Difference between revisions of "Lnc-EPCAM-1:2"

From LncRNAWiki
Jump to: navigation, search
Line 1: Line 1:
−
Please input one-sentence summary here.
+
''BCYRN1''-The shortest, long, non-coding RNA associated with cancer
  
 
==Annotated Information==
 
==Annotated Information==
 +
===Approved Symbol===
 +
''BCYRN1''
 
===Name===
 
===Name===
−
''BCYRN1'': apoptosis associated transcript in bladder cancer
+
''BCYRN1'': brain cytoplasmic RNA 1 <ref name="ref1" /><ref name="ref2" />
−
BC200
+
BC200 <ref name="ref1" /><ref name="ref2" />
  
 
===Characteristics===
 
===Characteristics===
−
200 nucleotide ncRNA [http://www.ncbi.nlm.nih.gov/pubmed/7684772 (Tiedge (1993))] exapted from an Alu element [http://www.ncbi.nlm.nih.gov/pubmed/2444875 (Watson (1987))]. Transcribed by RNA polymerase III [http://www.ncbi.nlm.nih.gov/pubmed/8265590 (Martignetti (1993))]. Three structural domains, 5' that shares homology with Alu elements, a central A rich region and a 3' unique region [http://www.ncbi.nlm.nih.gov/pubmed/7684772 (Tiedge (1993))].
+
''BCYRN1'' is a shortest known long noncoding RNA with a length of 200bps <ref name="ref3" />
 +
''BCYRN1'' is sense-transcribed from its gene locus situated on human chromosome 2 between the protein-coding genes for calmodulin 2 (CALM2) and epithelial cellular adhesion molecule (EPCAM)<ref name="ref1" /><ref name="ref2" />
 +
''BCYRN1'' is relatively recent, no orthologs of ''BCYRN1'' have been identified outside of the primate order <ref name="ref8" />
 +
''BCYRN1'' is found in the primate brain, Among neural cells, ''BCYRN1'' is highly expressed in dendrites, where is it thought to play a role in local translational control <ref name="ref3" />
 +
''BCYRN1'' is a tissue-specific Pol III transcript, altering the view that Pol III was only responsible for the synthesis of transfer RNA (tRNA) and 5 S ribosomal RNA <ref name="ref4" /><ref name="ref5" /><ref name="ref6" />
 +
''BCYRN1'' RNA sequence revealed three distinct sequence domains: a 5′ Alu element, a central adenosine-rich region and a 3′, 43-nucleotide, unique region containing a cytosine-rich stretch <ref name="ref7" />
 +
''BCYRN1'' has a 5′ Alu element that has very high sequence homology to the Alu-J repetitive element found in the human genome and the Alu domain of 7SL RNA <ref name="ref7" />
  
 
===Function===
 
===Function===
−
Binds several proteins including the signal recognition particle SRP9/14 heterodimer [http://www.ncbi.nlm.nih.gov/pubmed/9605471 (Kremerskothen (1998))], eukaryotic initiation factor 4A helicase (eIF4A) [http://www.ncbi.nlm.nih.gov/pubmed/18316401 (Lin (2008))] and Poly(A)-binding protein (PABP), binding to PABP requires the central A rich region [http://www.ncbi.nlm.nih.gov/pubmed/12162957 (Muddashetty (2002))].
+
''BCYRN1'' is important in several key features of cancer – like cell proliferation, survival and migration <ref name="ref3" />
−
 
+
''BCYRN1'' may act as a linker between certain proteins and mRNAs, allowing transient regulation and/or modification <ref name="ref3" />
−
Inhibits translation in-vitro and in cultured cells similar to BC1.  BC200 binding to eIF4A inhibits it by uncoupling eIF4A ATPase activity from its helicase/ duplex unwinding activity [http://www.ncbi.nlm.nih.gov/pubmed/18316401 (Lin (2008))]. Translational inhibition also involves BC200 binding to to PABP [http://www.ncbi.nlm.nih.gov/pubmed/16154588 (Kondrashov (2005))].
+
''BCYRN1'' exerts its translational inhibitory effects by acting as a competitor for PABP <ref name="ref9" />
 +
''BCYRN1''and BC1 interfere with eIF4A's catalytic mechanism by blocking the factor's helicase activity, while enhancing its ATPase activity <ref name="ref10" />
 +
''BCYRN1'' is linked wit necrosis <ref name="ref3" />
  
 
===Regulation===
 
===Regulation===
−
Please input regulation information here.
+
TATA box and internal promoter elements play a critical role in transcription of ''BCYRN1'' <ref name="ref3" />
  
 
===Expression===
 
===Expression===
−
Expressed predominantly in different regions of the brain. Also shows low level expression in testis but not in other normal tissues examined ([http://www.ncbi.nlm.nih.gov/pubmed/2444875 Watson (1987)], [http://www.ncbi.nlm.nih.gov/pubmed/7684772 Tiedge (1993)], [http://www.ncbi.nlm.nih.gov/pubmed/11399078 Kuryshev (2001)]). RNA sequencing of 11 human tissues confirmed up-regulation of expression in brain (hypothalamus) and low or no expression elsewhere [http://www.ncbi.nlm.nih.gov/pubmed/20668672 (Castle (2010))].
+
long noncoding RNA ''BCYRN1'' is expressed predominantly in different regions of the brain. It also shows low level expression in testis but not in other normal tissues examined <ref name="ref3" /> <ref name="ref7" />
−
 
+
''BCYRN1'' is disregulated in cancer and is expressed in a number of human tumours but not in corresponding normal <ref name="ref3" />
−
Disregulated in cancer: expressed in a number of human tumours but not in corresponding normal tissue [http://www.ncbi.nlm.nih.gov/pubmed/9422992 (Chen (1998))].
+
''BCYRN1'' expression decreases with aging but is upregulated in Alzheimer's disease (AD). In AD affected brain regions, expression increased with disease severity <ref name="ref3" />
−
 
+
''BCYRN1'' also suggested to localise to dendrites  <ref name="ref3" />
−
Link with aging and Alzheimer disease: BC200 expression decreases with aging but is upregulated in Alzheimer's disease (AD). In AD affected brain regions, expression increased with disease severity. RNA localisation showed intense perikaryal staining, showing build up of RNA in cell body [http://www.ncbi.nlm.nih.gov/pubmed/17553964 (Mus (2007))].
 
−
 
 
−
Like BC1 ncRNA found in rodents, BC200 also suggested to localise to dendrites [http://www.ncbi.nlm.nih.gov/pubmed/7684772 (Tiedge (1993))].  
 
−
 
 
−
===Allelic Information and Variation===
 
−
Please input allelic information and variation information here.
 
  
 
===Disease===
 
===Disease===
−
Alzheimer's disease [http://www.ncbi.nlm.nih.gov/pubmed/17553964 (Mus (2007))]
+
*Alzheimer's disease <ref name="ref3" />
−
 
+
*Breast cancer  <ref name="ref3" />
−
===Evolution===
+
*Cervix cancer <ref name="ref3" />
−
Please input evolution information here.
+
*Colon cancer <ref name="ref3" />
−
 
+
*Lung cancer <ref name="ref3" />
−
You can also add sub-section(s) at will.
+
*Oesophagus cancer <ref name="ref3" />
 +
*Ovary cancer <ref name="ref3" />
 +
*Parotid cancer <ref name="ref3" />
 +
*Stomach cancer <ref name="ref3" />
 +
*Tongue cancer <ref name="ref3" />
  
 
==Labs working on this lncRNA==
 
==Labs working on this lncRNA==
−
* The Robert F. Furchgott Center for Neural and Behavioral Science, Department of Physiology and Pharmacology, State University of New York Health Science Center, Brooklyn, NY 11203, USA. [http://www.ncbi.nlm.nih.gov/pubmed/17553964 (Mus (2007))]
+
*School of Biochemistry and Cell Biology, Western Gateway Building, University College Cork, Cork, Ireland
 +
*Department of Clinical Laboratory, Qilu Hospital, Shandong University, Jinan, Shandong Province, China
 +
*Department of Laboratory, Yuhuangding Hospital, Qingdao University Medical College, Yantai, Shandong Province, China
 +
*Department of Clinical Laboratory, The Affiliated Hospital of Qingdao University, Qingdao, Shandong Province, China
 +
*Clinical Medicine of Undergraduate, Taishan Medical University, Taian, Shandong Province, China
 +
*Wakayama Medical University, Wakayama, Wakayama, Japan
  
−
==References==
 
 
==References==
 
==References==
 
<references>
 
<references>
−
<ref name="ref1"> Mus E, Hof PR, Tiedge H. Dendritic BC200 RNA in aging and in Alzheimer's
+
<ref name="ref1"> Basile V., Vicente A., Martignetti J.A., Skryabin B.V., Brosius J., Kennedy J.L. Assignment of the human BC200 RNA gene (BCYRN1) to chromosome 2p16 by radiation hybrid mapping. Cytogenet. Cell Genet. 1998;82:271–272.  
−
disease. Proc Natl Acad Sci U S A. 2007 Jun 19;104(25):10679-84.
 
 
</ref>(1)
 
</ref>(1)
 +
<ref name="ref2"> Ludwig A., Rozhdestvensky T.S., Kuryshev V.Y., Schmitz J., Brosius J. An unusual primate locus that attracted two independent Alu insertions and facilitates their transcription. J. Mol. Biol. 2005;350:200–210.
 +
</ref>(2)
 +
<ref name="ref3">  Samson J, Cronin S & Dean K. BC200 (BCYRN1)–The shortest, long, non-coding RNA associated with cancer[J]. Non-coding RNA research. 2018.
 +
</ref>(3)
 +
<ref name="ref4">  Martignetti J.A., Brosius J. BC200 RNA : a neural RNA polymerase III product encoded by a monomeric Alu element. Proc. Natl. Acad. Sci. Unit. States Am. 1993;90:11563–11567.
 +
</ref>(4)
 +
<ref name="ref5">  Dieci G., Fiorino G., Castelnuovo M., Teichmann M., Pagano A. The expanding RNA polymerase III transcriptome. Trends Genet. 2007;23:614–622.
 +
</ref>(5)
 +
<ref name="ref6">  White R.J. Transcription by RNA polymerase III: more complex than we thought. Nat. Rev. Genet. 2011;12:459–463.
 +
</ref>(6)
 +
<ref name="ref7">  Tiedge H., Chen W., Brosius J. Primary structure, neural-specific expression, and dendritic location of human BC200 RNA. J. Neurosci. 1993;13 2382 LP-2390.
 +
</ref>(7)
 +
<ref name="ref8"> Martignetti J.A., Brosius J. BC200 RNA : a neural RNA polymerase III product encoded by a monomeric Alu element. Proc. Natl. Acad. Sci. Unit. States Am. 1993;90:11563–11567.
 +
</ref>(8)
 +
<ref name="ref9">  Khanam T., Rozhdestvensky T.S., Bundman M., Galiveti C.R., Handel S., Sukonina V. Two primate-specific small non-protein-coding RNAs in transgenic mice: neuronal expression, subcellular localization and binding partners. Nucleic Acids Res. 2007;35:529–539.
 +
</ref>(9)
 +
<ref name="ref10">  Lin D., Pestova T.V., Hellen C.U.T., Tiedge H. Translational control by a small RNA: dendritic BC1 RNA targets the eukaryotic initiation factor 4A helicase mechanism. Mol. Cell Biol. 2008;28:3008–3019.
 +
</ref>(10)
 
</references>
 
</references>
  
−
[http://www.lncrnadb.org/BC200/ Annotation originally sourced from lncRNAdb.]
+
===Sequence===
−
 
+
>gi|618|ref|NR_001568.1|Homo sapiens brain cytoplasmic RNA 1 (BCYRN1), long non-coding RNA
−
{{basic|
+
<dnaseq>GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCTCTCAGGGAGGCTAAGAGGCGGGAGGATAGCTTGA
−
tID = lnc-EPCAM-1:2|
+
GCCCAGGAGTTCGAGACCTGCCTGGGCAATATAGCGAGACCCCGTTCTCCAGAAAAAGGAAAAAAAAAAA
−
source = LNCipedia2.1|
+
CAAAAGACAAAAAAAAAATAAGCGTAACTTCCCTCAAAGCAACAACCCCCCCCCCCCTTT</dnaseq>
−
same = ,|
 
−
classification = intergenic|
 
−
length = 200 nt|
 
−
location = chr2+:47562453..47562653|
 
−
number = 1|
 
−
exons = 47562453..47562653|
 
−
context = <html><div align="center">
 
−
<iframe src="http://lncrna.big.ac.cn/view/?data=species/human&loc=chr2:47562453..47562653&tracklist=0&overview=0&tracks=DNA,RefGene,lncRNA" style=" border-width:0 " width="100%" height="250" scrolling="yes"></iframe>
 
−
</div></html>|
 
−
sequence = <dnaseq>GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCTCTCAGGGAGGCTAAGAGGCGGGAGGATAGCTTGAGCCCAGGAGTTCGAGACCTGCCTGGGCAATATAGCGAGACCCCGTTCTCCAGAAAAAGGAAAAAAAAAAACAAAAGACAAAAAAAAAATAAGCGTAACTTCCCTCAAAGCAACAACCCCCCCCCCCCTTT</dnaseq>|
 
−
}}
 
−
[[Category:Intergenic]][[Category:lnc-EPCAM-1]][[Category:Transcripts]]
 

Revision as of 05:07, 15 November 2018

BCYRN1-The shortest, long, non-coding RNA associated with cancer

Annotated Information

Approved Symbol

BCYRN1

Name

BCYRN1: brain cytoplasmic RNA 1 [1][2] BC200 [1][2]

Characteristics

BCYRN1 is a shortest known long noncoding RNA with a length of 200bps [3] BCYRN1 is sense-transcribed from its gene locus situated on human chromosome 2 between the protein-coding genes for calmodulin 2 (CALM2) and epithelial cellular adhesion molecule (EPCAM)[1][2] BCYRN1 is relatively recent, no orthologs of BCYRN1 have been identified outside of the primate order [4] BCYRN1 is found in the primate brain, Among neural cells, BCYRN1 is highly expressed in dendrites, where is it thought to play a role in local translational control [3] BCYRN1 is a tissue-specific Pol III transcript, altering the view that Pol III was only responsible for the synthesis of transfer RNA (tRNA) and 5 S ribosomal RNA [5][6][7] BCYRN1 RNA sequence revealed three distinct sequence domains: a 5′ Alu element, a central adenosine-rich region and a 3′, 43-nucleotide, unique region containing a cytosine-rich stretch [8] BCYRN1 has a 5′ Alu element that has very high sequence homology to the Alu-J repetitive element found in the human genome and the Alu domain of 7SL RNA [8]

Function

BCYRN1 is important in several key features of cancer – like cell proliferation, survival and migration [3] BCYRN1 may act as a linker between certain proteins and mRNAs, allowing transient regulation and/or modification [3] BCYRN1 exerts its translational inhibitory effects by acting as a competitor for PABP [9] BCYRN1and BC1 interfere with eIF4A's catalytic mechanism by blocking the factor's helicase activity, while enhancing its ATPase activity [10] BCYRN1 is linked wit necrosis [3]

Regulation

TATA box and internal promoter elements play a critical role in transcription of BCYRN1 [3]

Expression

long noncoding RNA BCYRN1 is expressed predominantly in different regions of the brain. It also shows low level expression in testis but not in other normal tissues examined [3] [8] BCYRN1 is disregulated in cancer and is expressed in a number of human tumours but not in corresponding normal [3] BCYRN1 expression decreases with aging but is upregulated in Alzheimer's disease (AD). In AD affected brain regions, expression increased with disease severity [3] BCYRN1 also suggested to localise to dendrites [3]

Disease

  • Alzheimer's disease [3]
  • Breast cancer [3]
  • Cervix cancer [3]
  • Colon cancer [3]
  • Lung cancer [3]
  • Oesophagus cancer [3]
  • Ovary cancer [3]
  • Parotid cancer [3]
  • Stomach cancer [3]
  • Tongue cancer [3]

Labs working on this lncRNA

  • School of Biochemistry and Cell Biology, Western Gateway Building, University College Cork, Cork, Ireland
  • Department of Clinical Laboratory, Qilu Hospital, Shandong University, Jinan, Shandong Province, China
  • Department of Laboratory, Yuhuangding Hospital, Qingdao University Medical College, Yantai, Shandong Province, China
  • Department of Clinical Laboratory, The Affiliated Hospital of Qingdao University, Qingdao, Shandong Province, China
  • Clinical Medicine of Undergraduate, Taishan Medical University, Taian, Shandong Province, China
  • Wakayama Medical University, Wakayama, Wakayama, Japan

References

  1. ↑ 1.0 1.1 1.2 Basile V., Vicente A., Martignetti J.A., Skryabin B.V., Brosius J., Kennedy J.L. Assignment of the human BC200 RNA gene (BCYRN1) to chromosome 2p16 by radiation hybrid mapping. Cytogenet. Cell Genet. 1998;82:271–272.
  2. ↑ 2.0 2.1 2.2 Ludwig A., Rozhdestvensky T.S., Kuryshev V.Y., Schmitz J., Brosius J. An unusual primate locus that attracted two independent Alu insertions and facilitates their transcription. J. Mol. Biol. 2005;350:200–210.
  3. ↑ 3.00 3.01 3.02 3.03 3.04 3.05 3.06 3.07 3.08 3.09 3.10 3.11 3.12 3.13 3.14 3.15 3.16 3.17 3.18 3.19 Samson J, Cronin S & Dean K. BC200 (BCYRN1)–The shortest, long, non-coding RNA associated with cancer[J]. Non-coding RNA research. 2018.
  4. ↑ Martignetti J.A., Brosius J. BC200 RNA : a neural RNA polymerase III product encoded by a monomeric Alu element. Proc. Natl. Acad. Sci. Unit. States Am. 1993;90:11563–11567.
  5. ↑ Martignetti J.A., Brosius J. BC200 RNA : a neural RNA polymerase III product encoded by a monomeric Alu element. Proc. Natl. Acad. Sci. Unit. States Am. 1993;90:11563–11567.
  6. ↑ Dieci G., Fiorino G., Castelnuovo M., Teichmann M., Pagano A. The expanding RNA polymerase III transcriptome. Trends Genet. 2007;23:614–622.
  7. ↑ White R.J. Transcription by RNA polymerase III: more complex than we thought. Nat. Rev. Genet. 2011;12:459–463.
  8. ↑ 8.0 8.1 8.2 Tiedge H., Chen W., Brosius J. Primary structure, neural-specific expression, and dendritic location of human BC200 RNA. J. Neurosci. 1993;13 2382 LP-2390.
  9. ↑ Khanam T., Rozhdestvensky T.S., Bundman M., Galiveti C.R., Handel S., Sukonina V. Two primate-specific small non-protein-coding RNAs in transgenic mice: neuronal expression, subcellular localization and binding partners. Nucleic Acids Res. 2007;35:529–539.
  10. ↑ Lin D., Pestova T.V., Hellen C.U.T., Tiedge H. Translational control by a small RNA: dendritic BC1 RNA targets the eukaryotic initiation factor 4A helicase mechanism. Mol. Cell Biol. 2008;28:3008–3019.

Sequence

>gi|618|ref|NR_001568.1|Homo sapiens brain cytoplasmic RNA 1 (BCYRN1), long non-coding RNA

000001 GGCCGGGCGC GGTGGCTCAC GCCTGTAATC CCAGCTCTCA GGGAGGCTAA GAGGCGGGAG GATAGCTTGA GCCCAGGAGT 000080
000081 TCGAGACCTG CCTGGGCAAT ATAGCGAGAC CCCGTTCTCC AGAAAAAGGA AAAAAAAAAA CAAAAGACAA AAAAAAAATA 000160
000161 AGCGTAACTT CCCTCAAAGC AACAACCCCC CCCCCCCTTT
Retrieved from "https://ngdc.cncb.ac.cn/lncrnawiki1/index.php?title=Lnc-EPCAM-1:2&oldid=1275290"