289408 HSALNG0123467]
| |
− | |TINCR
| |
− | |ENST00000448587.1,FLJ90734,NCRNA00036,LINC00036,onco-lncRNA-16
| |
− | |translational control
| |
− | |pathogenic process;developmental process
| |
− | |bladder cancer;colorectal cancer;esophageal squamous cell cancer;gastric cancer;skin desease;squamous cell cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms;Male Urogenital Diseases;Female Urogenital Diseases and Pregnancy Complications;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289152 HSALNT0289152]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289152 HSALNG0060113]
| |
− | |LNCPRESS1
| |
− | |lncPRESS1
| |
− | |translational control
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289145 HSALNT0289145]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289145 HSALNG0075843]
| |
− | |LINC02561
| |
− | |RP11-445P17.8
| |
− | |NA
| |
− | |pathogenic process
| |
− | |cystic fibrosis
| |
− | |Respiratory Tract Diseases;Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289065 HSALNT0289065]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289065 HSALNG0140616]
| |
− | |LINC00850
| |
− | |KUCG1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |Duchenne muscular dystrophy
| |
− | |Musculoskeletal Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289431 HSALNT0289431]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289431 HSALNG0032699]
| |
− | |AFAP1-AS1
| |
− | |AFAP1A, AFAP1-A,MGC10981
| |
− | |NA
| |
− | |pathogenic process
| |
− | |non-small cell lung cancer;colorectal cancer;Pancreatic ductal adenocarcinoma;esophageal squamous cell cancer;hepatocellular cancer;nasopharyngeal cancer;lung adenocarcinoma;pancreatic cancer;Barrett's Esophagus;lung cancer
| |
− | |Neoplasms;Respiratory Tract Diseases;Stomatognathic Diseases;Otorhinolaryngologic Diseases;Endocrine System Diseases;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289519 HSALNT0289519]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289519 HSALNG0141630]
| |
− | |XACT
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0248684 HSALNT0248684]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0248684 HSALNG0120344]
| |
− | |GATA6-AS1
| |
− | |locus5689,BM742401
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cancer;chronic lymphocytic leukemia
| |
− | |Immune System Diseases;Neoplasms;Hemic and Lymphatic Diseases;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289222 HSALNT0289222]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289222 HSALNG0073144]
| |
− | |PTCSC2
| |
− | |NA
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |papillary thyroid cancer
| |
− | |Endocrine System Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289655 HSALNT0289655]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289655 HSALNG0141770]
| |
− | |BTG3-AS1
| |
− | |ASBEL
| |
− | |translational control
| |
− | |pathogenic process
| |
− | |ovarian cancer;colorectal cancer
| |
− | |Endocrine System Diseases;Female Urogenital Diseases and Pregnancy Complications;Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289224 HSALNT0289224]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289224 HSALNG0070801]
| |
− | |PTENP1
| |
− | |NONHSAT130775,PTENpg1,PTEN2,ENSG00000237984
| |
− | |transcriptional regulation;ceRNA
| |
− | |pathogenic process
| |
− | |gastric cancer;prostate cancer;renal cell cancer;cancer;hepatocelluar cancer
| |
− | |Male Urogenital Diseases;Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290129 HSALNT0290129]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290129 HSALNG0142244]
| |
− | |PAN
| |
− | |NA
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |Kaposi's sarcoma
| |
− | |Neoplasms;Virus Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289939 HSALNT0289939]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289939 HSALNG0142054]
| |
− | |LINC-ROR
| |
− | |lincRNA-RoR,lincRNA-ST8SIA3,ROR
| |
− | |transcriptional regulation;ceRNA
| |
− | |pathogenic process
| |
− | |gallbladder cancer;liver cancer;glioma;malignant melanoma;unveal melanoma;breast cancer;gastric cancer;hepatocellular cancer;nasopharyngeal cancer;pancreatic cancer;endometrial cancer;triple-negative breast cancer;colorectal cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms;Stomatognathic Diseases;Female Urogenital Diseases and Pregnancy Complications;Otorhinolaryngologic Diseases;Endocrine System Diseases;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290322 HSALNT0290322]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290322 HSALNG0142437]
| |
− | |UBE3A-ATS
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |Angelman syndrome
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0091004 HSALNT0091004]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0091004 HSALNG0043367]
| |
− | |LINC00461
| |
− | |EyeLinc1,Visc-1a,Visc-1b,Visc-2,LOC645323
| |
− | |NA
| |
− | |pathogenic process;developmental process
| |
− | |retinal and visual function
| |
− | |Eye Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289491 HSALNT0289491]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289491 HSALNG0141602]
| |
− | |CTBP1-AS
| |
− | |PCAT10
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |chronic hepatitis C;prostate cancer;polycystic ovary syndrome
| |
− | |Neoplasms;Male Urogenital Diseases;Virus Diseases;Female Urogenital Diseases and Pregnancy Complications;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0037401 HSALNT0037401]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0037401 HSALNG0017694]
| |
− | |GACAT1
| |
− | |LINC00876,AC096655.1-002
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0120344 HSALNT0120344]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0120344 HSALNG0056854]
| |
− | |HOXA-AS2
| |
− | |HOXA3as
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |promyelocytic leukemia;gastric cancer
| |
− | |Neoplasms;Hemic and Lymphatic Diseases;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0091313 HSALNT0091313]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0091313 HSALNG0043441]
| |
− | |LUCAT1
| |
− | |SCAL1
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |non-small cell lung cancer;lung cancer
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289425 HSALNT0289425]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289425 HSALNG0009941]
| |
− | |BLACAT1
| |
− | |linc-UBC1,LINC00912,onco-lncRNA-30
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |bladder cancer;gastric cancer
| |
− | |Male Urogenital Diseases;Female Urogenital Diseases and Pregnancy Complications;Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0149012 HSALNT0149012]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0149012 HSALNG0071221]
| |
− | |GLIDR
| |
− | |LINC01172,MGC21881,TCONS_00015562
| |
− | |NA
| |
− | |pathogenic process
| |
− | |glioblastoma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0217561 HSALNT0217561]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0217561 HSALNG0104548]
| |
− | |PWAR5
| |
− | |PAR5,PAR-5
| |
− | |NA
| |
− | |pathogenic process
| |
− | |glioblastoma;Prader-Willi syndrome and Angelman syndrome;Prader-Willi syndrome
| |
− | |Nutritional and Metabolic Diseases;Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Neoplasms;Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289272 HSALNT0289272]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289272 HSALNG0059377]
| |
− | |TP53TG1
| |
− | |TP53AP1,H_RG012D21.9,LINC00096
| |
− | |NA
| |
− | |pathogenic process
| |
− | |non-small cell lung cancer;ataxia telangiectasia
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Neoplasms;Respiratory Tract Diseases;Immune System Diseases;Nutritional and Metabolic Diseases;Cardiovascular Diseases;Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289598 HSALNT0289598]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289598 HSALNG0141713]
| |
− | |AK126698
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |non-small cell lung cancer
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0217598 HSALNT0217598]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0217598 HSALNG0104558]
| |
− | |IPW
| |
− | |NCRNA00002
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |Prader-Willi syndrome
| |
− | |Nutritional and Metabolic Diseases;Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0143633 HSALNT0143633]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0143633 HSALNG0068443]
| |
− | |CCAT2
| |
− | |NCCP1,LINC00873
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |non-small cell lung cancer;oral squamous cell cancer;colorectal cancer;ovarian cancer;esophageal squamous cell cancer;bladder cancer;small cell lung cancer;gastric cancer;hepatocellular cancer;prostate cancer;cervical squamous cell cancer;lung cancer;breast cancer;cervical cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms;Respiratory Tract Diseases;Male Urogenital Diseases;Female Urogenital Diseases and Pregnancy Complications;Endocrine System Diseases;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289026 HSALNT0289026]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289026 HSALNG0129180]
| |
− | |LINC00261
| |
− | |C20orf56,NCRNA00261,bA216C10.1,HCCDR1,TCONS_00027846,ALIEN,DEANR1,onco-lncRNA-17
| |
− | |NA
| |
− | |pathogenic process
| |
− | |pancreatic cancer;non-small cell lung cancer;gastric cancer
| |
− | |Respiratory Tract Diseases;Endocrine System Diseases;Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289078 HSALNT0289078]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289078 HSALNG0000303]
| |
− | |LINC00982
| |
− | |FLJ42875
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290082 HSALNT0290082]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290082 HSALNG0142197]
| |
− | |NEAT1_2
| |
− | |NEAT1_2
| |
− | |protein localization
| |
− | |pathogenic process
| |
− | |amyotrophic lateral sclerosis
| |
− | |Nutritional and Metabolic Diseases;Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288989 HSALNT0288989]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288989 HSALNG0076040]
| |
− | |GATA3-AS1
| |
− | |NA
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |renal cell cancer
| |
− | |Male Urogenital Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289427 HSALNT0289427]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289427 HSALNG0004297]
| |
− | |GNG12-AS1
| |
− | |NA
| |
− | |transcriptional regulation
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290395 HSALNT0290395]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290395 HSALNG0142510]
| |
− | |YAM1
| |
− | |Yam-1
| |
− | |transcriptional regulation
| |
− | |pathogenic process;developmental process
| |
− | |skeletal myogenesis
| |
− | |Musculoskeletal Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289202 HSALNT0289202]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289202 HSALNG0018036]
| |
− | |PAX8-AS1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |malignant pleural mesothelioma;cervical cancer
| |
− | |Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0054469 HSALNT0054469]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0054469 HSALNG0026023]
| |
− | |RASSF1-AS1
| |
− | |ANRASSF1
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |breast cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290261 HSALNT0290261]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290261 HSALNG0142376]
| |
− | |SUMO1P3
| |
− | |SUMO1P3
| |
− | |NA
| |
− | |pathogenic process
| |
− | |bladder cancer;gastric cancer
| |
− | |Male Urogenital Diseases;Female Urogenital Diseases and Pregnancy Complications;Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289002 HSALNT0289002]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289002 HSALNG0094549]
| |
− | |HNF1A-AS1
| |
− | |C12orf27,NCRNA00262,FLJ38690,HAS1
| |
− | |ceRNA
| |
− | |pathogenic process
| |
− | |esophageal adenocarcinoma;osteosarcoma;esophageal squamous cell cancer;gastric cancer;hepatocellular cancer;nasopharyngeal cancer;adenocarcinoma;lung adenocarcinoma;pancreatic cancer
| |
− | |Neoplasms;Respiratory Tract Diseases;Otorhinolaryngologic Diseases;Endocrine System Diseases;Digestive System Diseases;Stomatognathic Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289377 HSALNT0289377]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289377 HSALNG0041218]
| |
− | |NIPBL-AS1
| |
− | |NIPBL-DT,NIPBL-AS
| |
− | |NA
| |
− | |pathogenic process
| |
− | |autism spectrum disorder
| |
− | |Mental Disorders
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289249 HSALNT0289249]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289249 HSALNG0057702]
| |
− | |SNHG15
| |
− | |C7orf40,FLJ38860,MYO1GUT,Linc-Myo1g
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cancer;hepatocellular cancer;hereditary haemorrhagic telangiectasia
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Cardiovascular Diseases;Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0235898 HSALNT0235898]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0235898 HSALNG0113835]
| |
− | |MIR22HG
| |
− | |C17orf91,MGC14376,DKFZp686O06159
| |
− | |NA
| |
− | |pathogenic process
| |
− | |ovarian cancer
| |
− | |Endocrine System Diseases;Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0235898 HSALNT0235898]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0235898 HSALNG0113835]
| |
− | |MIR22HG
| |
− | |C17orf91,MGC14376,DKFZp686O06159
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288984 HSALNT0288984]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288984 HSALNG0119881]
| |
− | |GACAT2
| |
− | |MTCL1-AS1,HMlincRNA717
| |
− | |NA
| |
− | |pathogenic process
| |
− | |pancreatic cancer;non-small cell lung cancer;gastric cancer
| |
− | |Respiratory Tract Diseases;Endocrine System Diseases;Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289369 HSALNT0289369]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289369 HSALNG0134448]
| |
− | |MIF-AS1
| |
− | |LOC284889,MIF-AS
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |malaria;nephrolithiasis
| |
− | |Skin and Connective Tissue Diseases;Male Urogenital Diseases;Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Parasitic Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0129086 HSALNT0129086]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0129086 HSALNG0061385]
| |
− | |LINC-PINT
| |
− | |MKLN1-AS1,FLJ43663,PINT,LincRNA-Pint
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |colorectal cancer;heart failure
| |
− | |Pathological Conditions, Signs and Symptoms;Cardiovascular Diseases;Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289240 HSALNT0289240]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289240 HSALNG0020769]
| |
− | |SCHLAP1
| |
− | |LINC00913,SChLAP1,PCAT11
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |bladder cancer;prostate cancer
| |
− | |Male Urogenital Diseases;Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0193241 HSALNT0193241]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0193241 HSALNG0093119]
| |
− | |SOCS2-AS1
| |
− | |NA
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |prostate cancer
| |
− | |Male Urogenital Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0138824 HSALNT0138824]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0138824 HSALNG0066261]
| |
− | |CASC9
| |
− | |ESCCAL-1,ESSCAL1,LINC00981
| |
− | |NA
| |
− | |pathogenic process
| |
− | |esophageal squamous cell cancer;esophageal cancer
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0267627 HSALNT0267627]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0267627 HSALNG0130306]
| |
− | |HNF4A-AS1
| |
− | |uc002xlx
| |
− | |NA
| |
− | |pathogenic process
| |
− | |lung adenocarcinoma
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289194 HSALNT0289194]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289194 HSALNG0131196]
| |
− | |NKILA
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |nasopharyngeal cancer;breast cancer;tongue squamous cell cancer
| |
− | |Skin and Connective Tissue Diseases;Otorhinolaryngologic Diseases;Neoplasms;Stomatognathic Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289304 HSALNT0289304]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289304 HSALNG0088539]
| |
− | |LINC00942
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |ovarian cancer;autism spectrum disorder
| |
− | |Female Urogenital Diseases and Pregnancy Complications;Endocrine System Diseases;Mental Disorders;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289187 HSALNT0289187]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289187 HSALNG0062700]
| |
− | |MNX1-AS1
| |
− | |CCAT5,LOC645249
| |
− | |NA
| |
− | |pathogenic process
| |
− | |ovarian cancer;colorectal cancer
| |
− | |Endocrine System Diseases;Female Urogenital Diseases and Pregnancy Complications;Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289518 HSALNT0289518]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289518 HSALNG0141629]
| |
− | |VPS9D1-AS1
| |
− | |MYU
| |
− | |NA
| |
− | |pathogenic process
| |
− | |ovarian cancer;colorectal cancer
| |
− | |Endocrine System Diseases;Female Urogenital Diseases and Pregnancy Complications;Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290266 HSALNT0290266]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290266 HSALNG0142381]
| |
− | |TC0101441
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |epithelial ovarian cancer
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289426 HSALNT0289426]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289426 HSALNG0009856]
| |
− | |ERLNC1
| |
− | |TC0101441,ElncRNA1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |ovarian cancer
| |
− | |Endocrine System Diseases;Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290050 HSALNT0290050]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290050 HSALNG0142165]
| |
− | |Mdgt
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0043560 HSALNT0043560]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0043560 HSALNG0020594]
| |
− | |HAGLR
| |
− | |HOXD-AS1,Mdgt
| |
− | |NA
| |
− | |pathogenic process
| |
− | |bladder cancer;neuroblastoma
| |
− | |Male Urogenital Diseases;Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289092 HSALNT0289092]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289092 HSALNG0017541]
| |
− | |LINC01158
| |
− | |PANTR1,linc-Brn1a,linc-POU3F3
| |
− | |transcriptional regulation
| |
− | |pathogenic process;developmental process
| |
− | |esophageal squamous cell cancer;gastric cancer;glioma
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289448 HSALNT0289448]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289448 HSALNG0062110]
| |
− | |GHET1
| |
− | |lncRNA-GHET1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |bladder cancer;gastric cancer;colorectal cancer
| |
− | |Male Urogenital Diseases;Female Urogenital Diseases and Pregnancy Complications;Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289514 HSALNT0289514]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289514 HSALNG0141625]
| |
− | |PEG13
| |
− | |NA
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |intellectual disabilities
| |
− | |Behavior and Behavior Mechanisms;Pathological Conditions, Signs and Symptoms;Mental Disorders;Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289183 HSALNT0289183]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289183 HSALNG0140233]
| |
− | |MIR503HG
| |
− | |MGC16121,H19X
| |
− | |NA
| |
− | |pathogenic process
| |
− | |choriocarcinoma
| |
− | |Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289201 HSALNT0289201]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289201 HSALNG0083445]
| |
− | |PAUPAR
| |
− | |NA
| |
− | |transcriptional regulation
| |
− | |pathogenic process;developmental process
| |
− | |uveal melanoma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288956 HSALNT0288956]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288956 HSALNG0094171]
| |
− | |LINC01234
| |
− | |LCAL84,onco-lncRNA-32
| |
− | |ceRNA
| |
− | |pathogenic process
| |
− | |oesophageal squamous cell cancer;breast cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289021 HSALNT0289021]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289021 HSALNG0016642]
| |
− | |CYTOR
| |
− | |C2orf59,NCRNA00152,MGC4677
| |
− | |transcriptional regulation;ceRNA
| |
− | |pathogenic process
| |
− | |colorectal cancer;gastric cancer;hepatocellular cancer;pancreatic cancer;breast cancer;renal cell cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms;Male Urogenital Diseases;Endocrine System Diseases;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289706 HSALNT0289706]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289706 HSALNG0141821]
| |
− | |CHRF
| |
− | |NA
| |
− | |ceRNA
| |
− | |pathogenic process
| |
− | |cardiac hypertrophy;silicosis
| |
− | |Respiratory Tract Diseases;Occupational Diseases;Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0143635 HSALNT0143635]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0143635 HSALNG0068436]
| |
− | |CASC8
| |
− | |LINC00860,CARLo-1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |lung cancer
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0143672 HSALNT0143672]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0143672 HSALNG0068465]
| |
− | |CASC11
| |
− | |TCONS_00014535,LINC00990,CARLo-7,ENST00000518376
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |hepatocellular cancer;colorectal cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289032 HSALNT0289032]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289032 HSALNG0133191]
| |
− | |LINC00323
| |
− | |PRED42,FLJ37173
| |
− | |NA
| |
− | |pathogenic process
| |
− | |breast cancer;hereditary haemorrhagic telangiectasia
| |
− | |Skin and Connective Tissue Diseases;Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Cardiovascular Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0024655 HSALNT0024655]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0024655 HSALNG0011845]
| |
− | |LINC01139
| |
− | |LINK-A,TCONS_00000027
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hereditary haemorrhagic telangiectasia
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289018 HSALNT0289018]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289018 HSALNG0036270]
| |
− | |LEF1-AS1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hereditary haemorrhagic telangiectasia;colorectal cancer
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Cardiovascular Diseases;Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0247326 HSALNT0247326]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0247326 HSALNG0119753]
| |
− | |LINC00667
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hereditary haemorrhagic telangiectasia
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290145 HSALNT0290145]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290145 HSALNG0142260]
| |
− | |POU3F3
| |
− | |NA
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |esophageal squamous cell cancer;glioma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0199349 HSALNT0199349]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0199349 HSALNG0096112]
| |
− | |LINC00426
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |primary Sjögren's syndrome
| |
− | |Immune System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0155974 HSALNT0155974]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0155974 HSALNG0074744]
| |
− | |LINC00963
| |
− | |MetaLnc9
| |
− | |NA
| |
− | |pathogenic process
| |
− | |prostate cancer;renal cell cancer
| |
− | |Male Urogenital Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289211 HSALNT0289211]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289211 HSALNG0086124]
| |
− | |PCF11-AS1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatocellular cancer;adolescent idiopathic scoliosis
| |
− | |Musculoskeletal Diseases;Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289534 HSALNT0289534]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289534 HSALNG0141649]
| |
− | |91H
| |
− | |NA
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |osteosarcoma;esophageal squamous cell cancer;breast cancer;colorectal cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289446 HSALNT0289446]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289446 HSALNG0055679]
| |
− | |ELFN1-AS1
| |
− | |MYCLo-2
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |colorectal cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288883 HSALNT0288883]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288883 HSALNG0079547]
| |
− | |ACTA2-AS1
| |
− | |uc001kfo.1,ZXF1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |lung adenocarcinoma
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289443 HSALNT0289443]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289443 HSALNG0059132]
| |
− | |APTR
| |
− | |RSBN1L-AS1
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |liver fibrosis;glioblastoma
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289986 HSALNT0289986]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289986 HSALNG0142101]
| |
− | |lncRNA-MVIH
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatocellular cancer;non-small cell lung cancer
| |
− | |Respiratory Tract Diseases;Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289977 HSALNT0289977]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289977 HSALNG0142092]
| |
− | |lncRNA-ATB
| |
− | |NA
| |
− | |ceRNA
| |
− | |pathogenic process
| |
− | |colorectal cancer;hepatocelluar cancer;gastric cancer;pancreatic cancer;renal cell cancer;pneumoconiosis
| |
− | |Neoplasms;Respiratory Tract Diseases;Male Urogenital Diseases;Occupational Diseases;Endocrine System Diseases;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289622 HSALNT0289622]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289622 HSALNG0141737]
| |
− | |ATB
| |
− | |NA
| |
− | |ceRNA
| |
− | |pathogenic process
| |
− | |prostate cancer;glioma;keloid;gastric cancer;hepatocellular cancer;pancreatic cancer;breast cancer;colorectal cancer
| |
− | |Pathological Conditions, Signs and Symptoms;Skin and Connective Tissue Diseases;Neoplasms;Tissues;Male Urogenital Diseases;Endocrine System Diseases;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289586 HSALNT0289586]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289586 HSALNG0141701]
| |
− | |AK057054
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0278370 HSALNT0278370]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0278370 HSALNG0135702]
| |
− | |LINC01315
| |
− | |lnc-C22orf32-1,C22orf32-1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |nasopharyngeal cancer
| |
− | |Otorhinolaryngologic Diseases;Neoplasms;Stomatognathic Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0055601 HSALNT0055601]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0055601 HSALNG0026583]
| |
− | |ADAMTS9-AS2
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |non-small cell lung cancer;glioma
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289383 HSALNT0289383]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289383 HSALNG0009103]
| |
− | |PACERR
| |
− | |PACER,PTGS2-AS1
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |osteosarcoma;osteoarthritis;inflammation and cancer
| |
− | |Musculoskeletal Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289268 HSALNT0289268]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289268 HSALNG0010604]
| |
− | |TGFB2-OT1
| |
− | |FLJ11812
| |
− | |ceRNA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288938 HSALNT0288938]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288938 HSALNG0027860]
| |
− | |DUBR
| |
− | |LINC00883
| |
− | |ceRNA
| |
− | |pathogenic process
| |
− | |asthma and chronic obstructive pulmonary disease
| |
− | |Respiratory Tract Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290147 HSALNT0290147]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290147 HSALNG0142262]
| |
− | |POXCUT
| |
− | |TCONS_00011636
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289440 HSALNT0289440]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289440 HSALNG0047407]
| |
− | |FOXCUT
| |
− | |LINC01379,TCONS_00011636
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |esophageal squamous cell cancer;basal-like breast cancer;oral squamous cell cancer
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288924 HSALNT0288924]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288924 HSALNG0059521]
| |
− | |CYP51A1-AS1
| |
− | |ENST00000453068,LRRD1-AS1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |renal cell cancer
| |
− | |Male Urogenital Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289395 HSALNT0289395]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289395 HSALNG0036288]
| |
− | |RPL34-AS1
| |
− | |FLJ37673,RP11-462C24.1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cancer;colorectal cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289435 HSALNT0289435]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289435 HSALNG0045015]
| |
− | |C5orf66-AS1
| |
− | |CTC-276P9.1,Epist
| |
− | |NA
| |
− | |pathogenic process
| |
− | |esophageal squamous cell cancer;bladder cancer
| |
− | |Male Urogenital Diseases;Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289052 HSALNT0289052]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289052 HSALNG0006924]
| |
− | |LINC00623
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |nasopharyngeal cancer
| |
− | |Otorhinolaryngologic Diseases;Neoplasms;Stomatognathic Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289831 HSALNT0289831]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289831 HSALNG0141946]
| |
− | |FER1L4
| |
− | |FER1L4
| |
− | |ceRNA
| |
− | |pathogenic process
| |
− | |gastric cancer;endometrial cancer;colorectal cancer
| |
− | |Female Urogenital Diseases and Pregnancy Complications;Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288985 HSALNT0288985]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288985 HSALNG0013215]
| |
− | |GACAT3
| |
− | |LINC01458,lncRNA-AC130710
| |
− | |NA
| |
− | |pathogenic process
| |
− | |ovarian cancer;gastric cancer
| |
− | |Endocrine System Diseases;Female Urogenital Diseases and Pregnancy Complications;Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288881 HSALNT0288881]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288881 HSALNG0058863]
| |
− | |ABHD11-AS1
| |
− | |WBSCR26,LINC00035,NCRNA00035
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cancer;mutant huntingtin
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0282263 HSALNT0282263]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0282263 HSALNG0137651]
| |
− | |ZNF674-AS1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatocellular cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289207 HSALNT0289207]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289207 HSALNG0106864]
| |
− | |PCAT29
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |prostate cancer;glioma;bladder cancer;renal clear cell cancer;skin melanoma;hepatocellular cancer;lung adenocarcinoma;stomach adenocarcinoma
| |
− | |Neoplasms;Respiratory Tract Diseases;Male Urogenital Diseases;Female Urogenital Diseases and Pregnancy Complications;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289672 HSALNT0289672]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289672 HSALNG0141787]
| |
− | |CADM1
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289297 HSALNT0289297]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289297 HSALNG0007253]
| |
− | |LINC01527
| |
− | |lnc-SPRR2D-1,RP1-13P20.6
| |
− | |NA
| |
− | |pathogenic process
| |
− | |squamous cell cancer
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289158 HSALNT0289158]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289158 HSALNG0108520]
| |
− | |LUNAR1
| |
− | |NA
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |diffuse large B-cell lymphoma;T cell acute lymphoblastic leukemia
| |
− | |Hemic and Lymphatic Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289830 HSALNT0289830]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289830 HSALNG0141945]
| |
− | |FAR2P1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |lung adenocarcinoma;non-small cell lung cancer
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289263 HSALNT0289263]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289263 HSALNG0053580]
| |
− | |TARID
| |
− | |EYA4-AS1
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |kidney clear cell sarcoma
| |
− | |Male Urogenital Diseases;Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0145373 HSALNT0145373]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0145373 HSALNG0069286]
| |
− | |MAFA-AS1
| |
− | |RP11-909N17.3,TCONS_00014882
| |
− | |NA
| |
− | |pathogenic process
| |
− | |lung adenocarcinoma;non-small cell lung cancer
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290229 HSALNT0290229]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290229 HSALNG0142344]
| |
− | |RPLP0P2
| |
− | |RPLP0P2
| |
− | |NA
| |
− | |pathogenic process
| |
− | |lung adenocarcinoma
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289291 HSALNT0289291]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289291 HSALNG0133273]
| |
− | |ZNF295-AS1
| |
− | |C21orf121,NCRNA00318,PRED87
| |
− | |NA
| |
− | |pathogenic process
| |
− | |lung adenocarcinoma;epithelial ovarian cancer
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0084473 HSALNT0084473]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0084473 HSALNG0040150]
| |
− | |LINC01513
| |
− | |RP11-1C1.7,TCONS_00009352
| |
− | |NA
| |
− | |pathogenic process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289471 HSALNT0289471]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289471 HSALNG0108507]
| |
− | |IRAIN
| |
− | |IGF1R-AS
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |pancreatic cancer;acute myeloid leukemia;non-small cell lung cancer;breast cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms;Respiratory Tract Diseases;Endocrine System Diseases;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290402 HSALNT0290402]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290402 HSALNG0142517]
| |
− | |ZNRD1-AS1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatocellular cancer;lung cancer;cervical cancer
| |
− | |Respiratory Tract Diseases;Female Urogenital Diseases and Pregnancy Complications;Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289504 HSALNT0289504]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289504 HSALNG0141615]
| |
− | |LCAL1
| |
− | |onco-lncRNA-27
| |
− | |NA
| |
− | |pathogenic process
| |
− | |lung cancer
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289169 HSALNT0289169]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289169 HSALNG0100038]
| |
− | |MHRT
| |
− | |Myheart
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |heart hypertrophy;acute myocardial infarction
| |
− | |Pathological Conditions, Signs and Symptoms;Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289859 HSALNT0289859]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289859 HSALNG0141974]
| |
− | |HA117
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hirschsprung disease
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0026673 HSALNT0026673]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0026673 HSALNG0012722]
| |
− | |NRIR
| |
− | |lncRNA-CMPK2
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |chronic hepatitis C;HCV
| |
− | |Digestive System Diseases;Virus Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289887 HSALNT0289887]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289887 HSALNG0142002]
| |
− | |LET
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gallbladder cancer;esophageal squamous cell cancer;gastric cancer;nasopharyngeal cancer;renal cell cancer;cervical cancer
| |
− | |Neoplasms;Male Urogenital Diseases;Female Urogenital Diseases and Pregnancy Complications;Otorhinolaryngologic Diseases;Digestive System Diseases;Stomatognathic Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0007921 HSALNT0007921]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0007921 HSALNG0004023]
| |
− | |NFIA-AS1
| |
− | |RP5-833A20.1
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |atherosclerosis;glioma
| |
− | |Cardiovascular Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0247156 HSALNT0247156]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0247156 HSALNG0119710]
| |
− | |GAPLINC
| |
− | |LINC01540,TCONS_00026238,lncRNA-uc002kmd.1
| |
− | |siRNA
| |
− | |pathogenic process
| |
− | |gastric cancer;colorectal cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288917 HSALNT0288917]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288917 HSALNG0079313]
| |
− | |CERNA2
| |
− | |HOST2,lncRNA-HOST2
| |
− | |ceRNA
| |
− | |pathogenic process
| |
− | |hepatocellular cancer;epithelial ovarian cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289113 HSALNT0289113]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289113 HSALNG0050689]
| |
− | |LINC01564
| |
− | |TCONS_00011314
| |
− | |NA
| |
− | |pathogenic process
| |
− | |prostate cancer
| |
− | |Male Urogenital Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289088 HSALNT0289088]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289088 HSALNG0012685]
| |
− | |LINC01105
| |
− | |FLJ30594,LOC150622
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cancer;leukemia and neuroblastoma
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289464 HSALNT0289464]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289464 HSALNG0091650]
| |
− | |AGAP2-AS1
| |
− | |LOC100130776,PUNISHER
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |non-small cell lung cancer;glioma;leukemia and neuroblastoma
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288960 HSALNT0288960]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288960 HSALNG0106834]
| |
− | |EWSAT1
| |
− | |TMEM84,NCRNA00277,LINC00277,FLJ33768
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |Ewing sarcoma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289242 HSALNT0289242]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289242 HSALNG0074573]
| |
− | |SLC25A25-AS1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |colorectal cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289317 HSALNT0289317]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289317 HSALNG0130331]
| |
− | |KCNK15-AS1
| |
− | |RP11-445H22.4
| |
− | |NA
| |
− | |pathogenic process
| |
− | |osteoarthritis;breast cancer
| |
− | |Musculoskeletal Diseases;Skin and Connective Tissue Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289864 HSALNT0289864]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289864 HSALNG0141979]
| |
− | |HIF2PUT
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |osteosarcoma;colorectal cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289267 HSALNT0289267]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289267 HSALNG0019370]
| |
− | |TEX41
| |
− | |DKFZp686O1327,LINC00953
| |
− | |transcriptional regulation
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290361 HSALNT0290361]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290361 HSALNG0142476]
| |
− | |UFC1
| |
− | |NA
| |
− | |transcriptional regulation;ceRNA
| |
− | |pathogenic process
| |
− | |osteoarthritis;hepatocellular cancer
| |
− | |Musculoskeletal Diseases;Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289886 HSALNT0289886]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289886 HSALNG0142001]
| |
− | |LEIGC
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289367 HSALNT0289367]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289367 HSALNG0049188]
| |
− | |MDC1-AS1
| |
− | |MDC1-AS
| |
− | |NA
| |
− | |pathogenic process
| |
− | |bladder cancer;glioma
| |
− | |Male Urogenital Diseases;Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289190 HSALNT0289190]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289190 HSALNG0048542]
| |
− | |NBAT1
| |
− | |CASC14,NBAT-1
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |breast cancer;renal clear cell cancer;neuroblastoma
| |
− | |Skin and Connective Tissue Diseases;Male Urogenital Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0234826 HSALNT0234826]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0234826 HSALNG0113287]
| |
− | |LINC00917
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |intervertebral disc degeneration;breast cancer
| |
− | |Musculoskeletal Diseases;Skin and Connective Tissue Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289419 HSALNT0289419]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289419 HSALNG0094327]
| |
− | |LINC00173
| |
− | |NCRNA00173,FLJ42957
| |
− | |NA
| |
− | |pathogenic process
| |
− | |HIV-1-infected;hepatocelluar cancer
| |
− | |Virus Diseases;Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290138 HSALNT0290138]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290138 HSALNG0142253]
| |
− | |PEG10
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |diffuse large B-cell lymphoma;esophageal cancer
| |
− | |Neoplasms;Hemic and Lymphatic Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289136 HSALNT0289136]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289136 HSALNG0041549]
| |
− | |LINC02224
| |
− | |BRCAT107,ENST00000505706
| |
− | |NA
| |
− | |pathogenic process
| |
− | |active tuberculosis
| |
− | |Bacterial Infections and Mycoses
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289866 HSALNT0289866]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289866 HSALNG0141981]
| |
− | |HIT
| |
− | |NA
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |non-small cell lung cancer;breast cancer
| |
− | |Respiratory Tract Diseases;Skin and Connective Tissue Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0003927 HSALNT0003927]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0003927 HSALNG0002075]
| |
− | |SNHG12
| |
− | |ASLNC04080,C1orf79,LINC00100,NCRNA00100,PNAS-123
| |
− | |NA
| |
− | |pathogenic process
| |
− | |osteosarcoma;endometrial cancer
| |
− | |Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289099 HSALNT0289099]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289099 HSALNG0002236]
| |
− | |LINC01225
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatocelluar cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290047 HSALNT0290047]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290047 HSALNG0142162]
| |
− | |MALAT2
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0176345 HSALNT0176345]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0176345 HSALNG0084672]
| |
− | |SNHG1
| |
− | |LINC00057,NCRNA00057,U22HG,UHG,lncRNA16
| |
− | |NA
| |
− | |pathogenic process
| |
− | |astrocytoma;hepatocellular cancer;non-small cell lung cancer;Parkinson's disease;neuroblastoma
| |
− | |Respiratory Tract Diseases;Neoplasms;Digestive System Diseases;Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0094592 HSALNT0094592]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0094592 HSALNG0044933]
| |
− | |WSPAR
| |
− | |TCONS_00009511-XLOC_004555,lncTCF7
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |hepatocellular cancer;liver cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289308 HSALNT0289308]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289308 HSALNG0118552]
| |
− | |LINC00511
| |
− | |onco-lncRNA-12
| |
− | |NA
| |
− | |pathogenic process
| |
− | |lung adenocarcinoma;breast cancer
| |
− | |Respiratory Tract Diseases;Skin and Connective Tissue Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289452 HSALNT0289452]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289452 HSALNG0069321]
| |
− | |FAM83H-AS1
| |
− | |onco-lncRNA-3
| |
− | |NA
| |
− | |pathogenic process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289041 HSALNT0289041]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289041 HSALNG0051162]
| |
− | |LINC00472
| |
− | |C6orf155,dJ288M22.3,FLJ13189
| |
− | |NA
| |
− | |pathogenic process
| |
− | |ovarian cancer;breast cancer
| |
− | |Skin and Connective Tissue Diseases;Female Urogenital Diseases and Pregnancy Complications;Neoplasms;Endocrine System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289925 HSALNT0289925]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289925 HSALNG0142040]
| |
− | |linc-ITGB1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gallbladder cancer;breast cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0016239 HSALNT0016239]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0016239 HSALNG0007801]
| |
− | |LINC01133
| |
− | |lncRNA-PAGBC
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |non-small cell lung cancer;colorectal cancer;lung squamous cell cancer
| |
− | |Respiratory Tract Diseases;Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289489 HSALNT0289489]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289489 HSALNG0141600]
| |
− | |CCEPR
| |
− | |CCHE1,lncRNA-CCHE1
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |hepatocellular cancer;cervical cancer
| |
− | |Female Urogenital Diseases and Pregnancy Complications;Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289402 HSALNT0289402]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289402 HSALNG0098682]
| |
− | |SOX21-AS1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |lung adenocarcinoma;oral squamous cell cancer
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288905 HSALNT0288905]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288905 HSALNG0048533]
| |
− | |CASC15
| |
− | |LINC00340,lnc-SOX4-1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |basal cell cancer;melanoma;neuroblastoma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289555 HSALNT0289555]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289555 HSALNG0141670]
| |
− | |AC104699.1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gastric cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0096322 HSALNT0096322]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0096322 HSALNG0045923]
| |
− | |CLMAT3
| |
− | |SPARC-AS1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |colorectal cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289233 HSALNT0289233]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289233 HSALNG0043698]
| |
− | |RGMB-AS1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |lung adenocarcinoma;non-small cell lung cancer
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289908 HSALNT0289908]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289908 HSALNG0142023]
| |
− | |LINC01419
| |
− | |LVCAT7,TCONS_00014497
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatocelluar cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289541 HSALNT0289541]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289541 HSALNG0141656]
| |
− | |AB209630
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hypopharyngeal squamous cell cancer
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289608 HSALNT0289608]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289608 HSALNG0141723]
| |
− | |AOC4P
| |
− | |AOC4P
| |
− | |NA
| |
− | |pathogenic process
| |
− | |colorectal cancer;hepatocelluar cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289082 HSALNT0289082]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289082 HSALNG0040781]
| |
− | |PURPL
| |
− | |LINC01021,LOC643401,RP11-46C20.1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0196121 HSALNT0196121]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0196121 HSALNG0094605]
| |
− | |LINC01089
| |
− | |LIMT
| |
− | |NA
| |
− | |pathogenic process
| |
− | |breast cancer;astrocytoma
| |
− | |Skin and Connective Tissue Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0123080 HSALNT0123080]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0123080 HSALNG0058166]
| |
− | |EGFR-AS1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatocellular cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289539 HSALNT0289539]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289539 HSALNG0141654]
| |
− | |AB073614
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |ovarian cancer;glioma
| |
− | |Endocrine System Diseases;Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0242418 HSALNT0242418]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0242418 HSALNG0117322]
| |
− | |CACNA1G-AS1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |keloid
| |
− | |Pathological Conditions, Signs and Symptoms;Skin and Connective Tissue Diseases;Tissues
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0170814 HSALNT0170814]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0170814 HSALNG0081992]
| |
− | |MIR210HG
| |
− | |NA
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |hypoxic and inflammatory stress
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288979 HSALNT0288979]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288979 HSALNG0113319]
| |
− | |FOXC2-AS1
| |
− | |ODRUL
| |
− | |NA
| |
− | |pathogenic process
| |
− | |osteosarcoma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289022 HSALNT0289022]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289022 HSALNG0132865]
| |
− | |LINC00160
| |
− | |C21orf52,NCRNA00160
| |
− | |NA
| |
− | |pathogenic process
| |
− | |breast cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0105274 HSALNT0105274]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0105274 HSALNG0049582]
| |
− | |LINC01016
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |breast cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288904 HSALNT0288904]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288904 HSALNG0045753]
| |
− | |CARMN
| |
− | |MIR143HG,CARMEN
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |cardiac differentiation
| |
− | |Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289123 HSALNT0289123]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289123 HSALNG0121579]
| |
− | |LINC01630
| |
− | |LOC100287225
| |
− | |NA
| |
− | |pathogenic process
| |
− | |colorectal cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288971 HSALNT0288971]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288971 HSALNG0104253]
| |
− | |FAM30A
| |
− | |C14orf110,KIAA0125,HSPC053
| |
− | |NA
| |
− | |pathogenic process
| |
− | |gallbladder cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289506 HSALNT0289506]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289506 HSALNG0141617]
| |
− | |LINC00346
| |
− | |C13orf29,NCRNA00346
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatocellular cancer;breast cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289643 HSALNT0289643]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289643 HSALNG0141758]
| |
− | |BC032469
| |
− | |NA
| |
− | |ceRNA
| |
− | |pathogenic process
| |
− | |esophageal squamous cell cancer;gastric cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289580 HSALNT0289580]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289580 HSALNG0141695]
| |
− | |AK024171
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |intervertebral disc degeneration;gastric cancer
| |
− | |Musculoskeletal Diseases;Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290187 HSALNT0290187]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290187 HSALNG0142302]
| |
− | |RP11-284N8.3.1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |ovarian cancer
| |
− | |Endocrine System Diseases;Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289839 HSALNT0289839]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289839 HSALNG0141954]
| |
− | |FMR6
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |fragile X syndrome;fragile X-associated premature ovarian insufficiency
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Female Urogenital Diseases and Pregnancy Complications;Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290152 HSALNT0290152]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290152 HSALNG0142267]
| |
− | |PRAL
| |
− | |lncRNA-PRAL
| |
− | |NA
| |
− | |pathogenic process
| |
− | |hepatocellular cancer;lung cancer
| |
− | |Respiratory Tract Diseases;Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289380 HSALNT0289380]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289380 HSALNG0129818]
| |
− | |NORAD
| |
− | |LINC00657
| |
− | |transcriptional regulation;translational control
| |
− | |pathogenic process
| |
− | |breast cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0086803 HSALNT0086803]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0086803 HSALNG0041283]
| |
− | |LIFR-AS1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |preterm
| |
− | |Female Urogenital Diseases and Pregnancy Complications
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0076183 HSALNT0076183]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0076183 HSALNG0036373]
| |
− | |PANCR
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |atrial fibrillation
| |
− | |Pathological Conditions, Signs and Symptoms;Cardiovascular Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288975 HSALNT0288975]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288975 HSALNG0060982]
| |
− | |FEZF1-AS1
| |
− | |NA
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |gastric cancer;colorectal cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0238475 HSALNT0238475]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0238475 HSALNG0115230]
| |
− | |CCDC144NL-AS1
| |
− | |NA
| |
− | |ceRNA
| |
− | |pathogenic process
| |
− | |ovarian cancer;cardiac hypertrophy
| |
− | |Female Urogenital Diseases and Pregnancy Complications;Endocrine System Diseases;Cardiovascular Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290102 HSALNT0290102]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290102 HSALNG0142217]
| |
− | |NR_026689
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |ovarian cancer;lung cancer
| |
− | |Respiratory Tract Diseases;Endocrine System Diseases;Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289522 HSALNT0289522]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289522 HSALNG0075559]
| |
− | |ADARB2-AS1
| |
− | |C10orf109,NCRNA00168,bA466B20.1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |breast cancer;pancreatic ductal adenocarcinoma
| |
− | |Skin and Connective Tissue Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288936 HSALNT0288936]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288936 HSALNG0018139]
| |
− | |DPP10-AS1
| |
− | |BC032913
| |
− | |NA
| |
− | |pathogenic process
| |
− | |breast cancer;colorectal cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289474 HSALNT0289474]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289474 HSALNG0113682]
| |
− | |GAS8-AS1
| |
− | |C16orf3
| |
− | |NA
| |
− | |pathogenic process
| |
− | |papillary thyroid cancer;breast cancer
| |
− | |Skin and Connective Tissue Diseases;Endocrine System Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289063 HSALNT0289063]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289063 HSALNG0075802]
| |
− | |MANCR
| |
− | |LINC00704
| |
− | |NA
| |
− | |pathogenic process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289238 HSALNT0289238]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289238 HSALNG0026715]
| |
− | |SAMMSON
| |
− | |LINC01212
| |
− | |NA
| |
− | |pathogenic process
| |
− | |melanoma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289027 HSALNT0289027]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289027 HSALNG0007238]
| |
− | |LINC00302
| |
− | |C1orf46,NCRNA00302,XP33
| |
− | |NA
| |
− | |developmental process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0245543 HSALNT0245543]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0245543 HSALNG0118895]
| |
− | |SNHG20
| |
− | |C17orf86,NCRNA00338,LINC00338,PRO0872,FLJ25582,DKFZp686L05235,SCARNA16HG
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |hepatocellular cancer;colorectal cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0015631 HSALNT0015631]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0015631 HSALNG0007463]
| |
− | |DCST1-AS1
| |
− | |RP11-307C12.11
| |
− | |NA
| |
− | |pathogenic process
| |
− | |ovarian cancer
| |
− | |Endocrine System Diseases;Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0149810 HSALNT0149810]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0149810 HSALNG0071682]
| |
− | |PGM5-AS1
| |
− | |FAM233A,LOC572558
| |
− | |NA
| |
− | |pathogenic process
| |
− | |bladder cancer
| |
− | |Male Urogenital Diseases;Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290236 HSALNT0290236]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290236 HSALNG0142351]
| |
− | |SBF2-AS1
| |
− | |NA
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |non-small cell lung cancer
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290325 HSALNT0290325]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290325 HSALNG0142440]
| |
− | |uc.338
| |
− | |NA
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |hepatocellular cancer;lung cancer
| |
− | |Respiratory Tract Diseases;Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289973 HSALNT0289973]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289973 HSALNG0142088]
| |
− | |LNCRI
| |
− | |lnc-RI
| |
− | |ceRNA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290002 HSALNT0290002]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0290002 HSALNG0142117]
| |
− | |LOC100130476
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |esophageal squamous cell cancer;gastric cardia adenocarcinoma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289049 HSALNT0289049]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289049 HSALNG0063356]
| |
− | |LINC00599
| |
− | |Rncr3
| |
− | |NA
| |
− | |pathogenic process
| |
− | |diabetes
| |
− | |Endocrine System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0020406 HSALNT0020406]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0020406 HSALNG0009871]
| |
− | |LINC00628
| |
− | |NA
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |gastric cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289478 HSALNT0289478]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289478 HSALNG0133031]
| |
− | |DSCR4
| |
− | |DCRB
| |
− | |NA
| |
− | |pathogenic process
| |
− | |Down syndrome
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0017675 HSALNT0017675]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0017675 HSALNG0008546]
| |
− | |GAS5-AS1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |oral submucous fibrosis;non-small cell lung cancer
| |
− | |Respiratory Tract Diseases;Neoplasms;Stomatognathic Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289523 HSALNT0289523]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289523 HSALNG0048782]
| |
− | |HCG11
| |
− | |bK14H9.3,FLJ14049,FLJ30357
| |
− | |NA
| |
− | |pathogenic process
| |
− | |prostate cancer
| |
− | |Male Urogenital Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0134828 HSALNT0134828]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0134828 HSALNG0064314]
| |
− | |LINC02099
| |
− | |AC145110.1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |rheumatoid arthritis;breast cancer
| |
− | |Immune System Diseases;Musculoskeletal Diseases;Skin and Connective Tissue Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0209098 HSALNT0209098]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0209098 HSALNG0100348]
| |
− | |G2E3-AS1
| |
− | |CAT1647
| |
− | |NA
| |
− | |pathogenic process
| |
− | |bladder cancer
| |
− | |Male Urogenital Diseases;Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289139 HSALNT0289139]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289139 HSALNG0015506]
| |
− | |LINC02245
| |
− | |lnc-SERTAD2-3,AC007386.2
| |
− | |NA
| |
− | |pathogenic process
| |
− | |ovarian cancer
| |
− | |Endocrine System Diseases;Female Urogenital Diseases and Pregnancy Complications;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0008167 HSALNT0008167]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0008167 HSALNG0004109]
| |
− | |FOXD3-AS1
| |
− | |pasFOXD3
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |glioma
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289335 HSALNT0289335]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289335 HSALNG0060638]
| |
− | |LINC00998
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |major depression disorder
| |
− | |Behavior and Behavior Mechanisms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289379 HSALNT0289379]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289379 HSALNG0041522]
| |
− | |NNT-AS1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |colorectal cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0055497 HSALNT0055497]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0055497 HSALNG0026555]
| |
− | |PSMD6-AS1
| |
− | |ENST00000462717,lnc00462717
| |
− | |NA
| |
− | |pathogenic process
| |
− | |papillary thyroid cancer;glioma
| |
− | |Endocrine System Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289130 HSALNT0289130]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289130 HSALNG0119047]
| |
− | |LINC02081
| |
− | |CTD-2357A8.3,XLOC_012582
| |
− | |NA
| |
− | |pathogenic process
| |
− | |esophageal cancer
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289306 HSALNT0289306]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289306 HSALNG0107939]
| |
− | |LINC00052
| |
− | |TMEM83,NCRNA00052,FLJ31461
| |
− | |ceRNA
| |
− | |pathogenic process
| |
− | |hepatocellular cancer;breast cancer
| |
− | |Skin and Connective Tissue Diseases;Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0199070 HSALNT0199070]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0199070 HSALNG0095970]
| |
− | |PLUT
| |
− | |PDX1-AS1,PLUTO,HI-LNC71
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |type 2 diabetes
| |
− | |Nutritional and Metabolic Diseases;Endocrine System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289341 HSALNT0289341]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289341 HSALNG0073476]
| |
− | |LINC01505
| |
− | |RP11-308N19.1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289315 HSALNT0289315]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289315 HSALNG0020625]
| |
− | |LINC01116
| |
− | |TALNEC2
| |
− | |transcriptional regulation
| |
− | |pathogenic process
| |
− | |prostate cancer;glioblastoma
| |
− | |Male Urogenital Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0006439 HSALNT0006439]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0006439 HSALNG0003395]
| |
− | |FOXD2-AS1
| |
− | |MGC12982
| |
− | |NA
| |
− | |pathogenic process
| |
− | |lung cancer
| |
− | |Respiratory Tract Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0252387 HSALNT0252387]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0252387 HSALNG0122085]
| |
− | |LINC00305
| |
− | |C18orf20,NCRNA00305,MGC39571,HsT1235
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289473 HSALNT0289473]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289473 HSALNG0110794]
| |
− | |FBXL19-AS1
| |
− | |NCRNA00095,MGC125469,MGC125470,MGC125472
| |
− | |NA
| |
− | |pathogenic process
| |
− | |colorectal cancer
| |
− | |Neoplasms;Digestive System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0187807 HSALNT0187807]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0187807 HSALNG0090479]
| |
− | |LINC02555
| |
− | |AC079630.2
| |
− | |NA
| |
− | |pathogenic process
| |
− | |papillary thyroid cancer
| |
− | |Endocrine System Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0251493 HSALNT0251493]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0251493 HSALNG0121679]
| |
− | |LINC01929
| |
− | |CTD-2171N6.1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |papillary thyroid cancer
| |
− | |Endocrine System Diseases;Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0244776 HSALNT0244776]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0244776 HSALNG0118529]
| |
− | |LINC01152
| |
− | |TCONS_00025128,CMPD
| |
− | |NA
| |
− | |pathogenic process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0284591 HSALNT0284591]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0284591 HSALNG0139113]
| |
− | |DIAPH2-AS1
| |
− | |NA
| |
− | |NA
| |
− | |pathogenic process
| |
− | |Hodgkin's disease
| |
− | |Neoplasms
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289226 HSALNT0289226]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289226 HSALNG0104558]
| |
− | |PWAR1
| |
− | |PAR1,PAR-1
| |
− | |NA
| |
− | |pathogenic process
| |
− | |Prader-Willi syndrome and Angelman syndrome
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Nervous System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289339 HSALNT0289339]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289339 HSALNG0070961]
| |
− | |LINC00950
| |
− | |FP588
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289740 HSALNT0289740]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289740 HSALNG0141855]
| |
− | |DGCR12
| |
− | |DGS-E
| |
− | |NA
| |
− | |pathogenic process;developmental process
| |
− | |DiGeorge syndrome
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Hemic and Lymphatic Diseases;Musculoskeletal Diseases;Cardiovascular Diseases;Endocrine System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0275220 HSALNT0275220]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0275220 HSALNG0133987]
| |
− | |DGCR9
| |
− | |DGS-A,POM121L5P
| |
− | |NA
| |
− | |pathogenic process
| |
− | |DiGeorge syndrome
| |
− | |Congenital, Hereditary, and Neonatal Diseases and Abnormalities;Hemic and Lymphatic Diseases;Musculoskeletal Diseases;Cardiovascular Diseases;Endocrine System Diseases
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288929 HSALNT0288929]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0288929 HSALNG0133982]
| |
− | |DGCR10
| |
− | |DGS-B
| |
− | |NA
| |
− | |pathogenic process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289494 HSALNT0289494]
| |
− | |[https://bigd.big.ac.cn/lncbook/transcript?transid=HSALNT0289494 HSALNG0141605]
| |
− | |DGCR11
| |
− | |DGS-D
| |
− | |NA
| |
− | |pathogenic process
| |
− | |NA
| |
− | |NA
| |
− | |-
| |
− | |}
| |