Please input one-sentence summary here.

==Annotated Information==
===Function===
Chalk5 influences grain chalkiness, which also affects head rice yield and many other quality traits. Chalk5 encodes a vacuolar H+-translocating pyrophosphatase (V-PPase) with inorganic pyrophosphate (PPi) hydrolysis and H+-translocation activity.Elevated expression of Chalk5 increases the chalkiness of the endosperm, putatively by disturbing the pH homeostasis of the endomembrane trafficking system in developing seeds, which affects the biogenesis of protein bodies and is coupled with a great increase in small vesicle-like structures, thus forming air spaces among endosperm storage substances and resulting in chalky grain.
The elevated activity of Chalk5 increases the proton concentration and promotes water loss, which could disturb pH homeostasis in the endomembrane trafficking system of developing endosperms, resulting in a great increase in small vesicle-like structures coupled with an abnormal decrease in protein body number and size, causing the formation of air spaces among starch granules and protein bodies and thus aberrant shape and spatial arrangements of these storage substances, leading to chalky grain.
[[File:Ng.2923-F2.jpg|left|]]
[[File:Ng.2923-F4.jpg|none|]]
[[File:未标题-1.jpg|none|]]

===Expression===
Two consensus nucleotide polymorphisms in the Chalk5 promoter in rice varieties might partly account for the differences in Chalk5 mRNA levels that contribute to natural variation in grain chalkiness.

===Evolution===
Please input evolution information here.

You can also add sub-section(s) at will.

==Labs working on this gene==
Please input related labs here.

==References==
Li Yibo,Fan Chuchuan,Xing Yongzhong etc.Chalk5 encodes a vacuolar H+-translocating pyrophosphatase influencing grain chalkiness in rice,Nature Publishing Group, a division of Macmillan Publishers Limited. All Rights Reserved. 2014/04/46(4):1061-4036

==Structured Information==
{{IndicaGene|
GeneName = chalk5|
Description = Putative uncharacterized protein|
Definition = Oryza sativa Indica Group BGIOSGA000079, complete gene.|
tag = chalk5|
tid = BGIOSGA000079-TA|
pid = BGIOSGA000079-PA|
Length = 2622|
Source = Oryza sativa Indica Group

ORGANISM Oryza sativa Indica Group
Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
Spermatophyta; Magnoliophyta; Liliopsida; Poales; Poaceae; BEP
clade; Ehrhartoideae; Oryzeae; Oryza.
|
Chromosome = [[:category:Indica Chromosome 1|Chromosome 5]]|
AP = Chromosome 5:46289509..46292130|
CDS = 46291834..46292130,46291618..46291722,46291453..46291526,46291309..46291367,46290712..46290749 ,46290433..46290553,46290270..46290338,46290093..46290175,46289861..46289929 ,46289709..46289771,46289509..46289622|
GCID =</Ng.2923-F1.jpg>
name=IndicaChromosome01:46289509..46292130
source=RiceIndica01
preset=GeneLocation
</gbrowseImage1>|
GSID = <gbrowseImage2>
name=IndicaChromosome01:46289509..46292130
source=RiceIndica01
preset=GeneLocation
</gbrowseImage2>|
CDNA = <cdnaseq>ATGGCGGCACACTCCCACGTCATCCCCTTCCTCTCCCCGGCGGCGACGTCCGCGCGCTGCTCCCCCTACGGCCACCGCCGCCGCGGCCGCGCGGGGCTCCTGCGGTGCGCGGCGGCGGCGGGGCAGGCGGGGTTCTTCACCCGCCTGGGACGCCTCATCCAGGAGAAGGCCAAGAGCGACGTCGAGAAGCTCTTCTCCGGCTTCTCCAAGACCCGCGAGAGCCTCTCCGTCGTCGACGAGCTCCTCACCTACTGGAACCTCGCCGACACCGACCGCGTCCTCGACGAGCTCGAGGAGGCTCTGCTGGTGTCGGATTTTGGCCCCAAGATTTCGTTCCGGATCGTGGACACTCTACGCGAGGAAATCCGCGATGGCAAGCTCAAGTCTGGGGCTGAGATAAAGGAAGCGCTGAAAAGGTGTATTCTTGAACTGCTGACGAGCAAAGGCGGCAATCCGGAGCTGCAGCTCGGTTTCAGAAAGCCGGCAGTTATCATGATTGTGGGAGTGAATGGAGGTGGAAAGACTACCTCATTAGGAAAACTTGCTTACAGATTCAAGAATGAAGGAGTGAAGGTATTGATGGCAGCAGGTGATACCTTCAGAGCAGCAGCTCGTGACCAGCTAGAAGTTTGGGCAGAGAGAACAGGTTCAGAGATTGTTATCGATAATGATAAGAAAGCAAAACCTGCATCAGTTCTCTCGCAGGCAGTGAAGCGCGGGAAGCGTGAAGGATTTGATCTTGTTCTTTGCGACACGTCAGGACGACTTCATACAAATTATGGTCTGATGGAAGAATTGGTTTCCTGCAAGAAAGTCATAGCTAAAGCCCTTCCGGGTGCTCCTAATGAGATCTTGCTGGTTCTGGATGGCACGACTGGCTTGAATATGCTACAACAAGCGAGGGAGTTCAATGATGTTGTTGGAGTCACAGGATTCGTCCTAACAAAGCTTGATGGAACTGCTCGTGGTGGTTGTGTGGTTAGCGTTGTAGATGAACTTGGAATTCCAGTAAAGTTTATTGGTGTTGGTGAAGGGATGGAGGATCTTCAGCCTTTTGATGCTGAGGCATTTGTTGAAGCCATTTTTCCTTGA</cdnaseq>|
AA = <aaseq>MAAHSHVIPFLSPAATSARCSPYGHRRRGRAGLLRCAAAAGQAGFFTRLGRLIQEKAKSDVEKLFSGFSKTRESLSVVDELLTYWNLADTDRVLDELEEALLVSDFGPKISFRIVDTLREEIRDGKLKSGAEIKEALKRCILELLTSKGGNPELQLGFRKPAVIMIVGVNGGGKTTSLGKLAYRFKNEGVKVLMAAGDTFRAAARDQLEVWAERTGSEIVIDNDKKAKPASVLSQAVKRGKREGFDLVLCDTSGRLHTNYGLMEELVSCKKVIAKALPGAPNEILLVLDGTTGLNMLQQAREFNDVVGVTGFVLTKLDGTARGGCVVSVVDELGIPVKFIGVGEGMEDLQPFDAEAFVEAIFP</aaseq>|
DNA = <dnaseqindica>1..297#409..513#605..678#764..822#1382..1419#1578..1698#1793..1861#1956..2038#2202..2270#2360..2422#2509..2622#ATGGCGGCACACTCCCACGTCATCCCCTTCCTCTCCCCGGCGGCGACGTCCGCGCGCTGCTCCCCCTACGGCCACCGCCGCCGCGGCCGCGCGGGGCTCCTGCGGTGCGCGGCGGCGGCGGGGCAGGCGGGGTTCTTCACCCGCCTGGGACGCCTCATCCAGGAGAAGGCCAAGAGCGACGTCGAGAAGCTCTTCTCCGGCTTCTCCAAGACCCGCGAGAGCCTCTCCGTCGTCGACGAGCTCCTCACCTACTGGAACCTCGCCGACACCGACCGCGTCCTCGACGAGCTCGAGGAGGCGCGTCCCCTGCTCCACTGCTCTGCATGCTGTTCTCTCCTTCTTCACTGTTCGGCGCTGCTTCTGTCTTCGTTTTTTTTGAATGTTTCCTGCTTGGTCTCGTGCACGCAGGCTCTGCTGGTGTCGGATTTTGGCCCCAAGATTTCGTTCCGGATCGTGGACACTCTACGCGAGGAAATCCGCGATGGCAAGCTCAAGTCTGGGGCTGAGATAAAGGTCATTTCAGTTTCCTCTTAGTGTACATTGACATCGGCATTGTGATTGGTCTGATGATTCATTTTGTCATCTGTGGTGGTTGATTGTGCAGGAAGCGCTGAAAAGGTGTATTCTTGAACTGCTGACGAGCAAAGGCGGCAATCCGGAGCTGCAGCTCGGTTTCAGGTTCTGCTTTCTCCTGAATTCCTGCTCAGTGCCATTTGTTGCTTGCTGTTTGTAATTTGAGCAATGTTGTTCATCGTTATGGCAGAAAGCCGGCAGTTATCATGATTGTGGGAGTGAATGGAGGTGGAAAGACTACCTCATTAGGTACTCCTCTTGCATGCTTGGCTTTGTTAAGCTTAGATGTTTTTGTTCCATTCTGATAGATGGTCAATAAACGGTAACACACTCTCCTATGGTCCTACCCTAGTACCCTACTATATGGACAATTGACATTATGATGATGTTCTAAAGGCACAACACATGGTTATATAGGCACGCAAGTGCATTTGTGAAGGAAAAGATATTTGGTTATAAAAGCACAATACTGTAATTAGGCCATCACAAGATTATCTCTTATACACCAATGTACTAGTTACTCGAAGTGAATTTATCACGCCTATGTAAGGTATTTTCAGCTCAATGCAAAACTACTTGCATATTAAGCTTGGATTGTGGCATAGCATTGGATTAAGCTTCTGCAGGTTATCTTGTCGCTTTAAAGCTAATATGGTACCTAGATAGTAAGGAGCTCCTCAATATGCAGTTCTGGTTCGGGCATTTTCTACCATCTGCATCTGGCATCACTATTTAGTTTGGAACGTTTTATACAGCATGATGCTTTGAAGTGGAAGATTGATCTTACTCCTTTTTTATGTATTTGTAGGAAAACTTGCTTACAGATTCAAGAATGAAGGAGTGAAGGTGAGGCTATTTTCTAGACATACCCTGGTTTATAGGCTAGATGCATGGGAATTAAATTCAGCTATGTACATATTGCCTCACCACATTCTCTGAACATGTAATATTGTACAATAGATCAAAATAATGAGTTCATGTTCATGCTTTCAACAATAATATAGGTATTGATGGCAGCAGGTGATACCTTCAGAGCAGCAGCTCGTGACCAGCTAGAAGTTTGGGCAGAGAGAACAGGTTCAGAGATTGTTATCGATAATGATAAGAAAGCAAAACCTGCATCAGGTATGATTTTTTGATCTGCCAAGCATTGTGATCACACTCTGTTCTCATAAGGAGGTTAGCTTCTATGTTTCATCTAATTTGACTTGCTTGGTAGTTCTCTCGCAGGCAGTGAAGCGCGGGAAGCGTGAAGGATTTGATCTTGTTCTTTGCGACACGTCAGGACGTATGATTATTTTAGTGACTGAGAGCAGAATATGCATATGTTTGGTGATTTGCTGATTGGTTGAAATGACTTTGTTTCAGCACTTATTTTTCAGGACTTCATACAAATTATGGTCTGATGGAAGAATTGGTTTCCTGCAAGAAAGTCATAGCTAAAGCCCTTCCGGGTGCTCCTAATGTATGCTGTGTTTACATGCAAAGGACTTGATTTTGTGTTGATTGGATCATTTTGGCATGTGCAGTACTTTTGAGGGCAAGCTTAGAGAAGCACGGTTATGATTCTAATACTTCATAGCGCTCTCATTGTTATTAACTACTAGCATATATTCCTTGCTTAACAGGAGATCTTGCTGGTTCTGGATGGCACGACTGGCTTGAATATGCTACAACAAGCGAGGGAGTTCAATGATGTAATCACCATTTCCTGGTTATTTTGGTACTCCTGATTTTTCTTTTTTTTTTCATCAAGATATAACGAACTCTGTTGGCTTAATGCCAGGTTGTTGGAGTCACAGGATTCGTCCTAACAAAGCTTGATGGAACTGCTCGTGGTGGTTGTGTGGTATACACATATTCCTTGCCATATGCAGTTTATAAACAACAACATTTTAGTGGTTCACCTGAATTTTGTTGTTTGATCTATTGCAGGTTAGCGTTGTAGATGAACTTGGAATTCCAGTAAAGTTTATTGGTGTTGGTGAAGGGATGGAGGATCTTCAGCCTTTTGATGCTGAGGCATTTGTTGAAGCCATTTTTCCTTGA</dnaseqindica>|
Link = [http://plants.ensembl.org/Oryza_indica/Gene/Summary?g=BGIOSGA000079 EnsemblPlants:BGIOSGA000079]|
}}
[[Category:Genes]]
[[Category:Indica mRNA]]
[[Category:Oryza Sativa Indica Group]]
[[Category:Indica Genes]]
[[Category:Indica Chromosome 1]]
[[Category:Chromosome 1]]

2014-05-28T01:37:54Z

Kaweh:

{{Mitochondrion|
GeneName = chalk5|
Annotated Information = protein coding; the gene of protein chalk5(ATP synthase F0 subunit 1).|
Function = influences grain chalkiness, which also affects head rice yield and many other quality traits. Chalk5 encodes a vacuolar H+-translocating pyrophosphatase (V-PPase) with inorganic pyrophosphate (PPi) hydrolysis and H+-translocation activity. Elevated expression of Chalk5 increases the chalkiness
of the endosperm, putatively by disturbing the pH homeostasis of the endomembrane trafficking system in developing seeds,which affects the biogenesis of protein bodies and is coupled with a great increase in small vesicle-like structures,thus forming air spaces among endosperm storage substances and resulting in chalky grain. |
Expression =Two consensus nucleotide polymorphisms in the Chalk5 promoter in rice varieties might partly account for the differences in Chalk5 mRNA levels that contribute to natural variation ingrain chalkiness.|
Evolution = R1c might have evolved from R1b through elimination of its partial segments at the end containing the atp1 gene, which was integrated in the soybean genome at another location.The mitochondrial DNA is more conservative and the evolution rate of chloroplast DNA is higher than mitochondrial DNA in rice.|
Labs wodking on this gene = Laboratory of Plant Molecular Genetics; Key Laboratory of Crop Heterosis and Utilization of Ministry of Education; Beijing Key Laboratory of Crop Genetic Improvement; Key Laboratory of MOE for Plant Developmental Biology; State Key Laboratory of Pharmaceutical Biotechnology; Key Laboratory of Tea Biochemistry and Biotechnology; MOE Key Laboratory of Bioinformatics and Bioinformatics Div. TNLIST.|
References =AU - Li, Yibo, Fan, Chuchuan, Xing, Yongzhongetc. Chalk5 encodes a vacuolar H+-translocating pyrophosphatase influencing grain chalkiness in rice
Nat Genet 2014/04//print Nature Publishing Group, a division of Macmillan Publishers Limited. All Rights Reserved.1061-4036

Structured information = The product of the gene is the subunit of the ATP synthase F0(ATP synthase F0 subunit 1)
Description = ATP synthase F0 subunit 1|
Version = GeneID:6450183|
Length = 1530 bp|
Definition = Oryza sativa Japonica Group ''atp1'', Mitochondrion gene.|
Source = Oryza sativa Japonica Group

ORGANISM Oryza sativa Japonica Group
Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
Spermatophyta; Magnoliophyta; Liliopsida; Poales; Poaceae; BEP
clade; Ehrhartoideae; Oryzeae; Oryza.
|
Chromosome = [[:category:Japonica Mitochondrion|Mitochondrion]]|
AP = Mitochondrion:352379..353908|
CDS = 352379..353908|
GCID = <gbrowseImage1>
name=NC_011033:352379..353908
source=Rice_Japonica_Mitochondrion
preset=GeneLocation
</gbrowseImage1>|
GSID = <gbrowseImage2>
name=NC_011033:352379..353908
source=Rice_Japonica_Mitochondrion
preset=GeneLocation
</gbrowseImage2>|
AA = <aaseq>MEFSPRAAELTTLLESRMTNFYTNFQVDEIGRVVSVGDGIARVYGLNEIQAGEMVEFASGVKGIALNLENENVGIVVFGSDTAIKEGDLVKRTGSIVDVPAGKAMLGRVVDALGVPIDGKGALSDHERRRVEVKAPGIIERKSVHEPMQTGLKAVDSLVPIGRGQRELIIGDRQTGKTAIAIDTILNQKQMNSRGTNESETLYCVYVAIGQKRSTVAQLVQILSEANALEYSILVAATASDPAPLQFLAPYSGCAMGEYFRDNGMHALIIYDDLSKQAVAYRQMSLLLRRPPGREAFPGDVFYLHSRLLERAAKRSDQTGAGSLTALPVIETQAGDVSAYIPTNVISITDGQICLETELFYRGIRPAINVGLSVSRVGSAAQLKAMKQVCGSLKLELAQYREVAAFAQFGSDLDAATQALLNRGARLTEVSKQPQYEPLPIEKQIVVIYAAVNGFCDRMPLDRISQYEKAILSTINPELLKSFNEKGGLTNERKIELDAFLKQTAKEIN</aaseq>|
DNA = <dnaseqindica>1..1530#atggaattctcacccagagctgcggaactcacgactctattagaaagtagaatgaccaacttttacacgaattttcaagtggatgagatcggtcgagtggtctcagttggagatgggattgcacgtgtttatggattgaacgagattcaagctggagaaatggtggaatttgccagcggtgtgaaaggaatagccttgaatcttgagaatgagaatgtaggtattgttgtctttggtagtgataccgctattaaagaaggagatcttgtcaagcgcactggatctattgtggatgttcctgcgggaaaggccatgttaggccgtgtggtcgacgccttgggagtacctattgatggaaaaggggctctaagcgatcacgaacgaagacgtgtcgaagtgaaagccccagggattattgaacgtaaatctgtgcacgaacccatgcaaacaggcttaaaagcagtggatagcctggttcctataggccgtggtcaacgagaacttataatcggggacagacaaactggaaaaacagcaatagctatcgatactatattaaaccaaaagcaaatgaactcaaggggcacaaatgagagtgagacattgtattgtgtctatgttgcgattggacaaaaacgctcgactgtggcacaattagttcaaattctttcagaagcgaatgctttggaatattccattcttgtagcagccaccgcttcggatcctgctcctctgcaatttctggccccatattcagggtgtgccatgggggaatatttccgcgataatggaatgcacgcattaattatatatgatgatctaagtaaacaggcggtggcatatcgacaaatgtcattattgttacgccgaccaccaggccgtgaggctttcccaggggatgttttctatttacattcccgtctcttagaaagagccgctaaacgatcggaccagacaggtgcaggtagcttgactgcgttacccgtgattgaaacacaagctggagacgtatcggcctatatccccaccaatgtgatctccattacagatggacaaatctgtttggaaacagagctcttttatcgcggaattagacctgctattaacgttggcttatccgtcagtcgcgtcgggtctgccgctcagttgaaagctatgaaacaagtctgcggtagttcaaaactggaattggcacaatatcgcgaagtggccgccttcgctcaatttgggtcagaccttgatgctgcgactcaggcattactcaatagaggtgcaaggcttacagaagtgcccaaacaaccacaatatgaaccacttccaattgaaaaacaaattgttgtgatttatgctgctgtcaacggcttctgtgatcgaatgccactagacagaatttctcaatatgaaaaagccattctaagtactattaatccagaattactaaaatccttcaacgaaaaagggggattaactaacgaaagaaagattgaacctgatgcttctttaaaacaaactgcgaaggagattaattag</dnaseqindica>|
Link = [http://www.ncbi.nlm.nih.gov/gene?term=6450183 NCBI Gene:atp1]
}}
[[Category:Genes]]
[[Category:Japonica mRNA]]
[[Category:Oryza Sativa Japonica Group]]
[[Category:Japonica Genes]]
[[Category:Japonica Mitochondrion]]
[[Category:Mitochondrion]]

Chalk5

2014-05-28T01:18:35Z

Kaweh:

{{Mitochondrion|
GeneName = chalk5|
Annotated Information = protein coding; the gene of protein chalk5(ATP synthase F0 subunit 1).|
Function = influences grain chalkiness, which also affects head rice yield and many other quality traits. Chalk5 encodes a vacuolar H+-translocating pyrophosphatase (V-PPase) with inorganic pyrophosphate (PPi) hydrolysis and H+-translocation activity. Elevated expression of Chalk5 increases the chalkiness
of the endosperm, putatively by disturbing the pH homeostasis of the endomembrane trafficking system in developing seeds,which affects the biogenesis of protein bodies and is coupled with a great increase in small vesicle-like structures,thus forming air spaces among endosperm storage substances and resulting in chalky grain. |
Expression = Our results indicate that two consensus nucleotide polymorphisms in the Chalk5 promoter in rice varieties might partly account for the differences in
Chalk5 mRNA levels that contribute to natural variation ingrain chalkiness.|
Evolution = R1c might have evolved from R1b through elimination of its partial segments at the end containing the atp1 gene, which was integrated in the soybean genome at another location.The mitochondrial DNA is more conservative and the evolution rate of chloroplast DNA is higher than mitochondrial DNA in rice.|
Labs wodking on this gene = Laboratory of Plant Molecular Genetics; Key Laboratory of Crop Heterosis and Utilization of Ministry of Education; Beijing Key Laboratory of Crop Genetic Improvement; Key Laboratory of MOE for Plant Developmental Biology; State Key Laboratory of Pharmaceutical Biotechnology; Key Laboratory of Tea Biochemistry and Biotechnology; MOE Key Laboratory of Bioinformatics and Bioinformatics Div. TNLIST.|
References = Notsu Y, Masood S, Nishikawa T, et al. The complete sequence of the rice (Oryza sativa L.) mitochondrial genome: frequent DNA sequence acquisition and loss during the evolution of flowering plants[J]. Molecular Genetics and Genomics, 2002, 268(4): 434-445.
Wei X, Wang R, Cao L, et al. Origin of Oryza sativa in China inferred by nucleotide polymorphisms of organelle DNA[J]. PloS one, 2012, 7(11): e49546.
Li S, Yang D, Zhu Y. Characterization and use of male sterility in hybrid rice breeding[J]. Journal of Integrative Plant Biology, 2007, 49(6): 791-804.
Tan Y P, Li S Q, Xie H W, et al. Genetical and molecular analysis reveals a cooperating relationship between cytoplasmic male sterility-and fertility restoration-related genes in Oryza species[J]. Theoretical and Applied Genetics, 2011, 122(1): 9-19.
Wang B, Yuan J, Liu J, et al. Codon usage bias and determining forces in green plant mitochondrial genomes[J]. Journal of integrative plant biology, 2011, 53(4): 324-334.
Pasentsis K, Falara V, Pateraki I, et al. Identification and expression profiling of low oxygen regulated genes from Citrus flavedo tissues using RT-PCR differential display[J]. Journal of experimental botany, 2007, 58(8): 2203-2216.
Duroux L, Welinder K G. The peroxidase gene family in plants: a phylogenetic overview[J]. Journal of molecular evolution, 2003, 57(4): 397-407.
Zhu L, Deng W W, Ye A H, et al. Cloning of two cDNAs encoding a family of ATP sulfurylase from Camellia sinensis related to selenium or sulfur metabolism and functional expression in Escherichia coli[J]. Plant Physiology and Biochemistry, 2008, 46(8): 731-738.
Chen X, Wang Y, Li J, et al. Mitochondrial proteome during salt stress-induced programmed cell death in rice[J]. Plant Physiology and Biochemistry, 2009, 47(5): 407-415.
Lei B, Li S, Liu G, et al. Evolution of mitochondrial gene content: loss of genes, tRNAs and introns between Gossypium harknessii and other plants[J]. Plant Systematics and Evolution, 2013, 299(10): 1889-1897.|

Structured information = The product of the gene is the subunit of the ATP synthase F0(ATP synthase F0 subunit 1)
Description = ATP synthase F0 subunit 1|
Version = GeneID:6450183|
Length = 1530 bp|
Definition = Oryza sativa Japonica Group ''atp1'', Mitochondrion gene.|
Source = Oryza sativa Japonica Group

ORGANISM Oryza sativa Japonica Group
Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
Spermatophyta; Magnoliophyta; Liliopsida; Poales; Poaceae; BEP
clade; Ehrhartoideae; Oryzeae; Oryza.
|
Chromosome = [[:category:Japonica Mitochondrion|Mitochondrion]]|
AP = Mitochondrion:352379..353908|
CDS = 352379..353908|
GCID = <gbrowseImage1>
name=NC_011033:352379..353908
source=Rice_Japonica_Mitochondrion
preset=GeneLocation
</gbrowseImage1>|
GSID = <gbrowseImage2>
name=NC_011033:352379..353908
source=Rice_Japonica_Mitochondrion
preset=GeneLocation
</gbrowseImage2>|
AA = <aaseq>MEFSPRAAELTTLLESRMTNFYTNFQVDEIGRVVSVGDGIARVYGLNEIQAGEMVEFASGVKGIALNLENENVGIVVFGSDTAIKEGDLVKRTGSIVDVPAGKAMLGRVVDALGVPIDGKGALSDHERRRVEVKAPGIIERKSVHEPMQTGLKAVDSLVPIGRGQRELIIGDRQTGKTAIAIDTILNQKQMNSRGTNESETLYCVYVAIGQKRSTVAQLVQILSEANALEYSILVAATASDPAPLQFLAPYSGCAMGEYFRDNGMHALIIYDDLSKQAVAYRQMSLLLRRPPGREAFPGDVFYLHSRLLERAAKRSDQTGAGSLTALPVIETQAGDVSAYIPTNVISITDGQICLETELFYRGIRPAINVGLSVSRVGSAAQLKAMKQVCGSLKLELAQYREVAAFAQFGSDLDAATQALLNRGARLTEVSKQPQYEPLPIEKQIVVIYAAVNGFCDRMPLDRISQYEKAILSTINPELLKSFNEKGGLTNERKIELDAFLKQTAKEIN</aaseq>|
DNA = <dnaseqindica>1..1530#atggaattctcacccagagctgcggaactcacgactctattagaaagtagaatgaccaacttttacacgaattttcaagtggatgagatcggtcgagtggtctcagttggagatgggattgcacgtgtttatggattgaacgagattcaagctggagaaatggtggaatttgccagcggtgtgaaaggaatagccttgaatcttgagaatgagaatgtaggtattgttgtctttggtagtgataccgctattaaagaaggagatcttgtcaagcgcactggatctattgtggatgttcctgcgggaaaggccatgttaggccgtgtggtcgacgccttgggagtacctattgatggaaaaggggctctaagcgatcacgaacgaagacgtgtcgaagtgaaagccccagggattattgaacgtaaatctgtgcacgaacccatgcaaacaggcttaaaagcagtggatagcctggttcctataggccgtggtcaacgagaacttataatcggggacagacaaactggaaaaacagcaatagctatcgatactatattaaaccaaaagcaaatgaactcaaggggcacaaatgagagtgagacattgtattgtgtctatgttgcgattggacaaaaacgctcgactgtggcacaattagttcaaattctttcagaagcgaatgctttggaatattccattcttgtagcagccaccgcttcggatcctgctcctctgcaatttctggccccatattcagggtgtgccatgggggaatatttccgcgataatggaatgcacgcattaattatatatgatgatctaagtaaacaggcggtggcatatcgacaaatgtcattattgttacgccgaccaccaggccgtgaggctttcccaggggatgttttctatttacattcccgtctcttagaaagagccgctaaacgatcggaccagacaggtgcaggtagcttgactgcgttacccgtgattgaaacacaagctggagacgtatcggcctatatccccaccaatgtgatctccattacagatggacaaatctgtttggaaacagagctcttttatcgcggaattagacctgctattaacgttggcttatccgtcagtcgcgtcgggtctgccgctcagttgaaagctatgaaacaagtctgcggtagttcaaaactggaattggcacaatatcgcgaagtggccgccttcgctcaatttgggtcagaccttgatgctgcgactcaggcattactcaatagaggtgcaaggcttacagaagtgcccaaacaaccacaatatgaaccacttccaattgaaaaacaaattgttgtgatttatgctgctgtcaacggcttctgtgatcgaatgccactagacagaatttctcaatatgaaaaagccattctaagtactattaatccagaattactaaaatccttcaacgaaaaagggggattaactaacgaaagaaagattgaacctgatgcttctttaaaacaaactgcgaaggagattaattag</dnaseqindica>|
Link = [http://www.ncbi.nlm.nih.gov/gene?term=6450183 NCBI Gene:atp1]
}}
[[Category:Genes]]
[[Category:Japonica mRNA]]
[[Category:Oryza Sativa Japonica Group]]
[[Category:Japonica Genes]]
[[Category:Japonica Mitochondrion]]
[[Category:Mitochondrion]]

Chalk5

2014-05-28T01:03:08Z

Kaweh:

{{Mitochondrion|
GeneName = chalk5|
Annotated Information = protein coding; the gene of protein chalk5(ATP synthase F0 subunit 1).|
Function = Chalk5, influences grain chalkiness, which also affects head rice yield and many other quality traits. Chalk5 encodes a vacuolar H+-translocating pyrophosphatase (V-PPase) with inorganic pyrophosphate (PPi) hydrolysis and H+-translocation activity. Elevated expression of Chalk5 increases the chalkiness
of the endosperm, putatively by disturbing the pH homeostasis of the endomembrane trafficking system in developing seeds,which affects the biogenesis of protein bodies and is coupled with a great increase in small vesicle-like structures,thus forming air spaces among endosperm storage substances and resulting in chalky grain. Our results indicate that two consensus nucleotide polymorphisms in the Chalk5 promoter in rice varieties might partly account for the differences in
Chalk5 mRNA levels that contribute to natural variation ingrain chalkiness.|
Expression = In the rice chalk5 gene, multiple transcripts were observed at some regions of initiation of transcription by primer extension analysis. There were at least eight transcription initiation sites upstream of atp1. Rice atp1 is present in a unique environment and is transcribed at a high level. The multiple initiation sites of the
rice mitochondrial atp1 gene is also regulated in different ways.|
Evolution = R1c might have evolved from R1b through elimination of its partial segments at the end containing the atp1 gene, which was integrated in the soybean genome at another location.The mitochondrial DNA is more conservative and the evolution rate of chloroplast DNA is higher than mitochondrial DNA in rice.|
Labs wodking on this gene = Laboratory of Plant Molecular Genetics; Key Laboratory of Crop Heterosis and Utilization of Ministry of Education; Beijing Key Laboratory of Crop Genetic Improvement; Key Laboratory of MOE for Plant Developmental Biology; State Key Laboratory of Pharmaceutical Biotechnology; Key Laboratory of Tea Biochemistry and Biotechnology; MOE Key Laboratory of Bioinformatics and Bioinformatics Div. TNLIST.|
References = Notsu Y, Masood S, Nishikawa T, et al. The complete sequence of the rice (Oryza sativa L.) mitochondrial genome: frequent DNA sequence acquisition and loss during the evolution of flowering plants[J]. Molecular Genetics and Genomics, 2002, 268(4): 434-445.
Wei X, Wang R, Cao L, et al. Origin of Oryza sativa in China inferred by nucleotide polymorphisms of organelle DNA[J]. PloS one, 2012, 7(11): e49546.
Li S, Yang D, Zhu Y. Characterization and use of male sterility in hybrid rice breeding[J]. Journal of Integrative Plant Biology, 2007, 49(6): 791-804.
Tan Y P, Li S Q, Xie H W, et al. Genetical and molecular analysis reveals a cooperating relationship between cytoplasmic male sterility-and fertility restoration-related genes in Oryza species[J]. Theoretical and Applied Genetics, 2011, 122(1): 9-19.
Wang B, Yuan J, Liu J, et al. Codon usage bias and determining forces in green plant mitochondrial genomes[J]. Journal of integrative plant biology, 2011, 53(4): 324-334.
Pasentsis K, Falara V, Pateraki I, et al. Identification and expression profiling of low oxygen regulated genes from Citrus flavedo tissues using RT-PCR differential display[J]. Journal of experimental botany, 2007, 58(8): 2203-2216.
Duroux L, Welinder K G. The peroxidase gene family in plants: a phylogenetic overview[J]. Journal of molecular evolution, 2003, 57(4): 397-407.
Zhu L, Deng W W, Ye A H, et al. Cloning of two cDNAs encoding a family of ATP sulfurylase from Camellia sinensis related to selenium or sulfur metabolism and functional expression in Escherichia coli[J]. Plant Physiology and Biochemistry, 2008, 46(8): 731-738.
Chen X, Wang Y, Li J, et al. Mitochondrial proteome during salt stress-induced programmed cell death in rice[J]. Plant Physiology and Biochemistry, 2009, 47(5): 407-415.
Lei B, Li S, Liu G, et al. Evolution of mitochondrial gene content: loss of genes, tRNAs and introns between Gossypium harknessii and other plants[J]. Plant Systematics and Evolution, 2013, 299(10): 1889-1897.|

Structured information = The product of the gene is the subunit of the ATP synthase F0(ATP synthase F0 subunit 1)
Description = ATP synthase F0 subunit 1|
Version = GeneID:6450183|
Length = 1530 bp|
Definition = Oryza sativa Japonica Group ''atp1'', Mitochondrion gene.|
Source = Oryza sativa Japonica Group

ORGANISM Oryza sativa Japonica Group
Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
Spermatophyta; Magnoliophyta; Liliopsida; Poales; Poaceae; BEP
clade; Ehrhartoideae; Oryzeae; Oryza.
|
Chromosome = [[:category:Japonica Mitochondrion|Mitochondrion]]|
AP = Mitochondrion:352379..353908|
CDS = 352379..353908|
GCID = <gbrowseImage1>
name=NC_011033:352379..353908
source=Rice_Japonica_Mitochondrion
preset=GeneLocation
</gbrowseImage1>|
GSID = <gbrowseImage2>
name=NC_011033:352379..353908
source=Rice_Japonica_Mitochondrion
preset=GeneLocation
</gbrowseImage2>|
AA = <aaseq>MEFSPRAAELTTLLESRMTNFYTNFQVDEIGRVVSVGDGIARVYGLNEIQAGEMVEFASGVKGIALNLENENVGIVVFGSDTAIKEGDLVKRTGSIVDVPAGKAMLGRVVDALGVPIDGKGALSDHERRRVEVKAPGIIERKSVHEPMQTGLKAVDSLVPIGRGQRELIIGDRQTGKTAIAIDTILNQKQMNSRGTNESETLYCVYVAIGQKRSTVAQLVQILSEANALEYSILVAATASDPAPLQFLAPYSGCAMGEYFRDNGMHALIIYDDLSKQAVAYRQMSLLLRRPPGREAFPGDVFYLHSRLLERAAKRSDQTGAGSLTALPVIETQAGDVSAYIPTNVISITDGQICLETELFYRGIRPAINVGLSVSRVGSAAQLKAMKQVCGSLKLELAQYREVAAFAQFGSDLDAATQALLNRGARLTEVSKQPQYEPLPIEKQIVVIYAAVNGFCDRMPLDRISQYEKAILSTINPELLKSFNEKGGLTNERKIELDAFLKQTAKEIN</aaseq>|
DNA = <dnaseqindica>1..1530#atggaattctcacccagagctgcggaactcacgactctattagaaagtagaatgaccaacttttacacgaattttcaagtggatgagatcggtcgagtggtctcagttggagatgggattgcacgtgtttatggattgaacgagattcaagctggagaaatggtggaatttgccagcggtgtgaaaggaatagccttgaatcttgagaatgagaatgtaggtattgttgtctttggtagtgataccgctattaaagaaggagatcttgtcaagcgcactggatctattgtggatgttcctgcgggaaaggccatgttaggccgtgtggtcgacgccttgggagtacctattgatggaaaaggggctctaagcgatcacgaacgaagacgtgtcgaagtgaaagccccagggattattgaacgtaaatctgtgcacgaacccatgcaaacaggcttaaaagcagtggatagcctggttcctataggccgtggtcaacgagaacttataatcggggacagacaaactggaaaaacagcaatagctatcgatactatattaaaccaaaagcaaatgaactcaaggggcacaaatgagagtgagacattgtattgtgtctatgttgcgattggacaaaaacgctcgactgtggcacaattagttcaaattctttcagaagcgaatgctttggaatattccattcttgtagcagccaccgcttcggatcctgctcctctgcaatttctggccccatattcagggtgtgccatgggggaatatttccgcgataatggaatgcacgcattaattatatatgatgatctaagtaaacaggcggtggcatatcgacaaatgtcattattgttacgccgaccaccaggccgtgaggctttcccaggggatgttttctatttacattcccgtctcttagaaagagccgctaaacgatcggaccagacaggtgcaggtagcttgactgcgttacccgtgattgaaacacaagctggagacgtatcggcctatatccccaccaatgtgatctccattacagatggacaaatctgtttggaaacagagctcttttatcgcggaattagacctgctattaacgttggcttatccgtcagtcgcgtcgggtctgccgctcagttgaaagctatgaaacaagtctgcggtagttcaaaactggaattggcacaatatcgcgaagtggccgccttcgctcaatttgggtcagaccttgatgctgcgactcaggcattactcaatagaggtgcaaggcttacagaagtgcccaaacaaccacaatatgaaccacttccaattgaaaaacaaattgttgtgatttatgctgctgtcaacggcttctgtgatcgaatgccactagacagaatttctcaatatgaaaaagccattctaagtactattaatccagaattactaaaatccttcaacgaaaaagggggattaactaacgaaagaaagattgaacctgatgcttctttaaaacaaactgcgaaggagattaattag</dnaseqindica>|
Link = [http://www.ncbi.nlm.nih.gov/gene?term=6450183 NCBI Gene:atp1]
}}
[[Category:Genes]]
[[Category:Japonica mRNA]]
[[Category:Oryza Sativa Japonica Group]]
[[Category:Japonica Genes]]
[[Category:Japonica Mitochondrion]]
[[Category:Mitochondrion]]

Chalk5

2014-05-28T01:00:29Z

Kaweh:

{{Mitochondrion|
GeneName = chalk5|
Annotated Information = protein coding; the gene of protein chalk5(ATP synthase F0 subunit 1).|
Function = Involved in the synthesis of ATP|
Expression = In the rice atp1 gene, multiple transcripts were observed at some regions of initiation of transcription by primer extension analysis. There were at least eight transcription initiation sites upstream of atp1. Rice atp1 is present in a unique environment and is transcribed at a high level. The multiple initiation sites of the
rice mitochondrial atp1 gene is also regulated in different ways.|
Evolution = R1c might have evolved from R1b through elimination of its partial segments at the end containing the atp1 gene, which was integrated in the soybean genome at another location.The mitochondrial DNA is more conservative and the evolution rate of chloroplast DNA is higher than mitochondrial DNA in rice.|
Labs wodking on this gene = Laboratory of Plant Molecular Genetics; Key Laboratory of Crop Heterosis and Utilization of Ministry of Education; Beijing Key Laboratory of Crop Genetic Improvement; Key Laboratory of MOE for Plant Developmental Biology; State Key Laboratory of Pharmaceutical Biotechnology; Key Laboratory of Tea Biochemistry and Biotechnology; MOE Key Laboratory of Bioinformatics and Bioinformatics Div. TNLIST.|
References = Notsu Y, Masood S, Nishikawa T, et al. The complete sequence of the rice (Oryza sativa L.) mitochondrial genome: frequent DNA sequence acquisition and loss during the evolution of flowering plants[J]. Molecular Genetics and Genomics, 2002, 268(4): 434-445.
Wei X, Wang R, Cao L, et al. Origin of Oryza sativa in China inferred by nucleotide polymorphisms of organelle DNA[J]. PloS one, 2012, 7(11): e49546.
Li S, Yang D, Zhu Y. Characterization and use of male sterility in hybrid rice breeding[J]. Journal of Integrative Plant Biology, 2007, 49(6): 791-804.
Tan Y P, Li S Q, Xie H W, et al. Genetical and molecular analysis reveals a cooperating relationship between cytoplasmic male sterility-and fertility restoration-related genes in Oryza species[J]. Theoretical and Applied Genetics, 2011, 122(1): 9-19.
Wang B, Yuan J, Liu J, et al. Codon usage bias and determining forces in green plant mitochondrial genomes[J]. Journal of integrative plant biology, 2011, 53(4): 324-334.
Pasentsis K, Falara V, Pateraki I, et al. Identification and expression profiling of low oxygen regulated genes from Citrus flavedo tissues using RT-PCR differential display[J]. Journal of experimental botany, 2007, 58(8): 2203-2216.
Duroux L, Welinder K G. The peroxidase gene family in plants: a phylogenetic overview[J]. Journal of molecular evolution, 2003, 57(4): 397-407.
Zhu L, Deng W W, Ye A H, et al. Cloning of two cDNAs encoding a family of ATP sulfurylase from Camellia sinensis related to selenium or sulfur metabolism and functional expression in Escherichia coli[J]. Plant Physiology and Biochemistry, 2008, 46(8): 731-738.
Chen X, Wang Y, Li J, et al. Mitochondrial proteome during salt stress-induced programmed cell death in rice[J]. Plant Physiology and Biochemistry, 2009, 47(5): 407-415.
Lei B, Li S, Liu G, et al. Evolution of mitochondrial gene content: loss of genes, tRNAs and introns between Gossypium harknessii and other plants[J]. Plant Systematics and Evolution, 2013, 299(10): 1889-1897.|

Structured information = The product of the gene is the subunit of the ATP synthase F0(ATP synthase F0 subunit 1)
Description = ATP synthase F0 subunit 1|
Version = GeneID:6450183|
Length = 1530 bp|
Definition = Oryza sativa Japonica Group ''atp1'', Mitochondrion gene.|
Source = Oryza sativa Japonica Group

ORGANISM Oryza sativa Japonica Group
Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
Spermatophyta; Magnoliophyta; Liliopsida; Poales; Poaceae; BEP
clade; Ehrhartoideae; Oryzeae; Oryza.
|
Chromosome = [[:category:Japonica Mitochondrion|Mitochondrion]]|
AP = Mitochondrion:352379..353908|
CDS = 352379..353908|
GCID = <gbrowseImage1>
name=NC_011033:352379..353908
source=Rice_Japonica_Mitochondrion
preset=GeneLocation
</gbrowseImage1>|
GSID = <gbrowseImage2>
name=NC_011033:352379..353908
source=Rice_Japonica_Mitochondrion
preset=GeneLocation
</gbrowseImage2>|
AA = <aaseq>MEFSPRAAELTTLLESRMTNFYTNFQVDEIGRVVSVGDGIARVYGLNEIQAGEMVEFASGVKGIALNLENENVGIVVFGSDTAIKEGDLVKRTGSIVDVPAGKAMLGRVVDALGVPIDGKGALSDHERRRVEVKAPGIIERKSVHEPMQTGLKAVDSLVPIGRGQRELIIGDRQTGKTAIAIDTILNQKQMNSRGTNESETLYCVYVAIGQKRSTVAQLVQILSEANALEYSILVAATASDPAPLQFLAPYSGCAMGEYFRDNGMHALIIYDDLSKQAVAYRQMSLLLRRPPGREAFPGDVFYLHSRLLERAAKRSDQTGAGSLTALPVIETQAGDVSAYIPTNVISITDGQICLETELFYRGIRPAINVGLSVSRVGSAAQLKAMKQVCGSLKLELAQYREVAAFAQFGSDLDAATQALLNRGARLTEVSKQPQYEPLPIEKQIVVIYAAVNGFCDRMPLDRISQYEKAILSTINPELLKSFNEKGGLTNERKIELDAFLKQTAKEIN</aaseq>|
DNA = <dnaseqindica>1..1530#atggaattctcacccagagctgcggaactcacgactctattagaaagtagaatgaccaacttttacacgaattttcaagtggatgagatcggtcgagtggtctcagttggagatgggattgcacgtgtttatggattgaacgagattcaagctggagaaatggtggaatttgccagcggtgtgaaaggaatagccttgaatcttgagaatgagaatgtaggtattgttgtctttggtagtgataccgctattaaagaaggagatcttgtcaagcgcactggatctattgtggatgttcctgcgggaaaggccatgttaggccgtgtggtcgacgccttgggagtacctattgatggaaaaggggctctaagcgatcacgaacgaagacgtgtcgaagtgaaagccccagggattattgaacgtaaatctgtgcacgaacccatgcaaacaggcttaaaagcagtggatagcctggttcctataggccgtggtcaacgagaacttataatcggggacagacaaactggaaaaacagcaatagctatcgatactatattaaaccaaaagcaaatgaactcaaggggcacaaatgagagtgagacattgtattgtgtctatgttgcgattggacaaaaacgctcgactgtggcacaattagttcaaattctttcagaagcgaatgctttggaatattccattcttgtagcagccaccgcttcggatcctgctcctctgcaatttctggccccatattcagggtgtgccatgggggaatatttccgcgataatggaatgcacgcattaattatatatgatgatctaagtaaacaggcggtggcatatcgacaaatgtcattattgttacgccgaccaccaggccgtgaggctttcccaggggatgttttctatttacattcccgtctcttagaaagagccgctaaacgatcggaccagacaggtgcaggtagcttgactgcgttacccgtgattgaaacacaagctggagacgtatcggcctatatccccaccaatgtgatctccattacagatggacaaatctgtttggaaacagagctcttttatcgcggaattagacctgctattaacgttggcttatccgtcagtcgcgtcgggtctgccgctcagttgaaagctatgaaacaagtctgcggtagttcaaaactggaattggcacaatatcgcgaagtggccgccttcgctcaatttgggtcagaccttgatgctgcgactcaggcattactcaatagaggtgcaaggcttacagaagtgcccaaacaaccacaatatgaaccacttccaattgaaaaacaaattgttgtgatttatgctgctgtcaacggcttctgtgatcgaatgccactagacagaatttctcaatatgaaaaagccattctaagtactattaatccagaattactaaaatccttcaacgaaaaagggggattaactaacgaaagaaagattgaacctgatgcttctttaaaacaaactgcgaaggagattaattag</dnaseqindica>|
Link = [http://www.ncbi.nlm.nih.gov/gene?term=6450183 NCBI Gene:atp1]
}}
[[Category:Genes]]
[[Category:Japonica mRNA]]
[[Category:Oryza Sativa Japonica Group]]
[[Category:Japonica Genes]]
[[Category:Japonica Mitochondrion]]
[[Category:Mitochondrion]]

Chalk5

2014-05-21T05:07:10Z

Kaweh: Created page with "Rice genes, including ''Oryza sativa'' ''Japonica'' and ''Indica''. Gene Name=chalk5 Descrition=putative protein phosph..."

Rice genes, including ''Oryza sativa'' ''[[:Category:Japonica Genes|Japonica]]'' and ''[[:Category:Indica Genes|Indica]]''.
Gene Name=chalk5
Descrition=putative protein phosphatase with Kelch-like repeat domain (OsPPKL1)|
version=TCAGGTACCGATCGAGCTTAGCTT
TGCGCTTCGTTCATC

Category:Genes

2014-05-21T04:52:32Z

Kaweh: