<?xml version="1.0"?>
<feed xmlns="http://www.w3.org/2005/Atom" xml:lang="en">
		<id>http://192.168.164.12:81/ricewiki/api.php?action=feedcontributions&amp;feedformat=atom&amp;user=Lmw2015</id>
		<title>RiceWiki - User contributions [en]</title>
		<link rel="self" type="application/atom+xml" href="http://192.168.164.12:81/ricewiki/api.php?action=feedcontributions&amp;feedformat=atom&amp;user=Lmw2015"/>
		<link rel="alternate" type="text/html" href="https://ngdc.cncb.ac.cn/ricewiki/index.php/Special:Contributions/Lmw2015"/>
		<updated>2026-08-27T20:27:38Z</updated>
		<subtitle>User contributions</subtitle>
		<generator>MediaWiki 1.30.0</generator>

	<entry>
		<id>https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os12g0610200&amp;diff=248937</id>
		<title>Os12g0610200</title>
		<link rel="alternate" type="text/html" href="https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os12g0610200&amp;diff=248937"/>
				<updated>2015-06-12T04:36:16Z</updated>
		
		<summary type="html">&lt;p&gt;Lmw2015: /* References */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&lt;br /&gt;
''OsPIL11'', with accession number Os12g0610200, is one of six putative phytochrome-interacting factors(PIFs).&lt;br /&gt;
&lt;br /&gt;
==Annotated Information==&lt;br /&gt;
===Constitution===&lt;br /&gt;
''OsPIL11'' contain a conserved sequence motif at their N-terminal regions, designated as the active phytochrome-binding (APB) motif (active phytochrome-binding protein, also named as PIL motif). Four invariant amino acid residues(ELxxxxGQ) are critical determinants of the APB motif. This motif is necessary for binding to the biologically active Pfr form of phyB &amp;lt;ref name=&amp;quot;ref1&amp;quot; /&amp;gt;. &lt;br /&gt;
&lt;br /&gt;
===Function===&lt;br /&gt;
''OsPIL11'' is a member of the rice phytochrome-interacting factors (PIFs) family. Nakamura et al &amp;lt;ref name=&amp;quot;ref2&amp;quot; /&amp;gt; identified six candidate genes encoding PIFs, designated ''OsPIL11'' to ''OsPIL16'', via homologous analysis in rice genome. ''OsPIL11'' contain APB motif at their N-termini, suggesting the possible interaction between PIF and phytochromes in rice &amp;lt;ref name=&amp;quot;ref2&amp;quot; /&amp;gt;. &lt;br /&gt;
&lt;br /&gt;
PIFs, as a small subset of the basic helix-loop-helix (bHLH) transcription factor superfamily, have been found to bind to the G-box motif in the promoter region of light-regulated genes. Thus, PIFs constitute a signal transfer pathway from photoactivated phytochromes to the light-regulation of gene expression that controls photomorphogenesis in plants. Among phytochrome associated proteins, phytochrome-interacting factors (PIFs) are central player in phytochrome-mediated signal transduction &amp;lt;ref name=&amp;quot;ref3&amp;quot; /&amp;gt;&amp;lt;ref name=&amp;quot;ref4&amp;quot; /&amp;gt;. &lt;br /&gt;
In addition, ''OsPIL11'' plays important roles in light signal transduction in rice leaves and its development, and it may also involve in the regulation of plant hormones.&lt;br /&gt;
&lt;br /&gt;
===Expression===&lt;br /&gt;
''OsPIF11'' gene is widely expressed in rice roots, stems, new leaves and old leaves. The ''OsPIFs11'' transcription factor expression level in the leaves is significantly higher than in the roots and stems, and the expression is the lowest in roots.&lt;br /&gt;
&lt;br /&gt;
The expression of ''OsPIL11'' also is organ-specific and is regulated by leaf development, abscisic acid (ABA), jasmonic acid (JA) and salicylic acid (SA). ''OsPIL11'' is involved in red light-induced de-etiolation, but not in far-red lignt-induced de-etiolation in transgenic tobacco. ''OsPIL11'' expressed higher in the new leaves than in the old leaves. Therefore, the expression of ''OsPIL11'' gene was regulated by hormones in rice &amp;lt;ref name=&amp;quot;ref5&amp;quot; /&amp;gt;. &lt;br /&gt;
&lt;br /&gt;
==Labs working on this gene==&lt;br /&gt;
·High-Tech Research Center, Shandong Academy of Agricultural Sciences, Ji’nan 250100, China&lt;br /&gt;
&lt;br /&gt;
·College of Life Science, Henan Normal University, Xinxiang 453007, China&lt;br /&gt;
&lt;br /&gt;
·College of Life Sciences, Shandong Normal University, Jinan 250014, China&lt;br /&gt;
&lt;br /&gt;
·Laboratory of Molecular Microbiology, School of Agriculture, Nagoya University, Chikusa-ku, Nagoya 464-8601, Japan &lt;br /&gt;
&lt;br /&gt;
·National Key Laboratory of Plant Molecular Genetics, Institute of Plant Physiology and Ecology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, 300 Fenglin Road, Shanghai 200032, China&lt;br /&gt;
&lt;br /&gt;
[[Category:Genes]]&lt;br /&gt;
[[Category:Japonica mRNA]]&lt;br /&gt;
[[Category:Oryza Sativa Japonica Group]]&lt;br /&gt;
[[Category:Japonica Genes]]&lt;br /&gt;
[[Category:Japonica Chromosome 12]]&lt;br /&gt;
[[Category:Chromosome 12]]&lt;/div&gt;</summary>
		<author><name>Lmw2015</name></author>	</entry>

	<entry>
		<id>https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os12g0603700&amp;diff=248936</id>
		<title>Os12g0603700</title>
		<link rel="alternate" type="text/html" href="https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os12g0603700&amp;diff=248936"/>
				<updated>2015-06-12T04:35:53Z</updated>
		
		<summary type="html">&lt;p&gt;Lmw2015: /* Structured Information */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;'''''OsCIPK04''''' is a member of '''CIPK genes''' (CIPKs,calcineurin B-like protein interacting protein kinases)&amp;lt;ref name=&amp;quot;ref1&amp;quot;/&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
==Annotated Information==&lt;br /&gt;
===Function===&lt;br /&gt;
The function of ''OsCIPK04'' is '''specific to vegetative tissues/organs''' according to expression pattern. ''OsCIPK04'' might function downstream of ''OsGI''&amp;lt;ref name=&amp;quot;ref1&amp;quot;/&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
'''GO assignment(s):''' [http://amigo.geneontology.org/amigo/term/GO:0004672 GO:0004672],[http://amigo.geneontology.org/amigo/term/GO:0004674 GO:0004674], [http://amigo.geneontology.org/amigo/term/GO:0006468 GO:0006468], [http://amigo.geneontology.org/amigo/term/GO:0005524 GO:0005524], [http://amigo.geneontology.org/amigo/term/GO:0007165 GO:0007165]&lt;br /&gt;
&lt;br /&gt;
===Expression===&lt;br /&gt;
[[File: OsCIPK04 Expression1.jpg|right|thumb|250px|'''Figure 1.''' ''Validation of diurnal expression patterns for OsCIPK04.(from reference &amp;lt;ref name=&amp;quot;ref1&amp;quot;/&amp;gt;).'']]&lt;br /&gt;
[[File: OsCIPK04 Expression2.jpg|right|thumb|250px|'''Figure 2.''' ''Down-regulation in response to drought stress were analyzed through real-time RT-PCR analysis.(from reference &amp;lt;ref name=&amp;quot;ref1&amp;quot;/&amp;gt;).'']] &lt;br /&gt;
&lt;br /&gt;
*''OsCIPK04'' showed '''down-regulation''' under '''drought stress'''(Fig. 1)&amp;lt;ref name=&amp;quot;ref1&amp;quot;/&amp;gt;. &lt;br /&gt;
&lt;br /&gt;
*Of the two genes in subgroup VII, ''OsCIPK04'' showed preferred expression in the '''root and internode''' while ''OsCIPK07'' showed high expression in the '''root''', '''shoot''', and '''leaf''', which indicating that the function of both genes is '''specific to''' vegetative tissues/organs according to expression pattern&amp;lt;ref name=&amp;quot;ref1&amp;quot;/&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
*''OsCIPK04'' peaked during the light period, the peak time of ''OsCIPK04'' was a little earlier than that of ''OsCIPK07'', suggesting the possibility of sequential regulation of circadian expression between them&amp;lt;ref name=&amp;quot;ref1&amp;quot;/&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
*The x-axis indicates sampling time used for real-time RT-PCR analysis and the y-axis indicates the relative expression level to OsUbi5. 2 h drought stress treated seedling leaves for 2 h, 2hc control for 2 h, 4 h drought stress treated seedling leaves for 4 h, 4hc control for 4 h, 6 h drought stress treated seedling leaves for 6 h, 6hc control for 6 h, 8 h drought stress treated seedling leaves for 8 h, 8hc control for 8 h(Fig. 2)&amp;lt;ref name=&amp;quot;ref1&amp;quot;/&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
*Real-time RT-PCR analysis confirmed the diurnal expression patterns showing a peak at daytime and a downregulation in the ''osgi'' mutant for the three marker genes and nine of the ''OsCIPK'' genes, ''OsCIPK04'' is a member of these nine genes&amp;lt;ref name=&amp;quot;ref1&amp;quot;/&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
===Evolution===&lt;br /&gt;
'''''OsCIPK04''''' and [[Os03g0634400|'''''OsCIPK07''''']] belongs to '''Group VII''' of ''OsCIPK'' family&amp;lt;ref name=&amp;quot;ref1&amp;quot;/&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
===Knowledge Extension===&lt;br /&gt;
[[File: OsCIPK family Functional.png|left|thumb|260px|'''Figure 3.''' ''Functional gene network analysis of OsCIPK family members.(from reference &amp;lt;ref name=&amp;quot;ref1&amp;quot;/&amp;gt;).'']]  &lt;br /&gt;
*From real-time RT-PCR analyses, ''Giong et al.'' identified 16 OsCIPK genes showing a significant up- or down-regulation in response to '''drought stress'''. Using the probable functional gene network tool, RiceNet, ''Giong et al.'' generated a hypothetical functional gene network based on 15 out of 16 OsCIPK proteins (Fig. 3)&amp;lt;ref name=&amp;quot;ref1&amp;quot;/&amp;gt;. &lt;br /&gt;
*More than 200 interactions mediated by these OsCIPK proteins. This network was further refined by integrating fold change data showing at least 1 log2-fold up-regulation (red colored nodes in Fig. 3) or less than -1 log2-fold down-regulation (green colored nodes in Fig. 3) under drought stress to all the elements in this network&amp;lt;ref name=&amp;quot;ref1&amp;quot;/&amp;gt;.&lt;br /&gt;
*Integrated subcellular localization data further enhances the feasibility of functional modules consisting of co-expressed functional groups such as CIPK and PPC and other components in the network(Fig. 3)&amp;lt;ref name=&amp;quot;ref1&amp;quot;/&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
*The calcineurin B-like protein–CBL-interacting protein kinase ('''CBL–CIPK''') signaling pathway in plants is a Ca&amp;lt;sup&amp;gt;2+&amp;lt;/sup&amp;gt;-related pathway that responds strongly to both abiotic and biotic environmental stimuli&amp;lt;ref name=&amp;quot;ref2&amp;quot;/&amp;gt;. The CBL-CIPK system shows variety, specificity, and complexity in response to different stresses, and the CBL–CIPK signaling pathway is regulated by complex mechanisms in plant cells&amp;lt;ref name=&amp;quot;ref2&amp;quot;/&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
==Labs working on this gene==&lt;br /&gt;
*Department of Plant Molecular Systems Biotechnology &amp;amp; Crop Biotech Institute, Kyung Hee University, Yongin 446-701, Korea&lt;br /&gt;
*Graduate School of Biotechnology, Kyung Hee University, Yongin 446-701, Korea&lt;br /&gt;
&lt;br /&gt;
==References==&lt;br /&gt;
&amp;lt;references&amp;gt;&lt;br /&gt;
* &amp;lt;ref name=&amp;quot;ref1&amp;quot;&amp;gt;&lt;br /&gt;
Giong H K, Moon S, Jung K H. A systematic view of the rice calcineurin B-like protein interacting protein kinase family[J]. Genes &amp;amp; Genomics, 2015, 37(1): 55-68. &lt;br /&gt;
&amp;lt;/ref&amp;gt;&lt;br /&gt;
* &amp;lt;ref name=&amp;quot;ref2&amp;quot;&amp;gt;&lt;br /&gt;
Yu Q, An L, Li W. The CBL–CIPK network mediates different signaling pathways in plants[J]. Plant cell reports, 2014, 33(2): 203-214.&lt;br /&gt;
&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;/references&amp;gt;&lt;br /&gt;
&lt;br /&gt;
[[Category:Genes]]&lt;br /&gt;
[[Category:Japonica mRNA]]&lt;br /&gt;
[[Category:Oryza Sativa Japonica Group]]&lt;br /&gt;
[[Category:Japonica Genes]]&lt;br /&gt;
[[Category:Japonica Chromosome 12]]&lt;br /&gt;
[[Category:Chromosome 12]]&lt;/div&gt;</summary>
		<author><name>Lmw2015</name></author>	</entry>

	<entry>
		<id>https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os12g0597000&amp;diff=248935</id>
		<title>Os12g0597000</title>
		<link rel="alternate" type="text/html" href="https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os12g0597000&amp;diff=248935"/>
				<updated>2015-06-12T04:35:35Z</updated>
		
		<summary type="html">&lt;p&gt;Lmw2015: /* Structured Information */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;CBL proteins are calcium-binding proteins that are thought to function as plant signal transduction elements. Only one rice CBL gene, OsCBL2, is up-regulated by GA in the aleurone layer.&lt;br /&gt;
==Annotated Information==&lt;br /&gt;
===Function===&lt;br /&gt;
[[File:Table1.jpg|left|thumb|200px|'''Table1''' Amino acid similarity and identity of rice CBLs (OsCBL1–10) and Arabidopsis CBLs (AtCBL1–10).    For each pairwise comparison, similarity values are followed by identity values in parentheses.(from reference&amp;lt;ref name=&amp;quot;ref1&amp;quot; /&amp;gt;)]]&lt;br /&gt;
[[File:图片1.png|left|thumb|200px|'''Figure 1''' Yeast two-hybrid analysis demonstrates an interaction between OsCBLs and AtCIPKs. OsCBLs and AtCIPKs were translationally fused to the GAL4 DNA-binding domain (BD) and activation domain (AD) as indicated. Nutritional reporter systems minus Leu plus Trp (−LT) and minus Leu, Trp, and His (−LHT) and filter-lift GAL assays were employed to examine the interaction between OsCBLs and AtCIPKs (A). A positive control showing the interaction of AtCBL1 with AtCIPK1 is shown in B.(from reference&amp;lt;ref name=&amp;quot;ref1&amp;quot; /&amp;gt;)]]&lt;br /&gt;
[[File:图片2.png|right|thumb|200px|'''Figure 2''' OsCBL2 to 4 are localized to membranes. OsCBL1 to 4 were translationally fused to GFP and transiently expressed in barley aleurone protoplasts. The figure shows representative epifluorescence images (top) and bright-field images (bottom) of single, transformed cells. The unmagnified width of each image is approximately 40 μm.(from reference&amp;lt;ref name=&amp;quot;ref1&amp;quot; /&amp;gt;)]]&lt;br /&gt;
[[File:图片970009-3.png|left|thumb|200px|'''Figure 3''' Antisense OsCBL2 or HvCBL2delays the GA-induced vacuolation of barley aleurone protoplasts. Barley protoplasts were cotransfected with GFP andAsOsCBL2, GFP, andAsHvCBL2, or with GFP and empty cassette (pLZUbi) using the constructs diagrammed in A. The extent of vacuolation for individual protoplasts was scored using the five categories indicated in B. Vacuoles are seen as dark regions surrounded by bright regions of cytoplasm. The number of protoplasts in each category 48 h after transfection and 42 h after treatment with GA are shown in C forAsOsCBL2 and in D for AsHvCBL2.(from reference&amp;lt;ref name=&amp;quot;ref1&amp;quot; /&amp;gt;)]]&lt;br /&gt;
[[File:图片10-4.gif|right|thumb|200px|'''Figure 4''' Antisense OsCBL2 does not delay GA-induced transcription of GUS from anα-amylase promoter in rice half-grain. A diagram of the constructs introduced by particle bombardment is shown in A. Transcription of GUS from a GA-regulated α-amylase promoter was measured relative to expression of LUX (GUS:LUX ratio) driven by a constitutive ubiquitin promoter (B). Half-grains were incubated for 24 h without hormone (−GA) or with GA and the ratio of GUS-to-LUX expression determined in the presence and absence of the antisense construct.(from reference&amp;lt;ref name=&amp;quot;ref1&amp;quot; /&amp;gt;)]]&lt;br /&gt;
Many developmental and environmental signals are transduced through changes in intracellular calcium concentrations. Calcineurin B-like (CBL) proteins are calcium-binding proteins that are thought to function as plant signal transduction elements. RNA profiling using a rice (Oryza sativa cv Nipponbare) oligonucleotide microarray was used to monitor gene expression in de-embryonated rice grains. This analysis showed that a putative rice CBL gene responded to gibberellic acid, but not abscisic acid, treatment. The CBL gene family in rice contains at least 10 genes and these have extensive similarity to the CBLs of Arabidopsis (Arabidopsis thaliana). In yeast (Saccharomyces cerevisiae) two-hybrid assays, rice CBLs interact with the kinase partners of Arabidopsis CBLs. Only one rice CBL gene, OsCBL2, is up-regulated by GA in the aleurone layer.&amp;lt;ref name=&amp;quot;ref1&amp;quot; /&amp;gt;&lt;br /&gt;
&lt;br /&gt;
'''OsCBLs Interact with AtCIPKs'''&lt;br /&gt;
&lt;br /&gt;
We used the yeast two-hybrid system to demonstrate that rice CBLs interact with AtCIPKs. OsCBL1 to 4 were fused to the binding domain of GAL4, whereasAtCIPK1, 6, and 8 were fused to the activation domain of GAL4. Figure 1A shows the growth of yeast on selection medium and the corresponding assay for β-galactosidase when these different OsCBLs and AtCIPKs were used as bait and prey. As expected, the positive control showed interaction between AtCBL1 and AtCIPK1 (Fig. 1B)&amp;lt;ref name=&amp;quot;ref2&amp;quot; /&amp;gt;. OsCBL2, which has 74% amino acid similarity with AtCBL1 (Table I), also had a strong interaction with AtCIPK1. Like AtCBL1&amp;lt;ref name=&amp;quot;ref3&amp;quot; /&amp;gt;, OsCBL2 interacted strongly with AtCIPK8 and weakly with AtCIPK6. OsCBL4 also interacted strongly with AtCIPK1 and 8, but unlike OsCBL2, it did not interact with AtCIPK6. OsCBL1 and 3 both interacted with all three of the Arabidopsis CIPKs examined. These data provide evidence that OsCBL1 to 4 proteins are functional homologs of Arabidopsis CBL proteins. &lt;br /&gt;
&lt;br /&gt;
Specificity for rice CBL function is likely to arise from differences in intracellular localization and different timing of expression. We show here that OsCBL2 and 3are targeted to the TN, and OsCBL4 to the PM (Fig. 2). Even though both OsCBL2 and 3 are targeted to the TN, their roles may be distinguished by the timing of their expression. For example, OsCBL2 is expressed in aleurone during germination, but OsCBL3 was not detectable in this tissue under the conditions that we have tested. OsCBL2 may be involved in vacuole function since transformation of aleurone protoplasts with an antisense construct of OsCBL2 orHvCBL2 slowed the rate of GA-induced vacuolation (Fig. 3), but not GA-induced transcription of an α-amylase reporter construct (Fig. 4).&lt;br /&gt;
&lt;br /&gt;
===Expression===&lt;br /&gt;
[[File:图片4-5.png|left|thumb|200px|'''Figure 5''' OsCBL2 but not OsCBL1shows GA-specific up-regulation in embryoless rice half-grains. Total RNA was isolated from grains treated with ABA or GA (A) or no hormone (B) for the indicated times. Note that changes in mRNA abundance reflect changes occurring in the aleurone layer.(from reference&amp;lt;ref name=&amp;quot;ref1&amp;quot; /&amp;gt;)]]&lt;br /&gt;
[[File:图片1-6.png|right|thumb|200px|'''Figure 6''' The rice calcineurin B-like gene OsCBL2 is up-regulated by GA treatment of rice aleurone layers. Transcript abundance of OsCBL2 (black circles) and actin (white circles) as measured by hybridization to a rice oligonucleotide chip (A). Total RNA was extracted from embryoless rice half-grains treated with GA, ABA, or no hormone for the indicated time. Expression of GA-induced α-amylase, RAmy1A (B), and ABA-induced dehydrin (C) genes in the same chip experiment are shown for comparison.(from reference&amp;lt;ref name=&amp;quot;ref1&amp;quot; /&amp;gt;)]]&lt;br /&gt;
[[File:图片3-7.png|left|thumb|200px|'''Figure 7''' OsCBL2 is expressed in many rice organs and at all stages of rice plant development. Data are pooled from individual microarray experiments where each radius in the figure represents a separate experiment. RNA samples were pooled prior to hybridization to the chip, and the data are presented as normalized intensity values.(from reference&amp;lt;ref name=&amp;quot;ref1&amp;quot; /&amp;gt;)]]&lt;br /&gt;
[[File:图片5-8.png|right|thumb|200px|'''Figure 8''' OsCBLs are expressed in rice seedling tissues. Total RNA was isolated from scutella, shoots, and roots of 1-week-old rice seedlings. RNA blots were probed with gene-specific probes for OsCBL1 to3. Hybridization to actin was used as a loading control.(from reference&amp;lt;ref name=&amp;quot;ref1&amp;quot; /&amp;gt;)]]&lt;br /&gt;
[[File:图片6-9.png|left|thumb|200px|'''Figure 9''' Expression of OsCBL2 in wild-type rice grain is higher than expression in d1 mutant grain. Total RNA was extracted from embryoless wild-type rice grain or d1mutant grain treated with 0.1 or 5 μM GA for 0, 3, or 8 h. RNA abundance of OsCBL2was determined using microarray (A and B) or northern (C) analysis. The abundance of rice RAmy1Awas also determined using the microarray (B).(from reference&amp;lt;ref name=&amp;quot;ref1&amp;quot; /&amp;gt;)]]&lt;br /&gt;
&lt;br /&gt;
OsCBL2 high expression in booting culms, young spikes, seedling roots and shoots. Expression of OsCBL2 is not induced by salt, drought, cold or ABA treatment. Although both OsCBL1 and 2 were expressed in rice half-grains, OsCBL2 was specifically up-regulated by GA (Fig. 5).  GeneChip and RNA blotting experiments showed that OsCBL2 was most strongly expressed in aleurone and root and, using an expression intensity value of 50 as a cutoff, it is clear thatOsCBL2 is expressed in most tissues of the rice plant. &lt;br /&gt;
&lt;br /&gt;
In aleurone cells, GA stimulates the synthesis and secretion of hydrolytic enzymes including α-amylase, promotes the vacuolation of the aleurone protoplast, and initiates programmed cell death. All of these processes require an increase in [Ca2+]cyt. Here we show that the expression of one gene in the rice CBL family is up-regulated in aleurone by GA, but not by ABA. We show that other rice CBLs are not differentially expressed by GA and ABA in aleurone or in vegetative tissues of the shoot or root. We present data showing that OsCBL2 is localized to the aleurone tonoplast (TN), and transient expression assays with rice and barley CBLs in barley aleurone cells indicate that they are likely to be involved in a GA-signaling pathway that leads to the vacuolation of the aleurone cell.&amp;lt;ref name=&amp;quot;ref1&amp;quot; /&amp;gt;&lt;br /&gt;
&lt;br /&gt;
'''Hormone and Tissue-Specific Expression of OsCBLs'''&lt;br /&gt;
&lt;br /&gt;
Only OsCBL2 contains the probe sequences found on the rice GeneChip microarray. It is therefore highly likely that the GA-regulated CBL identified in our microarray experiments (Fig. 6) is OsCBL2. We used the GeneChip microarray to quantitate the expression of OsCBL2 in the tissues of rice cv Nipponbare at all stages of development. These data are presented in Figure 7, where GeneChip intensity values for each tissue or organ are plotted with higher values farther from the center of the figure. OsCBL2 is expressed at high levels in roots of seedlings and tillering plants, during early stages of panicle and seed formation, and in the aleurone of mature grain. Expression of OsCBL2 was lowest in mature leaves and stems and in the emerging inflorescence shoot (Fig. 7).&lt;br /&gt;
&lt;br /&gt;
To investigate the expression of OsCBLs in germinating Nipponbare rice seedling tissues, RNA was isolated from scutellum, shoots, and roots of 7-d-old seedlings and northern blots were hybridized with gene-specific probes for OsCBL1 to 3(Fig. 8). OsCBL2 is expressed in all rice seedling tissues and this confirmed the analysis made with the GeneChip array (Fig. 7). RNA blotting also confirmed thatOsCBL2 mRNA was abundant in roots relative to shoots and scutella, whereas theOsCBL1 transcript was more abundant in shoots than in roots and the OsCBL3transcript was abundant in both root and shoot tissue (Fig. 8). OsCBL4 and 7 were not expressed strongly enough in tissues of 7-d-old seedlings to be detected.&amp;lt;ref name=&amp;quot;ref1&amp;quot; /&amp;gt;&lt;br /&gt;
&lt;br /&gt;
'''GA-Induced Expression of OsCBL2 Is Reduced in the Aleurone Layer of dwarf1 Mutant Rice'''&lt;br /&gt;
&lt;br /&gt;
We also used RNA profiling and northern blotting to see whether GA-induced expression of OsCBL2 in aleurone cells was dependent on a signaling pathway that utilizes heterotrimeric G-proteins. For these experiments, RNA was isolated from half-grains of wild-type and dwarf1 (d1) mutant rice. The d1 rice mutant lacks the α-subunit of heterotrimeric G-proteins and shows a defective GA response, except at high GA concentrations&amp;lt;ref name=&amp;quot;ref4&amp;quot; /&amp;gt;.  In the experiment shown in Figure 9A, there was a 3-fold increase in OsCBL2 expression in wild-type rice aleurone after 8-h incubation at a high (5 μM) GA concentration. When wild-type half-grains were incubated with a low (100 nM) GA concentration,OSCBL2 expression was still almost twice as high as that at time zero (Fig. 9A). Expression of OsCBL2 in d1 half-grains, however, was much reduced at 5 μM GA compared to wild type, and transcript abundance was virtually unchanged following 8-h incubation with 100 nM GA (Fig. 9A). Similar changes in expression were observed for α-amylase in d1 and wild-type rice half-grains (Fig. 9B). Thus, there was virtually no change in the expression of the RAmy1A gene at low GA concentrations in d1 rice, whereas in wild-type rice grain low GA brought about a large change in RAmy1A expression (Fig. 9B). RNA blotting was used to confirm the microarray data on CBL expression as shown in Figure 9C. Expression ofOsCBL2 was observed in wild-type aleurone and the d1 mutant at 5 μM GA, butOsCBL2 transcript could not be detected in the d1 mutant at 100 nM GA.&amp;lt;ref name=&amp;quot;ref1&amp;quot; /&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Mutation===&lt;br /&gt;
The amount of OsCBL2 transcript was increased specifically by GA treatment in rice aleurone (Figs.5,6, and 9). Using microarray analyses and RNA blots, we show that the up-regulation ofOsCBL2 expression occurs within 3 h of GA treatment and persists for at least 48 h (Figs.5,6, and 9). Data from experiments with the d1 mutant of rice strongly suggest that OsCBL2 transcription is part of a GA-signaling pathway that involves the α-subunit of heterotrimeric G-proteins (Fig. 9). &lt;br /&gt;
&lt;br /&gt;
OsCBL2 expression in aleurone is specifically up-regulated by GA (Figs. 5 and 6). Transcript abundance was unchanged when rice half-grains were incubated with ABA or no hormone, or when seedlings were exposed to various stresses. Perhaps more interesting is our observation that correct expression of OsCBL2 in aleurone protoplasts seems to be required for proper vacuolation (Fig. 3). When barley aleurone protoplasts were transiently transformed with antisense constructs forOsCBL2 or HvCBL2 (Fig. 3, C and D), vacuolation was retarded. This was a specific effect in that AsOsCBL2 did not inhibit transcription from an α-amylase promoter (Fig. 4). One interpretation of these data is that OsCBL2 interacts with one or more proteins in aleurone cells, and that an insufficient amount of OsCBL2 leads to a defect in vacuole function. For example, OsCBL2 may activate a CIPK and the OsCBL2/CIPK complex may promote vacuole fusion and enlargement. AntisenseOsCBL2 would reduce the amount of OsCBL2 and prevent the formation of the active OsCBL/CIPK complex. This speculation is consistent with our previous data showing that a Ser/Thr protein kinase present on the TN in barley aleurone protoplasts is involved in the gating of a Ca2+-regulated ion channel&amp;lt;ref name=&amp;quot;ref5&amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
===Knowledge Extension===&lt;br /&gt;
A homolog with 91% sequence identity to OsCBL2 was cloned from barley (Hordeum vulgare cv Himalaya), and designated HvCBL2. We examined the localization and function of OsCBL2 and HvCBL2 in rice and barley aleurone because changes in cytosolic calcium have been implicated in the response of the aleurone cell to GA. Green fluorescent protein translational fusions of OsCBL2 and OsCBL3 were localized to the tonoplast of aleurone cell protein storage vacuoles and OsCBL4-green fluorescent protein was localized to the plasma membrane. Data from experiments using antisense expression of OsCBL2 and HvCBL2 are consistent with a role for OsCBL2 in promoting vacuolation of barley aleurone cells following treatment with GA.&amp;lt;ref name=&amp;quot;ref1&amp;quot; /&amp;gt;&lt;br /&gt;
&lt;br /&gt;
Calcium-binding proteins with similarity to calcineurin B have been cloned recently from plants &amp;lt;ref name=&amp;quot;ref6&amp;quot; /&amp;gt;. These calcineurin B-like proteins (CBLs) contain calcium-binding EF hands and are similar to the regulatory B-subunit of calcineurin and to the neuronal calcium sensor &amp;lt;ref name=&amp;quot;ref7&amp;quot; /&amp;gt;. CBLs, therefore, have the potential to transduce [Ca2+]cyt signals and are thought to play roles in stress and hormone signaling in plants &amp;lt;ref name=&amp;quot;ref8&amp;quot; /&amp;gt;. The first CBL gene to be cloned was a salt overly sensitive (SOS) gene from Arabidopsis (Arabidopsis thaliana) that was designatedSOS3 . SOS3 is identical to AtCLB4, a salt-responsive CBL gene cloned independently from Arabidopsis &amp;lt;ref name=&amp;quot;ref9&amp;quot; /&amp;gt;. At least 10 expressed CBL genes and proteins from Arabidopsis have now been identified, and many CBL genes are present in the sequenced rice (Oryza sativa) genome&amp;lt;ref name=&amp;quot;ref10&amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
==Labs working on this gene==&lt;br /&gt;
Department of Plant and Microbial Biology, University of California, Berkeley, California 94720–3102 (Y.-s.H., P.C.B., Y.H.C., R.L.J.); and Torrey Mesa Research Institute, Syngenta Research and Technology, San Diego, California 92121 (H.-S.C., T.Z.);&lt;br /&gt;
State key lab of crop genetics and germplasm enhancement, Nanjing Agricultural University, Nanjing, 210095, PR China; College of Chemistry and Life Science, Zhejiang Normal University, Jinhua, 321004, PR China&lt;br /&gt;
&lt;br /&gt;
==References==&lt;br /&gt;
&amp;lt;references&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref1&amp;quot;&amp;gt; Hwang Y S, Bethke P C, Cheong Y H, Chang H S, Zhu T, Jones R L. A gibberellin-regulated calcineurin B in rice localizes to the tonoplast and is implicated in vacuole function[J]. Plant Physiol, 2005, 138: 1347-1358&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref2&amp;quot;&amp;gt; Kim KN, Cheong YH, Gupta R, Luan S (2000) Interaction specificity of Arabidopsis calcineurin B-like calcium sensors and their target kinases. Plant Physiol 124: 1844–1853&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref3&amp;quot;&amp;gt;Kolukisaoglu U, Weinl S, Blazevic D, Batistic O, Kudla J (2004) Calcium sensors and their interacting protein kinases: genomics of the Arabidopsis and rice CBL-CIPK signaling networks. Plant Physiol 134: 43–58&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref4&amp;quot;&amp;gt;Ueguchi-Tanaka M, Fujisawa Y, Kobayashi M, Ashikari M, Iwasaki Y, Kitano H, Matsuoka M (2000) Rice dwarf mutant d1, which is defective in the alpha subunit of the heterotrimeric G protein, affects gibberellin signal transduction. Proc Natl Acad Sci USA 97: 11638–11643 &amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref5&amp;quot;&amp;gt;Bethke PC, Jones RL (1997) Reversible protein phosphorylation regulates the activity of the slow-vacuolar ion channel. Plant J 11: 1227–1235&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref6&amp;quot;&amp;gt;Shi JR, Kim KN, Ritz O, Albrecht V, Gupta R, Harter K, Luan S, Kudla J (1999) Novel protein kinases associated with calcineurin B-like calcium sensors in Arabidopsis. Plant Cell 11: 2393–2405&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref7&amp;quot;&amp;gt;Liu J, Zhu J-K (1998) A calcium sensor homolog required for plant salt tolerance. Science 280: 1943–1945&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref8&amp;quot;&amp;gt;Luan S, Kudla J, Rodriguez-Concepcion M, Yalovsky S, Gruissem W(2002) Calmodulins and calcineurin B-like proteins: calcium sensors for specific signal response coupling in plants. Plant Cell (Suppl) 14: S389–S400&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref9&amp;quot;&amp;gt;Kim KN, Cheong YH, Gupta R, Luan S (2000) Interaction specificity of Arabidopsis calcineurin B-like calcium sensors and their target kinases. Plant Physiol 124: 1844–1853&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref10&amp;quot;&amp;gt;Kolukisaoglu U, Weinl S, Blazevic D, Batistic O, Kudla J (2004) Calcium sensors and their interacting protein kinases: genomics of the Arabidopsis and rice CBL-CIPK signaling networks. Plant Physiol 134: 43–58&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;/references&amp;gt;&lt;br /&gt;
&lt;br /&gt;
[[Category:Genes]]&lt;br /&gt;
[[Category:Japonica mRNA]]&lt;br /&gt;
[[Category:Oryza Sativa Japonica Group]]&lt;br /&gt;
[[Category:Japonica Genes]]&lt;br /&gt;
[[Category:Japonica Chromosome 12]]&lt;br /&gt;
[[Category:Chromosome 12]]&lt;/div&gt;</summary>
		<author><name>Lmw2015</name></author>	</entry>

	<entry>
		<id>https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os12g0586100&amp;diff=248934</id>
		<title>Os12g0586100</title>
		<link rel="alternate" type="text/html" href="https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os12g0586100&amp;diff=248934"/>
				<updated>2015-06-12T04:35:13Z</updated>
		
		<summary type="html">&lt;p&gt;Lmw2015: /* Structured Information */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;Please input one-sentence summary here.&lt;br /&gt;
&lt;br /&gt;
==Annotated Information==&lt;br /&gt;
===Function===&lt;br /&gt;
Please input function information here.&lt;br /&gt;
&lt;br /&gt;
===Expression===&lt;br /&gt;
Please input expression information here.&lt;br /&gt;
&lt;br /&gt;
===Evolution===&lt;br /&gt;
Please input evolution information here.&lt;br /&gt;
&lt;br /&gt;
You can also add sub-section(s) at will.&lt;br /&gt;
&lt;br /&gt;
==Labs working on this gene==&lt;br /&gt;
Please input related labs here.&lt;br /&gt;
&lt;br /&gt;
==References==&lt;br /&gt;
Please input cited references here.&lt;br /&gt;
&lt;br /&gt;
[[Category:Genes]]&lt;br /&gt;
[[Category:Japonica mRNA]]&lt;br /&gt;
[[Category:Oryza Sativa Japonica Group]]&lt;br /&gt;
[[Category:Japonica Genes]]&lt;br /&gt;
[[Category:Japonica Chromosome 12]]&lt;br /&gt;
[[Category:Chromosome 12]]&lt;/div&gt;</summary>
		<author><name>Lmw2015</name></author>	</entry>

	<entry>
		<id>https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os12g0583700&amp;diff=248933</id>
		<title>Os12g0583700</title>
		<link rel="alternate" type="text/html" href="https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os12g0583700&amp;diff=248933"/>
				<updated>2015-06-12T04:34:56Z</updated>
		
		<summary type="html">&lt;p&gt;Lmw2015: /* Structured Information */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;''ZFP252'' is a salt and drought stress responsive TFIIIA-type zinc finger protein gene in rice&amp;lt;ref name=&amp;quot;ref1&amp;quot;/&amp;gt;&amp;lt;ref name=&amp;quot;ref2&amp;quot;/&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
==Annotated Information==&lt;br /&gt;
===Function===&lt;br /&gt;
''Agarwal et al.'' identified a total of 189 C2H2-type zinc finger proteins in the indica rice genome and found 26 genes that were upregulated by cold, drought or salt stress &amp;lt;ref name=&amp;quot;ref3&amp;quot;/&amp;gt;&amp;lt;ref name=&amp;quot;ref4&amp;quot;/&amp;gt;. By gene expression analysis, ''Xu et al.'' identified several stress-related C2H2-type zinc finger proteins, such as ''ZFP182'', ''ZFP252''  and ''ZFP245'', in ''japonica'' rice.&lt;br /&gt;
Using gain- and loss-of-function strategies, ''Xu et al.'' found that overexpression of ''ZFP252'' in rice increased tolerance to salt and drought stresses. The contents of free proline and soluble sugars in sense-ZFP252 transgenic rice plants were higher than those in the WT (wild-type) and antisense-''ZFP252'' transgenic rice plants under salt and drought stress. ''ZFP252'' might play a key role in stress-responsive signal transduction pathway, and be useful in engineering crop plants with enhanced tolerance to salinity and drought stresses&amp;lt;ref name=&amp;quot;ref1&amp;quot;/&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
'''GO assignment(s):''' [http://amigo.geneontology.org/amigo/term/GO:0003676 GO:0003676], [http://amigo.geneontology.org/amigo/term/GO:0005634 GO:0005634], [http://amigo.geneontology.org/amigo/term/GO:0008270 GO:0008270]&lt;br /&gt;
&lt;br /&gt;
===Mutation===&lt;br /&gt;
''ZFP252'' and Transgenic rice plants&amp;lt;ref name=&amp;quot;ref1&amp;quot;/&amp;gt;:&lt;br /&gt;
After salt treatment with 100 mM NaCl for 10 d when the top leaves of WT plants began to slightly roll, ZFP252-ox transgenic lines S3, S6, S7 and S10 accumulated more free proline and soluble sugars than WT and ZFP252-kd transgenic lines A14 and A17.After water withholding for 10 d when the top leaves of WT plants started to slightly roll, it was observed that the contents of free proline and soluble sugars in ZFP252-ox transgenic lines were also significantly higher than those in WT and ZFP252-kd lines.There was no significant difference in the contents of free proline and soluble sugars between WT, ZFP252-ox and ZFP252-kd transgenic lines before the drought stress.&lt;br /&gt;
&lt;br /&gt;
===Expression===&lt;br /&gt;
[[File: ZFP252 expression1.png|right|thumb|200px|'''Figure 1.'''Real-time PCR analysis of ZFP252.(from reference &amp;lt;ref name=&amp;quot;ref2&amp;quot;/&amp;gt;).'']]&lt;br /&gt;
[[File: ZFP252 expression2.png|right|thumb|200px|'''Figure 2.'''ZFP252 conferred drought tolerance in rice.(from reference &amp;lt;ref name=&amp;quot;ref1&amp;quot;/&amp;gt;).'']]&lt;br /&gt;
[[File: ZFP252 expression3.png|right|thumb|300px|'''Figure 3.'''Expression of stress-related genes in ZFP252 transgenic and WT rice.(from reference &amp;lt;ref name=&amp;quot;ref1&amp;quot;/&amp;gt;).'']]&lt;br /&gt;
1. Expression of ''ZFP252'' in transgenic rice plants&amp;lt;ref name=&amp;quot;ref1&amp;quot;/&amp;gt;:&lt;br /&gt;
Both semi-quantitative RTPCR and quantitative real-time PCR showed that the expression level of ''ZFP252'' in the four ZFP252-ox lines(S3, S6, S7 and S10) was significantly higher than that in WT plants. The expression of ''ZFP252'' in two ZFP252-kd lines (A14 and A17) was hardly detected.&lt;br /&gt;
&lt;br /&gt;
2. Overexpression of ''ZFP252'' in rice seedlings enhanced plant tolerance to salinity.&amp;lt;ref name=&amp;quot;ref1&amp;quot;/&amp;gt;&amp;lt;ref name=&amp;quot;ref2&amp;quot;/&amp;gt;&lt;br /&gt;
&lt;br /&gt;
3. In mZFPs, the expression level of ''ZFP252'' was enhanced under salt treatment but not under cold treatment (Figure 1). In mZFP+, the expression level of ZFP252 under normal conditions was equal to that of mZFP- as the insertion of mPing did not change the position of the TATA box or the Y Patch (Figure 1). In&lt;br /&gt;
mZFP+, the expression level of ''ZFP252'' was also increased only under salt stress, and its expression level was higher than that of mZFP-. The database search indicated that the REG of ''ZFP252'' contained the auxinand salicylic acid-responsive cis-element ASF1MOTIFCAMV&amp;lt;ref name=&amp;quot;ref2&amp;quot;/&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
4. Overexpression of ''ZFP252'' increases rice tolerance to drought stresses&amp;lt;ref name=&amp;quot;ref1&amp;quot;/&amp;gt;:&lt;br /&gt;
Almost all leaves of the WT and transgenic lines A14 and A17 rolled after 14 d of un-watered, while only a few of leaves of transgenic lines S3, S6, S7 and S10 rolled (Fig. 2A).The survival rates of lines S3, S6, S7 and S10 were 85.32%–90.32%, and significantly higher than those of WT plants(11.23%) and ZFP252-kd lines A14 (17.62%), A17 (15.32%)(Fig. 2B). It was found that the third leaves from top of WT and ZFP252-kd transgenic plants severely rolled after 10 d of&lt;br /&gt;
water withholding and their relative electrolyte leakages were higher than those from ZFP252-ox (Fig. 2C). These results suggested that damage degree to the cell membrane of WT and ZFP252-kd transgenic plants was higher than that to the ZFP252-ox transgenic under drought stress.&lt;br /&gt;
&lt;br /&gt;
5. Expression of stress-related genes in ''ZFP252'' transgenic rice plants:&lt;br /&gt;
''Xu et al.'' analyzed the expression of several known stress-related genes in ZFP252 transgenic lines and WT, including ''OsDREB1A'', ''Oslea3'', ''OsP5CS'' and ''OsProT''. There was no significant difference in the expression levels of ''Oslea3'', ''OsP5CS'' and ''OsProT'' between ''ZFP252'' transgenic lines and WT plants under non-treated conditions (Fig. 3B–D). However the ''OsDREB1A'' mRNA was much more accumulated in ZFP252-ox transgenic lines S3, S6, S7 and S10 as compared with that in ZFP252-kd lines A14, A17 or WT plants under normal conditions (Fig. 3A). Under salt or drought treatments the expression levels of all four stress-related genes in ZFP252-ox transgenic lines was increased more than that in ZFP252-kd lines and WT plants(Fig. 3A–D). It suggested that ''ZFP252'' might be one upstream regulator of these genes mediating expression of some stress-related genes upon rice treated with salt or drought stresses. It acted as a master switch in stress tolerance, and was involved in the complicated network controlling stress responsive genes.&lt;br /&gt;
''OsDREB1A'' encoding a DREB protein in rice was responsive to overexpression of ''ZFP252'' in ZFP252-ox plants, suggesting ''ZFP252'' might be an upstream regulator of ''OsDREB1A''.&lt;br /&gt;
&lt;br /&gt;
PCR was performed with ZFP252-specific primers of 5'-GGTGGAGGCGGTTCTTGAGG-3' and 5'-CGTCGTAGTGGCATCGCTTGT-3'.&lt;br /&gt;
&lt;br /&gt;
===Evolution===&lt;br /&gt;
[[File: ZFP252 4.jpg|left|thumb|300px|'''Figure 4.''' phylogenetic tree analysis of amino acid sequences of ZFP179 with the other stress-responsive&lt;br /&gt;
C2H2-type zinc finger proteins.(from reference &amp;lt;ref name=&amp;quot;ref5&amp;quot;/&amp;gt;).'']]&lt;br /&gt;
To investigate the evolutionary relationship among plant C2H2-type zinc finger proteins involved in stress responses, a phylogenetic tree was constructed using Neighbor–Joining method with the full-length amino acid sequences (Figure 4). The result revealed that ''ZFP179'' was clustered with ''ZFP182'', ''ZFP150'' and ''ZAT12'', whereas other stress responsive zinc finger proteins were categorized into another big branch&amp;lt;ref name=&amp;quot;ref5&amp;quot;/&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
===Knowledge Extension===&lt;br /&gt;
[[File: ZFP252 5.png|left|thumb|380px|'''Figure 5.''' Schematic Presentation of the Signaling Relationships among the Genes Described in the Review.(from reference &amp;lt;ref name=&amp;quot;ref6&amp;quot;/&amp;gt;).'']]&lt;br /&gt;
Schematic Presentation of the Signaling Relationships among the Genes Described in this Review&lt;br /&gt;
''Yang et al.'' focuses mainly on the recent studies of genes that are involved in molecular or biochemical processes affecting drought tolerance and that have been used successfully in the genetic engineering of staple crop species such as rice, maize, wheat (Triticum aestivum), soybean, and canolafor improvement of drought tolerance(Figure 5).&lt;br /&gt;
The movement of guard cells might be controlled through the actions of activation/inactivation by a specific pair of kinase–phosphatase&amp;lt;ref name=&amp;quot;ref6&amp;quot;/&amp;gt;.&lt;br /&gt;
The identification of commercial grade transgenes that enhance crop performance under both drought and optimal conditions is a lengthy, tedious, and expensive process. Nevertheless, the successful genetic engineering of canola and maize for improved drought tolerance as reviewed herein confirms that the approach is feasible(Figure 5)&amp;lt;ref name=&amp;quot;ref6&amp;quot;/&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
==Labs working on this gene&lt;br /&gt;
*State Key Laboratory of Crop Genetics and Germplasm Enhancement, Nanjing Agricultural University, Nanjing 210095, PR China&lt;br /&gt;
*Graduate School of Agriculture, Kyoto University, Kitashirakawa, Sakyo-ku, Kyoto 606-8502, Japan&lt;br /&gt;
*Genebank, National Institute of Agrobiological Sciences, Kannondai 2-1-2, Tsukuba, Ibaraki 305-8602, Japan&lt;br /&gt;
&lt;br /&gt;
==References==&lt;br /&gt;
&amp;lt;references&amp;gt;&lt;br /&gt;
* &amp;lt;ref name=&amp;quot;ref1&amp;quot;&amp;gt;&lt;br /&gt;
Xu D Q, Huang J, Guo S Q, et al. Overexpression of a TFIIIA-type zinc finger protein gene&amp;lt; i&amp;gt; ZFP252&amp;lt;/i&amp;gt; enhances drought and salt tolerance in rice (&amp;lt; i&amp;gt; Oryza sativa&amp;lt;/i&amp;gt; L.)[J]. FEBS letters, 2008, 582(7): 1037-1043.&lt;br /&gt;
&amp;lt;/ref&amp;gt;&lt;br /&gt;
* &amp;lt;ref name=&amp;quot;ref2&amp;quot;&amp;gt;&lt;br /&gt;
Yasuda K, Ito M, Sugita T, et al. Utilization of transposable element mPing as a novel genetic tool for modification of the stress response in rice[J]. Molecular Breeding, 2013, 32(3): 505-516.&lt;br /&gt;
&amp;lt;/ref&amp;gt;&lt;br /&gt;
* &amp;lt;ref name=&amp;quot;ref3&amp;quot;&amp;gt;&lt;br /&gt;
Huang J, Sun S J, Xu D Q, et al. Increased tolerance of rice to cold, drought and oxidative stresses mediated by the overexpression of a gene that encodes the zinc finger protein ZFP245[J]. Biochemical and biophysical research communications, 2009, 389(3): 556-561.&lt;br /&gt;
&amp;lt;/ref&amp;gt;&lt;br /&gt;
* &amp;lt;ref name=&amp;quot;ref4&amp;quot;&amp;gt;&lt;br /&gt;
Agarwal P, Arora R, Ray S, et al. Genome-wide identification of C2H2 zinc-finger gene family in rice and their phylogeny and expression analysis[J]. Plant molecular biology, 2007, 65(4): 467-485.&lt;br /&gt;
&amp;lt;/ref&amp;gt;&lt;br /&gt;
* &amp;lt;ref name=&amp;quot;ref5&amp;quot;&amp;gt;&lt;br /&gt;
Sun S J, Guo S Q, Yang X, et al. Functional analysis of a novel Cys2/His2-type zinc finger protein involved in salt tolerance in rice[J]. Journal of experimental botany, 2010: erq120.&lt;br /&gt;
&amp;lt;/ref&amp;gt;&lt;br /&gt;
* &amp;lt;ref name=&amp;quot;ref6&amp;quot;&amp;gt;&lt;br /&gt;
Yang S, Vanderbeld B, Wan J, et al. Narrowing down the targets: towards successful genetic engineering of drought-tolerant crops[J]. Molecular Plant, 2010, 3(3): 469-490.&lt;br /&gt;
&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;/references&amp;gt;&lt;br /&gt;
&lt;br /&gt;
[[Category:Genes]]&lt;br /&gt;
[[Category:Japonica mRNA]]&lt;br /&gt;
[[Category:Oryza Sativa Japonica Group]]&lt;br /&gt;
[[Category:Japonica Genes]]&lt;br /&gt;
[[Category:Japonica Chromosome 12]]&lt;br /&gt;
[[Category:Chromosome 12]]&lt;/div&gt;</summary>
		<author><name>Lmw2015</name></author>	</entry>

	<entry>
		<id>https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os12g0569700&amp;diff=248932</id>
		<title>Os12g0569700</title>
		<link rel="alternate" type="text/html" href="https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os12g0569700&amp;diff=248932"/>
				<updated>2015-06-12T04:34:35Z</updated>
		
		<summary type="html">&lt;p&gt;Lmw2015: /* Structured Information */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;''OsHsp23.7'' is a member of Heat shock proteins(Hsps), it belongs to HSP70 family&amp;lt;ref name=&amp;quot;ref1&amp;quot;/&amp;gt;&amp;lt;ref name=&amp;quot;ref2&amp;quot;/&amp;gt;.&lt;br /&gt;
==Annotated Information==&lt;br /&gt;
===Function===&lt;br /&gt;
[[File: OsHsp23.7 expression1.jpg|left|thumb|200px|'''Figure 1.'''''Drought tolerance assays of OsHsp23.7-OE transgenic rice(from reference &amp;lt;ref name=&amp;quot;ref1&amp;quot;/&amp;gt;).'']]&lt;br /&gt;
[[File: OsHsp23.7 expression2.jpg|right|thumb|200px|'''Figure 2.'''''Salt tolerance assays of OsHsp23.7-OE transgenic rice(from reference &amp;lt;ref name=&amp;quot;ref1&amp;quot;/&amp;gt;).'']]&lt;br /&gt;
Both OsHsp17.0-OE and OsHsp23.7-OE transgenic lines demonstrated higher germination ability compared to wild-type (WT) plants when subjected to mannitol and NaCl. Phenotypic analysis showed that transgenic rice lines displayed a higher tolerance to drought and salt&lt;br /&gt;
stress compared to WT plants. In addition, transgenic rice lines showed significantly lower REC, lower MDA content and higher free proline content than WT under drought and salt stresses. These results suggest that ''OsHsp17.0'' and ''OsHsp23.7'' play an important role in rice acclimation to salt and drought stresses and are useful for engineering drought and salt tolerance rice&amp;lt;ref name=&amp;quot;ref1&amp;quot;/&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
'''GO assignment(s):''' [http://amigo.geneontology.org/amigo/term/GO:0005524 GO:0005524]&lt;br /&gt;
&lt;br /&gt;
===Mutation===&lt;br /&gt;
[[File: nine OsHSP genes.jpg|left|thumb|300px|'''Figure 3.'''''Gene tree of the nine rice HSPs(from reference &amp;lt;ref name=&amp;quot;ref2&amp;quot;/&amp;gt;).'']]&lt;br /&gt;
*The expression of ''OsHsp17.0'' and ''OsHsp23.7'' in transgenic lines (T2 generation) was checked by real-time qPCR. Three highly&lt;br /&gt;
over-expressed lines were identified in the OsHsp17.0-OE and OsHsp23.7-OE lines respectively (Fig. 1A) and were used for later&lt;br /&gt;
characterization.&lt;br /&gt;
*Three-week-old seedlings were exposed to air for 9.5 h, and then were transferred to normal hydroponic conditions and recovered for 10 d.(Figure 1D) Seedlings before treatment. (Figure 1E) Seedlings were exposed to air for 9.5 h. (Figure 1F) Seedlings were transferred to normal hydroponic conditions and recovered for 10 d. &lt;br /&gt;
*Three-week-old seedlings were watered with 200 mM NaCl solution for 24 h and then were transferred to normal hydroponic conditions and recovered for 10 d. (Figure 2D) Seedlings before treatment. (Figure 2E) Seedlings were subjected to 200 mM NaCl solution for&lt;br /&gt;
24 h. (Figure 2F) Seedlings were transferred to normal hydroponic conditions and recovered for 10 d.&lt;br /&gt;
&lt;br /&gt;
===Expression===&lt;br /&gt;
*Overexpression of ''OsHsp17.0'' and ''OsHsp23.7'' enhanced drought tolerance and salt tolerance.&lt;br /&gt;
*After temperature treatment, leaf tips of both transgenic plants and WT plants were rolled or withered, no significant differences were observed between them. After recovery for 7 d, both transgenic plants and WT plants remained alive and produced new leaves.&lt;br /&gt;
*There were no significant differences in content of MDA content and proline content between WT and OE lines under normal conditions. However, after stress treatments (20%PEG6000, 200 mM NaCl, 45℃ and 5℃), the MDA content was significantly higher in WT than in OE lines. The accumulation of proline in OE plants was significantly more than that in WT plants, which suggesting that less membrane damage and improved osmotic adjustment ability in transgenic OE plants under stresses.&lt;br /&gt;
&lt;br /&gt;
{| class='wikitable' style=&amp;quot;text-align:center&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! | Primer&amp;lt;ref name=&amp;quot;ref1&amp;quot;/&amp;gt;&lt;br /&gt;
! | Forward primer&lt;br /&gt;
! | Reverse primer&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot;|PCR-amplifie&lt;br /&gt;
| | 5'-CGGGATCCCACCCAACTCTTCTTCTTCC-3'&lt;br /&gt;
| | 5'-GCTCTAGACTTGACCTTGACAAACTCCC-3'&lt;br /&gt;
|-&lt;br /&gt;
| | 5'-CGGGATCCATGAGCCTACTGCTGCT-3'&lt;br /&gt;
| | 5'-AATCTAGATCGTACACCTGGATCAACA-3'&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;3&amp;quot;|real-time quantitative PCR&lt;br /&gt;
| | 5'-AAGGTGGACCAGGTGAAGG-3'&lt;br /&gt;
| | 5'-GACCTTGACAAACTCCCGTT-3' &lt;br /&gt;
|-&lt;br /&gt;
| | 5'-AGACCACCCACCATTGAGATT-3'&lt;br /&gt;
| | 5'-GCCACCAACAAGGATGAACAT-3'&lt;br /&gt;
|-&lt;br /&gt;
| | 5'-GGAAGTAAGGAAGGAGGAGGAA-3'&lt;br /&gt;
| | 5'-CAGAGGTGATGCTAAGGTGTTC-3' &lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
===Evolution===&lt;br /&gt;
Gene tree were conducted using the software Molecular Evolutionary Genetics Analysis (MEGA) Version 4.0 by the neighbor-joining method with pairwise deletion and the Poisson correction model.As shown in Figure 1, based on amino acids sequence homology, nine OsHSP genes were divided into three classes, among them ''OsHSP80.2'', ''OsHSP74.8'' and ''OsHSP50.2'' belong to ''HSP90'' family; ''OsHSP71.1'', ''OsHSP58.7'' and ''OsHSP23.7'' belong to ''HSP70'' family; ''OsHSP26.7'', ''OsHSP24.1'' and ''OsHSP17.0'' belong to sHSP family&amp;lt;ref name=&amp;quot;ref2&amp;quot;/&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
===Knowledge Extension===&lt;br /&gt;
Heat shock proteins (Hsps) belong to a class of proteins that are conserved in prokaryotes and eukaryotes and are especially abundant in plants. Hsps are highly expressed in plants and other organisms after being stimulated by high temperature and other stresses. The sHsps are much more abundant in higher plants than in other organisms&amp;lt;ref name=&amp;quot;ref3&amp;quot;/&amp;gt;.&lt;br /&gt;
Expression of nine ''OsHSP'' genes was affected differentially by abiotic stresses and abscisic acid (ABA). All nine OsHSP genes were induced strongly by heat shock treatment, whereas none of them were induced by cold. The transcripts of ''OsHSP80.2'', ''OsHSP71.1'' and&lt;br /&gt;
''OsHSP23.7'' were increased during salt tress treatment. Expression of ''OsHSP80.2'' and ''OsHSP24.1'' genes were enhanced while treated with 10% PEG. Only ''OsHSP71.1'' was induced by ABA while OsHSP24.1 was suppressed by ABA. These observations imply&lt;br /&gt;
that the nine ''OsHSP'' genes may play different roles in plant development and abiotic stress responses&amp;lt;ref name=&amp;quot;ref2&amp;quot;/&amp;gt;.&lt;br /&gt;
According to their approximate molecular weights, HSPs are grouped into five families: HSP100s, HSP90s, HSP70s, HSP60s and sHSPs (small&lt;br /&gt;
HSPs, o40 kDa)&amp;lt;ref name=&amp;quot;ref4&amp;quot;/&amp;gt;. Most HSPs function as molecular chaperones in maintaining homeostasis of protein folding and are thought to be responsible for the acquisition of thermo tolerance&amp;lt;ref name=&amp;quot;ref3&amp;quot;/&amp;gt;. It is believed that the accumulations of HSPs play a pivotal role in abiotic stress.&lt;br /&gt;
&lt;br /&gt;
==Labs working on this gene==&lt;br /&gt;
*Hunan Provincial Key Laboratory for Germplasm Innovation and Utilization of Crop, Hunan Agricultural University, Changsha 410128, China&lt;br /&gt;
*College of Bioscience and Biotechnology, Hunan Agricultural University, Changsha 410128, China&lt;br /&gt;
*Crop Gene Engineering Key Laboratory of Hunan Province, Hunan Agricultural University, Changsha 410128, China&lt;br /&gt;
&lt;br /&gt;
==References==&lt;br /&gt;
&amp;lt;references&amp;gt;&lt;br /&gt;
* &amp;lt;ref name=&amp;quot;ref1&amp;quot;&amp;gt;&lt;br /&gt;
Zou J, Liu C, Liu A, et al. Overexpression of&amp;lt; i&amp;gt; OsHsp17. 0&amp;lt;/i&amp;gt; and&amp;lt; i&amp;gt; OsHsp23. 7&amp;lt;/i&amp;gt; enhances drought and salt tolerance in rice[J]. Journal of plant physiology, 2012, 169(6): 628-635.&lt;br /&gt;
&amp;lt;/ref&amp;gt;&lt;br /&gt;
* &amp;lt;ref name=&amp;quot;ref2&amp;quot;&amp;gt;&lt;br /&gt;
Zou J, Liu A, Chen X, et al. Expression analysis of nine rice heat shock protein genes under abiotic stresses and ABA treatment[J]. Journal of plant physiology, 2009, 166(8): 851-861.&lt;br /&gt;
&amp;lt;/ref&amp;gt;&lt;br /&gt;
* &amp;lt;ref name=&amp;quot;ref3&amp;quot;&amp;gt;&lt;br /&gt;
Vierling E. The roles of heat shock proteins in plants[J]. Annual review of plant biology, 1991, 42(1): 579-620.&lt;br /&gt;
&amp;lt;/ref&amp;gt;&lt;br /&gt;
* &amp;lt;ref name=&amp;quot;ref4&amp;quot;&amp;gt;&lt;br /&gt;
Trent J D. A review of acquired thermotolerance, heat‐shock proteins, and molecular chaperones in archaea[J]. FEMS microbiology reviews, 1996, 18(2‐3): 249-258.&lt;br /&gt;
&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;/references&amp;gt;&lt;br /&gt;
&lt;br /&gt;
[[Category:Genes]]&lt;br /&gt;
[[Category:Japonica mRNA]]&lt;br /&gt;
[[Category:Oryza Sativa Japonica Group]]&lt;br /&gt;
[[Category:Japonica Genes]]&lt;br /&gt;
[[Category:Japonica Chromosome 12]]&lt;br /&gt;
[[Category:Chromosome 12]]&lt;/div&gt;</summary>
		<author><name>Lmw2015</name></author>	</entry>

	<entry>
		<id>https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os12g0568500&amp;diff=248931</id>
		<title>Os12g0568500</title>
		<link rel="alternate" type="text/html" href="https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os12g0568500&amp;diff=248931"/>
				<updated>2015-06-12T04:34:15Z</updated>
		
		<summary type="html">&lt;p&gt;Lmw2015: Replaced content with &amp;quot;Category:Genes
Category:Japonica mRNA
Category:Oryza Sativa Japonica Group
Category:Japonica Genes
Category:Japonica Chromosome 12
[[Category:Chromosom...&amp;quot;&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;[[Category:Genes]]&lt;br /&gt;
[[Category:Japonica mRNA]]&lt;br /&gt;
[[Category:Oryza Sativa Japonica Group]]&lt;br /&gt;
[[Category:Japonica Genes]]&lt;br /&gt;
[[Category:Japonica Chromosome 12]]&lt;br /&gt;
[[Category:Chromosome 12]]&lt;/div&gt;</summary>
		<author><name>Lmw2015</name></author>	</entry>

	<entry>
		<id>https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os12g0555500&amp;diff=248930</id>
		<title>Os12g0555500</title>
		<link rel="alternate" type="text/html" href="https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os12g0555500&amp;diff=248930"/>
				<updated>2015-06-12T04:33:56Z</updated>
		
		<summary type="html">&lt;p&gt;Lmw2015: /* Structured Information */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;PBZ1, a PR10 family protein, has been shown to accumulate in tissues undergoing cell death/programmed cell death (PCD) in rice, it was first shown to be weakly induced only 3 days after treatment with a herbicide, probenazol.&lt;br /&gt;
&lt;br /&gt;
==Annotated Information==&lt;br /&gt;
===Function===&lt;br /&gt;
PBZ1 gene has an important function during the disease resistance response in rice&amp;lt;ref name=&amp;quot;ref1&amp;quot; /&amp;gt;. Numerous reports and researchers have hypothesized it as a molecular marker in rice self-defense, but the precise function of PBZ1 remains unknown&amp;lt;ref name=&amp;quot;ref2&amp;quot; /&amp;gt;&amp;lt;ref name=&amp;quot;ref3&amp;quot; /&amp;gt;&amp;lt;ref name=&amp;quot;ref4&amp;quot; /&amp;gt;. In recent years, Sun et al. have demonstrated that the expression levels and localizations of PBZ1 dramatically coincided with tissues undergoing programmed cell death(PCD), namely, during leaf senescence, root aerenchyma formation, coleoptiles senescence, root cap, and seed aleurone layer&amp;lt;ref name=&amp;quot;ref2&amp;quot; /&amp;gt;. &lt;br /&gt;
* Naoki et al. have showed that the time course of the accumulation of the PBZl mRNA after treatment with probenazole corresponds to that of the development of anti-rice blast activity, this gene is somewhat related to disease resistance, and it is not a simple nonspecific response to chemical stimulation&amp;lt;ref name=&amp;quot;ref1&amp;quot; /&amp;gt;.&lt;br /&gt;
*Based on mRNA and protein analysis, Hideo et al, indicates that a promoter of PBZ1 is activated by salicylic acid(SA). What’s more, PBZ1 can also induced by jasmonic acid (JA), ethephon, abscisic acid (ABA), and NaCl&amp;lt;ref name=&amp;quot;ref5&amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
===Expression===&lt;br /&gt;
[[File:pbz1-1.png|right|thumb|390px|'''Figure 1.''' ''Morphology of cell death. Dark brown color serves as an indica- tion of cell death(from reference&amp;lt;ref name=&amp;quot;ref4&amp;quot; /&amp;gt;).'']]&lt;br /&gt;
* Sang et al. found recombinant PBZ1 protein causes cell death in rice suspension-cultured cells(SCCs) and tobacco leaves. The result in Figure1,  shows that suspended cells treated with PBZ1 protein turned into the dark brown color (i.e. cell death), whereas cells treated with others remained light yellow, suggesting that PBZ1 protein induces cell death in rice SCCs . The pre-immune serum did not cause any cell death. In planta, leaves of tobacco, cell death morphology was clearly visible within 72 h post application(Figure2). This phenomena can also find in Arabidopsis. What’s more they even found that rice cultured cells-treated with the PBZ1 protein reveal DNA fragmentation – a sign of PCD&amp;lt;ref name=&amp;quot;ref4&amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
===Mutation===&lt;br /&gt;
[[File:pbz1-2.png|right|thumb|727px|'''Figure 2.''' ''(A) Does- dependent effect of PBZ1 protein on cell death. 1, 10 mM HEPES buffer (pH 7.0); 2, acetylated BSA (100 μg/ml); 3 through 6 are recombinant PBZ1 protein at the concentration of 10, 25, 50 and 100 μg/ml, respectively. (B) Cell death blocking experiment. 1, acetylated BSA (100 μg/mL); 2, PBZ1 antibody (10 μl); 3, PBZ1 protein (100 μg/ml); and 4, PBZ1 protein (100 μg/ml) plus PBZ1 antibody (10 μl). Numbers 1 and 2 serve as appropriate controls(from reference&amp;lt;ref name=&amp;quot;ref4&amp;quot; /&amp;gt;).'']]&lt;br /&gt;
*Mutation of a W-box like element in PBZ1 promoter abolished its SA inducibility. Because SA inducibility of the 687:LUC construct is the highest among deletion constructs, and only one WLE1 with the TGAC core is present in region III. If WLE1 in region III was mutagenized from TGAC to TGAA. The WRKY protein(it binds to the W boxes in rice, can regulate the defense signaling in rice) couldn’t bind to a TGAA sequence, therefore, this mutation prevents the association of WRKY to the WLE1 of the PBZ1 promoter, so this little mutation can abolish PBZ1’s SA inducibility&amp;lt;ref name=&amp;quot;ref5&amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
===Evolution===&lt;br /&gt;
*Originally, OsPR10a was known to be induced by probenazole and thus, was called a probenazole-inducible gene, PBZ1. Later, PBZ1 was renamed as OsPR10a because it shares a similar sequence with (has sequence similarity to) PR-10 proteins&amp;lt;ref name=&amp;quot;ref1&amp;quot; /&amp;gt;&amp;lt;ref name=&amp;quot;ref5&amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
===Gene Structure===&lt;br /&gt;
*The PBZ1 cDNA is 833 bp long and contain a major open reading frame of 474 bp that encode a putative protein of 158 amino acids with a predicted mol wt of 16,687 and a pi of 4.73. A putative polyadenylation signal (AATAAA) was found in the 3' non-coding region&amp;lt;ref name=&amp;quot;ref1&amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
==Labs working on this gene==&lt;br /&gt;
* Environmental Biotechnology National Core Research Center, Gyeongsang National University, Jinju 660-701, Korea&lt;br /&gt;
* Department of Plant Bioscience, Pusan National University, Busan 609-735, Korea&lt;br /&gt;
* United Graduate School, Tokyo Uni_ersity of Agriculture and Technology, Tokyo, Japan&lt;br /&gt;
* Food Function Laboratory, Ibaraki Uni_ersity, Ami, Ibaraki, Japan&lt;br /&gt;
* National Institute of Agricultural Biotechnology,Rural Development Administration,Suwon 440-707, South Korea&lt;br /&gt;
* Pharmaceutical Research Center, Meiji Seika Kaisha, Ltd., Morooka-cho, Kohoku-ku, Yokohama, 222 Japan&lt;br /&gt;
&lt;br /&gt;
==References==&lt;br /&gt;
&amp;lt;references&amp;gt;&lt;br /&gt;
* &amp;lt;ref name=&amp;quot;ref1&amp;quot;&amp;gt;&lt;br /&gt;
Midoh N, Iwata M. Cloning and characterization of a probenazole-inducible gene for an intracellular pathogenesis-related protein in rice[J]. Plant and cell physiology, 1996, 37(1): 9-18.&lt;br /&gt;
&amp;lt;/ref&amp;gt;&lt;br /&gt;
* &amp;lt;ref name=&amp;quot;ref2&amp;quot;&amp;gt;&lt;br /&gt;
Kim S T, Kim S G, Kang Y H, et al. Proteomics analysis of rice lesion mimic mutant (spl 1) reveals tightly localized probenazole-induced protein (PBZ1) in cells undergoing programmed cell death[J]. Journal of proteome research, 2008, 7(4): 1750-1760.&lt;br /&gt;
&amp;lt;/ref&amp;gt;&lt;br /&gt;
* &amp;lt;ref name=&amp;quot;ref3&amp;quot;&amp;gt;&lt;br /&gt;
Rakwal R, Agrawal G K, Yonekura M. Light-dependent induction of OsPR10 in rice (Oryza sativa L.) seedlings by the global stress signaling molecule jasmonic acid and protein phosphatase 2A inhibitors[J]. Plant Science, 2001, 161(3): 469-479.&lt;br /&gt;
&amp;lt;/ref&amp;gt;&lt;br /&gt;
* &amp;lt;ref name=&amp;quot;ref4&amp;quot;&amp;gt;&lt;br /&gt;
Kim S G, Kim S T, Wang Y, et al. The RNase activity of rice probenazole-induced protein1 (PBZ1) plays a key role in cell death in plants[J]. Molecules and cells, 2011, 31(1): 25-31.&lt;br /&gt;
&amp;lt;/ref&amp;gt;&lt;br /&gt;
* &amp;lt;ref name=&amp;quot;ref5&amp;quot;&amp;gt;&lt;br /&gt;
Hwang S H, Lee I A, Yie S W, et al. Identification of an OsPR10a promoter region responsive to salicylic acid[J]. Planta, 2008, 227(5): 1141-1150.&lt;br /&gt;
&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;/references&amp;gt;&lt;br /&gt;
&lt;br /&gt;
[[Category:Genes]]&lt;br /&gt;
[[Category:Japonica mRNA]]&lt;br /&gt;
[[Category:Oryza Sativa Japonica Group]]&lt;br /&gt;
[[Category:Japonica Genes]]&lt;br /&gt;
[[Category:Japonica Chromosome 12]]&lt;br /&gt;
[[Category:Chromosome 12]]&lt;/div&gt;</summary>
		<author><name>Lmw2015</name></author>	</entry>

	<entry>
		<id>https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os12g0476200&amp;diff=248929</id>
		<title>Os12g0476200</title>
		<link rel="alternate" type="text/html" href="https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os12g0476200&amp;diff=248929"/>
				<updated>2015-06-12T04:33:39Z</updated>
		
		<summary type="html">&lt;p&gt;Lmw2015: /* Structured Information */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;Please input one-sentence summary here.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
Xa25(Os01g0136400) is a new dominant gene for bacterial blight resistance in rice, which conferred resistance to Philippine race 9 (PXO339) of X. &lt;br /&gt;
&lt;br /&gt;
==Annotated Information==&lt;br /&gt;
===Function===&lt;br /&gt;
&lt;br /&gt;
[[File:Location.jpg|right|thumb|200px|''Figure 1. The location of Xoo resistance gene xa25 on rice chromosome 12.'']]&lt;br /&gt;
&lt;br /&gt;
The xa25, localized in the centromeric region of chromosome 12(see Fig. 1), mediates race-specific resistance to Xoo strain PXO339 at both seedling and adult stages by inhibiting Xoo growth&amp;lt;ref name=&amp;quot;ref1&amp;quot; /&amp;gt;. This gene conferred resistance to Philippine race 9 (PXO339) of X. oryzae pv. oryzae in both seedling and adult stages&amp;lt;ref name=&amp;quot;ref2&amp;quot; /&amp;gt;. It encodes a protein of the MtN3/saliva family, which is prevalent in eukaryotes, including mammals.&lt;br /&gt;
Transgenic plants carrying dominant Xa25 was analysed for its responses to other Xoo strains at both seedling and adult stages. In seedling stage, the wild-type Minghui 63 carrying dominant Xa3/Xa26 and recessive xa25 was resistant to PXO339 and susceptible to PXO61, PXO341 and PXO99. The transgenic plants showed significantly increased susceptibility (P &amp;lt; 0.01) to PXO339 as compared&lt;br /&gt;
with the wild-type and the susceptible control plants (Zhenshan 97) and had the same level of susceptibility to PXO61, PXO341 and PXO99 (see Fig. 2)&amp;lt;ref name=&amp;quot;ref1&amp;quot; /&amp;gt;. In the adult stage, the wild-type Minghui 63 was resistant to PXO339, moderately resistant to PXO61 and PXO341, and susceptible to PXO99 . Similar to the seedling stage, the transgenic plants only showed significantly increased susceptibility (P &amp;lt; 0.01) to PXO339 but not Xoo strains PXO61, PXO341 and PXO99 as compared with wild-type plants at adult stage (see Fig. 2). These results suggest that the recessive xa25 confers race-specific resistance to PXO339 at both seedling and adult stages.&lt;br /&gt;
&lt;br /&gt;
[[File:function 2.jpg|left|thumb|350px|''Figure 2. Responses of transgenic plants carrying Os12g29220 (Xa25) from susceptible Zhenshan 97 to Xoo'']]&lt;br /&gt;
&lt;br /&gt;
===Expression===&lt;br /&gt;
Transformation of the dominant Xa25 into a resistant rice line carrying the recessive xa25 abolished its resistance to PXO339. The encoding proteins of recessive xa25 and its dominant allele Xa25 have eight amino acid differences. The expression of dominant Xa25 but not recessive xa25 was rapidly induced by PXO339 but not other Xoo strain infections. The nature of xa25-encoding protein and its expression pattern in comparison with its susceptible allele in rice–Xoo interaction indicate that the mechanism of xa25-mediated resistance appears to be different from that conferred by most of the characterized R proteins.&lt;br /&gt;
&lt;br /&gt;
'''Ⅰ Dominant Xa25 but not recessive xa25 is specifically induced by PXO339'''&lt;br /&gt;
&lt;br /&gt;
Xoo strain PXO339 induced the expression of dominant Xa25 in Zhenshan 97 but not recessive xa25 in Minghui 63 in seedling stage (Fig. 3a)&amp;lt;ref name=&amp;quot;ref1&amp;quot; /&amp;gt;.Other Xoo strains (PXO61,PXO99 and PXO341) did not influence the expression of xa25 and Xa25 nor did PXO339 induce the recessive xa25 in resistant Zhonghua 11, Mudanjiang 8 and Nipponbare (Fig. 3b). PXO339 also induced dominant Xa25 but not recessive xa25 in adult stage (Fig. 3c).The consistency of PXO339-regulated race-specific susceptibility and PXO339-induced Xa25 expression suggests that the activation of dominant Xa25 may be associated with susceptibility.&lt;br /&gt;
The Xa25 promoter (approximately 1.11 kb upstream of the transcription initiation site) from susceptible rice variety Zhenshan 97 was different from xa25 promoters from resistant rice varieties Minghui 63, Zhonghua 11, Nipponbare and Mudanjiang 8 because of nucleotide substitutions, insertions and deletions. The xa25 promoters from Nipponbare and Mudanjiang 8 had identical sequence but different from the xa25 promoters from Minghui 63 and Zhonghua 11. In addition, the xa25 promoters from Minghui 63 and Zhonghua 11 are also different from each other. However, seven polymorphic sites, -1117 (T/C), -1075 (T/C), -663 (deletion/T), -248 (A/G), -56 (C/G), -40 (G/T) and -28 (A/deletion) according to the nucleotide position in Minghui 63, between the promoters of recessive xa25 from the four resistant rice varieties and dominant Xa25 from susceptible Zhenshan 97, were identified. This result suggests that the differential expression of dominant Xa25 and recessive xa25 in response to PXO339 infection may be associated with their promoter difference.&lt;br /&gt;
[[File:induced by pxo339.jpg|right|thumb|300px|''Figure 3. The influence of Xoo infection on xa25/Xa25 expression analysed by RT-PCR'']]&lt;br /&gt;
&lt;br /&gt;
'''Ⅱ Recessive xa25 and dominant Xa25 encode different proteins'''&lt;br /&gt;
&lt;br /&gt;
the coding regions of the recessive and dominant alleles were interrupted by five introns . The recessive xa25 alleles in Minghui 63, Zhonghua 11, Mudanjiang 8 and Nipponbare putatively encode identical protein consisting of 296 amino acids.The dominant Xa25 putatively encodes proteins consisting of 293 amino acids. In addition to the size difference, the two proteins have five-residue substitutions . These results suggest that the different functions of recessive xa25 and dominant Xa25 may also be associated with the differences in their encoding proteins.&lt;br /&gt;
&lt;br /&gt;
'''Ⅲ Developmental stage influences xa25-mediated resistance'''&lt;br /&gt;
&lt;br /&gt;
There is a report that xa25/Xa25(t) dominantly regulated resistance to Xoo strain PXO339 in a mapping population at adult stage,but the present results reveal that xa25 recessively regulate resistance to PXO339 in a similar mapping population at seedling stage&amp;lt;ref name=&amp;quot;ref3&amp;quot; /&amp;gt;. &lt;br /&gt;
&lt;br /&gt;
===Evolution===&lt;br /&gt;
&lt;br /&gt;
'''Ⅰ Recessive xa25 belongs to the MtN3/saliva family'''&lt;br /&gt;
&lt;br /&gt;
the Os12g29220 allele in resistant Minghui 63 is the recessive xa25.The xa25 confers resistance by inhibiting Xoo growth. Because the resistance of Minghui 63 to Xoo strain PXO339 was compromised by expression of dominant Xa25,the previously named R gene Xa25(t) that dominantly conferred Minghui 63 resistance to PXO339&amp;lt;ref name=&amp;quot;ref3&amp;quot; /&amp;gt; should be the same gene as the recessive xa25.&lt;br /&gt;
&lt;br /&gt;
'''Ⅱ The recessive xa25 is the same as Xa25(t)'''&lt;br /&gt;
&lt;br /&gt;
xa25 is a recessive R gene at both seedling (Figs 2 &amp;amp; 3) and adult (Fig. 2) stages. The recessive xa25 is the same gene as previously named Xa25(t)&amp;lt;ref name=&amp;quot;ref3&amp;quot; /&amp;gt;. However, xa25 was recessively regulated at seedling stage but dominantly regulated at adult stage [thus named Xa25(t) in Chen et al. 2002]. The inconsistent results of the genetic analyses may have the following explanations. &lt;br /&gt;
Firstly, the recessive xa25 may be an R gene with the characteristics of dominance reversal. Rice plants carrying xa25/Xa25(t) have the same characteristic as the rice varieties carrying R genes with the nature of dominance reversal reported previously &amp;lt;ref name=&amp;quot;ref4&amp;quot; /&amp;gt; &amp;lt;ref name=&amp;quot;ref5&amp;quot; /&amp;gt;.  &lt;br /&gt;
Secondly, development-associated minor resistance quantitative trait loci (QTLs) may influence the function of the recessive xa25.This hypothesis is supported by the characteristic of another rice R gene Xa3/Xa26 for Xoo resistance. Xa3/Xa26 has a dosage effect that is regulated by rice development; this dosage effect is associated with enhanced expression of defence-responsive genes OsWRKY13 and NH1 &amp;lt;ref name=&amp;quot;ref6&amp;quot; /&amp;gt;. OsWRKY13 and NH1 function as minor resistance QTLs in rice–pathogen interactions &amp;lt;ref name=&amp;quot;ref7&amp;quot; /&amp;gt;&amp;lt;ref name=&amp;quot;ref8&amp;quot; /&amp;gt; .&lt;br /&gt;
&lt;br /&gt;
'''Ⅲ MtN3/saliva-type proteins may have different biochemical functions'''&lt;br /&gt;
[[File:analysis.jpg|left|thumb|200px|''Figure 4. Phylogenetic analysis of xa25/Xa25 proteins with other 22 paralogs in rice MtN3/saliva family.'']]&lt;br /&gt;
&lt;br /&gt;
The recessive xa25 belongs to the MtN3/saliva gene family. The only known structure of xa25/Xa25 proteins are MtN3/saliva domain. MtN3/saliva family proteins are prevalent in eukaryotes including mammals &amp;lt;ref name=&amp;quot;ref9&amp;quot; /&amp;gt;, suggesting that they may have important roles in the physiological and developmental activities of eukaryotes. Rice susceptible protein Xa13 interacts with rice copper transporter 1 (COPT1) and COPT5 to remove copper from xylem vessels in the rice-Xoo interaction. The removal of copper from xylem may be associated with transporting copper into cells, because only the coexpression of the three plasma membrane proteins could complement the phenotype of yeast mutant that lacked the functions of copper transporters for copper uptake &amp;lt;ref name=&amp;quot;ref10&amp;quot; /&amp;gt;. The Xa13 (also named OsSWEET11) functions as a low-affinity glucose transporter in mammalian cells and oocytes &amp;lt;ref name=&amp;quot;ref11&amp;quot; /&amp;gt;. These results suggest that MtN3/saliva-type proteins may have different biochemical functions. The rice MtN3/saliva gene family consists of at least 23 paralogs &amp;lt;ref name=&amp;quot;ref11&amp;quot; /&amp;gt;.The encoding proteins of xa25/Xa25 are most closely related to OsSWEET14 (also named Os11N3) based on the phylogenetic analysis (Fig. 4). The OsSWEET14/Os11N3 functions as a low-affinity transporter to mediate glucose efflux in mammalian cells and oocytes; it is suggested that this function of OsSWEET14/Os11N3 may be used by pathogens for nutritional gain &amp;lt;ref name=&amp;quot;ref11&amp;quot; /&amp;gt;. Further study is required to elucidate whether xa25/Xa25 is also involved in sugar transporter in rice-Xoo interaction.&lt;br /&gt;
&lt;br /&gt;
==Labs working on this gene==&lt;br /&gt;
1.National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural University, Wuhan 430070, China&lt;br /&gt;
&lt;br /&gt;
2.National Key Laboratory of Plant Molecular Genetics, Institute of Plant Physiology and Ecology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai, 200032, China.&lt;br /&gt;
&lt;br /&gt;
3.National Key Laboratory of Plant Molecular Genetics, Shanghai Institute of Plant Physiology and Ecology, Chinese Academy of Sciences, Shanghai 200032, China &lt;br /&gt;
&lt;br /&gt;
4. College of Life and Environment Sciences, Shanghai Normal University, Shanghai 200234, China&lt;br /&gt;
&lt;br /&gt;
==References==&lt;br /&gt;
&amp;lt;references&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref1&amp;quot;&amp;gt;Qingsong Liu, Meng Yuan, Yan Zhou, Xxianghua Li, Jinghua Xiao, Shiping Wang.(2011) A paralog of the MtN3/saliva family recessively confers race-specific resistance to Xanthomonas oryzae in rice. Plant, Cell &amp;amp; Environment 34(11): 1958-1969.&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref2&amp;quot;&amp;gt;Huilan Chen, Shiping Wang, Qifa Zhang(2002). New Gene for Bacterial Blight Resistance in Rice Located on Chromosome 12 Identified from Minghui 63, an Elite Restorer Line. Phytopathology, 92(7): 750-754.&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref3&amp;quot;&amp;gt;Chen H.,Wang S. and Zhang Q. (2002) . New gene for bacterial blight resistance in rice located on chromosome 12 identified from Minghui 63, an elite restorer line. Phytopathology ,92: 750–754.&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref4&amp;quot;&amp;gt;Sidhu G.S. And Khush G.S. (1978) Dominant reversal of a bacterial blight resistance gene in some rice cultivars. Phytopathology 68:461–463.&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref5&amp;quot;&amp;gt;Zhao X.P., Zhang D.P. And  Xie Y.F.(1986) Study of dominance reversal of rice bacterial blight resistance genes.Hereditas 8: 5–9.&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref6&amp;quot;&amp;gt;Cao Y., Ding X., Cai M., Zhao J., Lin Y., Li X., Xu C. and Wang S.(2007) The expression pattern of a rice disease resistance gene Xa3/Xa26 is differentially regulated by the genetic backgrounds and developmental stages that influence its function. Genetics 177: 523–533.&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref7&amp;quot;&amp;gt;Hu K., Qiu D., Shen X., Li X. &amp;amp; Wang S. (2008) Isolation and manipulation of quantitative trait loci for disease resistance in rice using a candidate gene approach. Molecular Plant 1: 786–793.&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref8&amp;quot;&amp;gt;Kou Y., Li X., Xiao J. and Wang S. (2010) Identification of genes contributing to quantitative disease resistance in rice. Science China Life Sciences 53: 1263–1273.&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref9&amp;quot;&amp;gt;Guan Y.F., Huang X.Y., Zhu J., Gao J.F., Zhang H.X. and Yang Z.N.(2008) RUPTURED POLLEN GRAIN1, a member of the MtN3/saliva gene family, is crucial for exine pattern formation and cell integrity of microspores in Arabidopsis. Plant Physiology 147: 852–863.&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref10&amp;quot;&amp;gt;Yuan M., Chu Z., Li X., Xu C. &amp;amp; Wang S. (2010) The bacterial pathogen Xanthomonas oryzae overcomes rice defenses by regulating host copper redistribution. The Plant Cell 22: 3164–3176.&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref11&amp;quot;&amp;gt;Chen L.Q., Hou B.H., Lalonde S., et al. (2010) Sugar transporters for intercellular exchange and nutrition of pathogens. Nature 468, 527–532.&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;/references&amp;gt;&lt;br /&gt;
&lt;br /&gt;
[[Category:Genes]]&lt;br /&gt;
[[Category:Japonica mRNA]]&lt;br /&gt;
[[Category:Oryza Sativa Japonica Group]]&lt;br /&gt;
[[Category:Japonica Genes]]&lt;br /&gt;
[[Category:Japonica Chromosome 12]]&lt;br /&gt;
[[Category:Chromosome 12]]&lt;/div&gt;</summary>
		<author><name>Lmw2015</name></author>	</entry>

	<entry>
		<id>https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os12g0472500&amp;diff=248928</id>
		<title>Os12g0472500</title>
		<link rel="alternate" type="text/html" href="https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os12g0472500&amp;diff=248928"/>
				<updated>2015-06-12T04:33:21Z</updated>
		
		<summary type="html">&lt;p&gt;Lmw2015: /* Headline text */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;Please input one-sentence summary here.&lt;br /&gt;
&lt;br /&gt;
==Annotated Information==&lt;br /&gt;
===Function===&lt;br /&gt;
&lt;br /&gt;
* OsTDL1A, the closest rice homolog of the Arabidopsis (TAPETUM DETERMINANT1)TPD1 gene. In Arabidopsis TPD1, which encodes a small protein hypothesized to be an extracellular ligand of EXS/EMS1.&lt;br /&gt;
&lt;br /&gt;
* OsTDL1A binds to the LRR domain of rice receptor kinase (MULTIPLE SPOROCYTES1)MSP1, and is required to limit sporocyte numbers. MSP1 encodes a leucine-rich-repeat receptor kinase, which is orthologous to EXS/EMS1 in Arabidopsis. Like mac1 and msp1, exs/ems1 mutants produce extra sporocytes in the anther instead of a tapetum, causing male sterility. OsTDL1A binds MSP1 in order to limit sporocyte numbers. OsTDL1A-RNAi lines may be suitable starting points for achieving synthetic apospory in rice.&lt;br /&gt;
&lt;br /&gt;
* OsTDL1A has another name is MIL2. MIL2 is responsible for the differentiation of primary parietal cells into secondary parietal cells in rice anthers.&lt;br /&gt;
&lt;br /&gt;
* MIL2 works upstream of UDT1(is an early regulator of rice tapetum development) in controlling anther wall cell development.&lt;br /&gt;
&lt;br /&gt;
===MIL2 sequence analysis===&lt;br /&gt;
The predicted MIL2 protein has 226 amino acids, including a 34- amino-acid signal peptide at the N terminus.A BLAST search of the database indicated that MIL2 is well conserved in land plants and generally has two homologs in many angiosperm species, including maize (Zea mays), rice, soybean Glycine max) and grape (Vitis vinifera). The closest homolog of MIL2 is the maize ''MULTIPLE ARCHESPORIAL CELLS 1 (MAC1'') gene. However, no clear MIL2 homologs could be&lt;br /&gt;
detected in the Chlorophyta. The predicted MIL2 homolog proteins all have a highly conserved region (corresponding to positions 112–220 in AK713941), which we termed the MIL2 homology domain. These proteins are typically c. 160–230 amino acids in length and carry the MIL2 homology region at the C terminus. In addition, based on Signal IP predictions, most of the homologs have N-terminal signal peptides similar to MIL2.&lt;br /&gt;
&lt;br /&gt;
[[File:mil2-0.jpg]]&lt;br /&gt;
&lt;br /&gt;
=== Mutation and Phenotype===&lt;br /&gt;
Rice contains two close homologues of TPD1 (OsTDL1A and OsTDL1B), . The sites of expression of these genes relative to MSP1, examine the affinity of OsTDL1A and OsTDL1B proteins for the LRR domain of MSP1, and study the effect of RNA interference of OsTDL1A on anther and ovule. MSP1 and its close paralog MSP1-like1 (MSL1) are structurally the most similar rice proteins to EXS/EMS1.&lt;br /&gt;
&lt;br /&gt;
MIL2 has three kinds of mutations ''mil2-1, mil2-2 ''and'' mil2-3''. The ''mil2-1'' genome contains a one-nucleotide-deletion in the marked site in exon 4. In ''mil2-2'', a point mutation occurs in exon 3, causing a Q83P reversion. The ''mil2-3'' genome contains a 280-kb deletion of a region on chromosome 12 in which MIL2 gene is located.&lt;br /&gt;
&lt;br /&gt;
[[File:mil2-1.jpg]]&lt;br /&gt;
&lt;br /&gt;
Plants of the mil2 mutant line showed typical sterility phenotypes with very low seed set. The mil2 anthers were white and never dehisced compared with wild-type anthers. A closer examination revealed that these anthers were apparently devoid of pollen grains. When mil2 mutant plants were pollinated with&lt;br /&gt;
pollen from wild-type plants, only a few seeds resulted, suggesting that the mil2 mutation affected both male and female fertility.&lt;br /&gt;
&lt;br /&gt;
[[File:mil2-2.jpg]]&lt;br /&gt;
&lt;br /&gt;
In mil2-1 anthers, PPCs and sporogenous cells were generated from archesporial initials, with PPCs actually forming a sequential ring around a central core of sporogenous cells. Most of the ''mil2-1'' PPCs did not engage in further periclinal division, although evidence of a periclinal division could be observed occasionally in some PPCs . Therefore, in most of the ''mil2-1'' anthers, only one visible layer of somatic cells could be clearly observed beneath the epidermis. Enveloped by two somatic cell layers, the ''mil2-1'' sporogenous cells divided to form an increased number of microsporocytes occupying the center of the locules.  Followed, both the DAPI result and the result of the expression of marker gene OsREC8 (it is a meiotic-specific gene, which is often used as a marker for the identification of meiotic cells)、 MIL1 (controls meiotic entry of the microsporocytes) indicate the ''mil2-1'' microsporocytes entered meiosis, but did not complete meiotic division.&lt;br /&gt;
&lt;br /&gt;
===Expresson===&lt;br /&gt;
qRT-PCR shows MIL2 was expressed at a very low level, it was observed in most of the tissues analyzed, including leaf, internode, leaf sheath and panicle at early developmental stages. MIL2 expression in panicles declined gradually as the panicles elongated, and hardly any transcripts could be detected in panicles that were 10 cm in length.(R, root; I,internode; L, leaf; Sh, sheath; S, seedling; P1, 1-cm panicles; P2, 3-cm panicles; P3, 6-cm panicles; P4, 10-cm panicles; P5, panicles near maturity.)&lt;br /&gt;
&lt;br /&gt;
[[File:mil2-3.jpg]]&lt;br /&gt;
&lt;br /&gt;
RNA in situ hybridization shows MIL2 was expressed conspicuously in archesporial cells located in the four corners of young anthers. As archesporial cells developed into sporogenous cells and parietal cells, MIL2 mRNA preferentially accumulated in parietal cells, first in PPCs, and then in inner SPCs; hybridization signals in sporogenous cells were considerably weaker. After differentiation of the four somatic cell layers, MIL2 was expressed mainly in the somatic cell layers embracing the reproductive cells, including the middle and tapetal layers. A low level of expression was observed in microsporocytes in the&lt;br /&gt;
center of each anther lobe, whereas, in the outer two layers, hardly any hybridization signal above background was detectable. Expression of MIL2 in the anther lobes decreased substantially as the microsporocytes underwent meiosis.&lt;br /&gt;
&lt;br /&gt;
=== '''Evolution''' ===&lt;br /&gt;
OsTDL1A and OsTDL1B are rice homologs of TPD1 of Arabidopsis&lt;br /&gt;
&lt;br /&gt;
The full-length protein sequence of Arabidopsis TPD1 [AAR25553, 176 amino acids (aa)] was used as the query in a tblastn search of the rice genome. We detected two TPD1-like genes and named them OsTDL1A (blaste-value: 5 × 10−27) and OsTDL1B (blaste-value: 1 × 10−18). They are located on chromosomes 12 and 10, respectively, and the corresponding full-length cDNAs are AK108523 and AK121594. When their predicted protein sequences (NP_001066753, 226 aa; NP_001064316, 169 aa) were used as tblastn queries of the Arabidopsis genome, the best hits were to TPD1 and another Arabidopsis protein (ABF59206, 179 aa), which we have named AtTDL1. TPD1 is more similar to AtTDL1 (e-value: 2 × 10−35) than OsTDL1A is to OsTDL1B (e-value: 2 × 10−14), a conclusion supported by CLUSTALW analysis (Figure 1A). The four proteins cluster separately from the next most similar proteins encoded by the rice and Arabidopsis genomes (the boxed proteins are from rice). Single amplicons of the expected size for OsTDL1A and OsTDL1B (546 and 485 bp, respectively) were generated from RNA of roots and spikelets (1 mm, 3 mm and 5 DAF). Three amplicon sizes were seen for MSP1, as was also reported by Nonomura et al. (2003). The sizes of these amplicons are consistent with the sizes expected for the fully spliced transcript (507 bp), a transcript in which only the first intron has been removed by splicing (752 bp) and an unspliced transcript (1298 bp), based on the full-length cDNA sequence (AK120933). The smallest amplicon was amplified most strongly from 1- and 3-mm spikelets. The largest amplicon was not a PCR product derived from possible DNA contamination, because the RNA preparations lacked DNA contamination as judged by the failure of the GAPDH primers to produce the genomic amplicon (Figure 2, open arrow). We conclude that MSP1, OsTDL1A and OsTDL1B are all expressed in spikelets before and during meiosis.&lt;br /&gt;
&lt;br /&gt;
[[File:1A.jpg]]&lt;br /&gt;
&lt;br /&gt;
===Lab===&lt;br /&gt;
* State Key Laboratory of Plant Genomics and Center for Plant Gene Research, Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, Beijing, 100101, China;&lt;br /&gt;
&lt;br /&gt;
* Biotechnology Research Institute/National Key Facility for Gene Resources and Gene Improvement, Chinese Academy of Agricultural Sciences, Beijing, 100081, China&lt;br /&gt;
&lt;br /&gt;
* College of Agriculture and Biotechnology, Zhejiang University, Hangzhou, China&lt;br /&gt;
&lt;br /&gt;
* Plant Breeding, Genetics and Biotechnology Division, International Rice Research Institute, Manila, Philippines&lt;br /&gt;
&lt;br /&gt;
* Division of Plant Industry, Commonwealth Scientific and Industrial Research Organization, Canberra, Australia&lt;br /&gt;
&lt;br /&gt;
===References===&lt;br /&gt;
*  Xinai Zhao, Justina de Palma, Rowena Oane, ''et al.'' OsTDL1A binds to the LRR domain of rice receptor kinase MSP1, and is required to limit sporocyte numbers. The Plant Journal (2008) 54, 375–387 &lt;br /&gt;
* Lilan Hong, Ding Tang, Yi Shen, ''et al.'' MIL2 (MICROSPORELESS2) regulates early cell differentiation in the rice anther. New Phytologist (2012) 196: 402–413&lt;br /&gt;
&lt;br /&gt;
[[Category:Genes]]&lt;br /&gt;
[[Category:Japonica mRNA]]&lt;br /&gt;
[[Category:Oryza Sativa Japonica Group]]&lt;br /&gt;
[[Category:Japonica Genes]]&lt;br /&gt;
[[Category:Japonica Chromosome 12]]&lt;br /&gt;
[[Category:Chromosome 12]]&lt;/div&gt;</summary>
		<author><name>Lmw2015</name></author>	</entry>

	<entry>
		<id>https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os12g0438600&amp;diff=248927</id>
		<title>Os12g0438600</title>
		<link rel="alternate" type="text/html" href="https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os12g0438600&amp;diff=248927"/>
				<updated>2015-06-12T04:33:02Z</updated>
		
		<summary type="html">&lt;p&gt;Lmw2015: /* Structured Information */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&lt;br /&gt;
= Annotated Information =&lt;br /&gt;
&lt;br /&gt;
== Function ==&lt;br /&gt;
[[File:Representation of the AtCLCaNO32Ht antiporter in a plant cell.JPG|right|250px|thumb|Representation of the AtCLCaNO32Ht antiporter in a plant cell.]]&lt;br /&gt;
[[File:Vacuolar chloride is transported differently.JPG|right|250px|thumb|Vacuolar chloride is transported differently by native AtCLCaWT andthe mutant AtCLCaP160S.]]&lt;br /&gt;
[[File:Homology model of the AtCLCa C-terminal region.jpg|right|250px|thumb|Homology model of the AtCLCa C-terminal region. a, the alignment used for the homology modeling of AtCLCa C-terminal region on the hCLC-5 C-terminal region. b, detail of the region putatively involved in the ATP-AtCLCa interaction.]]&lt;br /&gt;
&lt;br /&gt;
AtCLC-a, a member of the CLC family of anion transporters, is involved mainly in nitrate storage in the vacuole. CLCa (AtCLCa) is localized to an intracellular membrane, the tonoplast of the plant vacuole, with anion transport ability. AtCLCa is able to accumulate specifically nitrate in the vacuole and behaves as a NO32-/H+ exchanger.&lt;br /&gt;
&lt;br /&gt;
In Monachello's study, analyses of T-DNA insertion mutants within the AtClCa and AtClCe genes revealed common phenotypic traits: a lower endogenous nitrate content; a higher nitrite content; a reduced nitrate influx into the root; and a decreased expression of several genes encoding nitrate transporters. This set of nitrate-related phenotypes, displayed by clca and clce mutant plants, showed interconnecting roles of AtClCa and AtClCe in nitrate homeostasis involving two different endocellular membranes &amp;lt;ref name=&amp;quot;ref3&amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
Electrophysiological studies show that, at physiological membrane potentials, AtCLCa-mediated current is able to transport NO3 2- into the vacuole (negative current), when cytosolic  [NO3 2-] is in a physiological range. Nevertheless, there is a clear discrepancy between the measured Erev and the Nernst potential for NO3 2. This observation demonstrates that other ions are transported by AtCLCa &amp;lt;ref name=&amp;quot;ref1&amp;quot; /&amp;gt;. The high selectivity of AtCLCa for nitrate ions compared with chloride ions seems to be a peculiarity of this plant CLC and is in agreement with the clca knockout mutant phenotype. &lt;br /&gt;
&lt;br /&gt;
By monitoring AtCLCa activity in its native environment, Stefanie Wege found that if proline 160 in AtCLCa is changed to a serine (AtCLCaP160S), the transporter loses its nitrate selectivity, but the anion proton exchange mechanism is unaffected. The results confirm the significance of this amino acid in the conserved selectivity filter of CLC proteins and highlight the importance of nitrate metabolism in Arabidopsis&amp;lt;ref name=&amp;quot;ref4&amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
ATP reversibly inhibits AtCLCa by interacting with the C-terminal domain. Applying the patch clamp technique to isolated Arabidopsis thaliana vacuoles, Alexis De Angeli demonstrate that ATP reduces AtCLCa activity with a maximum inhibition of 60%. ATP inhibition of nitrate influx into the vacuole at cytosolic physiological nitrate concentrations suggests that ATP modulation is physiologically relevant. ADP and AMP do not decrease the AtCLCa transport activity; nonetheless, AMP (but not ADP)  competes with ATP, preventing inhibition&amp;lt;ref name=&amp;quot;ref6&amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
== Expression ==&lt;br /&gt;
&lt;br /&gt;
The rice genome has been completely sequenced and comprises five CLC homologues, but only two members from Oryza sativa L., OsClC-1 and OsClC-2 have been characterized . The highest homology with the plant subgroup comprising AtClC-a to –g, OsClC-1 is expressed in most tissues, whereas OsClC-2 is expressed only in roots, nodes, internodes and leaf sheaths, but for both of them vacuolar localization has been suggested &amp;lt;ref name=&amp;quot;ref5&amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
To determine the subcellular localization of the AtCLCa protein,  green fluorescent protein (GFP) fusion proteins were transiently expressed in protoplasts from Arabidopsis cell suspensions. Confocal microscopy studies revealed a green fluorescent labelling that coincided with the tonoplast&amp;lt;ref name=&amp;quot;ref1&amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;gallery widths=250px heights=530px perrow=3 caption=&amp;quot;The expression of AtCLC-a (1)AtCLC-Promoter::GUS activity;(2)Organ and tissue-specific expression of AtCLC members; (3)Transient expression of AtCLCa–GFP fusion proteins in protoplasts.&amp;quot;&amp;gt;&lt;br /&gt;
File:Organ and tissue-specific expression of AtCLC members.jpg&lt;br /&gt;
File:Histochemical staining of AtCLC-Promoter.jpg&lt;br /&gt;
File:Transient expression of AtCLCa–GFP fusion proteins in protoplasts.JPG&lt;br /&gt;
&amp;lt;/gallery&amp;gt;&lt;br /&gt;
&lt;br /&gt;
== Evolution ==&lt;br /&gt;
[[File:08.jpg|200px|thumb|right|Phylogeny of predicted AtCLC proteins.]]&lt;br /&gt;
The AtCLC proteins were predicted to consist of 9–11 transmembrane spanning domains and two conserved CBS domains at the carboxyl end. These domains were similar in sizes and positions to those of CLC-0 and mammalian CLCs.&amp;lt;ref name=&amp;quot;ref2&amp;quot; /&amp;gt;.&lt;br /&gt;
Phylogeny of predicted AtCLC proteins shown in fiugre.&lt;br /&gt;
&lt;br /&gt;
= Labs working on this gene =&lt;br /&gt;
 &lt;br /&gt;
*Institute for Plant Biology, University of Zurich, CH-8008 Zurich, Switzerland.  Alexis De Angeli&lt;br /&gt;
*Institut des Sciences du Végétal, Centre National de la Recherche Scientifique, France.  Geneviève Ephritikhine&lt;br /&gt;
*School of Life Science and Technology, Tongji University, Shanghai, China.  Zhixue Liu&lt;br /&gt;
*National Key Laboratory of Plant Molecular Genetics, Shanghai Institute of Plant Physiology and Ecology, Chinese Academy of Sciences, Shanghai, China.  Hong-xia Zhang&lt;br /&gt;
*Universite Paris 7-Denis Diderot, UFR Biologie Sciences de la Nature, France. G. Ephritikhine&lt;br /&gt;
&lt;br /&gt;
= References =&lt;br /&gt;
&amp;lt;references&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref1&amp;quot;&amp;gt;De Angeli A, Monachello D, Ephritikhine G, Frachisse JM, Thomine S, Gambale F and Barbier-Brygoo H (2006) The nitrate/proton antiporter AtCLCa mediates nitrate accumulation in plant vacuoles. Nature 442:939-942.&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref2&amp;quot;&amp;gt;Lv Q-d, Tang R-j, Liu H, Gao X-s, Li Y-z, Zheng H-q and Zhang H-x (2009) Cloning and molecular analyses of the Arabidopsis thaliana chloride channel gene family. Plant Science 176:650-661.&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref3&amp;quot;&amp;gt;Monachello D, Allot M, Oliva S, Krapp A, Daniel-Vedele F, Barbier-Brygoo H and Ephritikhine G (2009) Two anion transporters AtClCa and AtClCe fulfil interconnecting but not redundant roles in nitrate assimilation pathways. The New phytologist 183:88-94.&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref4&amp;quot;&amp;gt;Wege S, Jossier M, Filleur S, Thomine S, Barbier-Brygoo H, Gambale F and De Angeli A (2010) The proline 160 in the selectivity filter of the Arabidopsis NO(3)(-)/H(+) exchanger AtCLCa is essential for nitrate accumulation in planta. The Plant journal : for cell and molecular biology 63:861-869.&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref5&amp;quot;&amp;gt;Zifarelli G and Pusch M (2010) CLC transport proteins in plants. FEBS letters 584:2122-2127.&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref6&amp;quot;&amp;gt;De Angeli A, Moran O, Wege S, Filleur S, Ephritikhine G, Thomine S, Barbier-Brygoo H and Gambale F (2009) ATP binding to the C terminus of the Arabidopsis thaliana nitrate/proton antiporter, AtCLCa, regulates nitrate transport into plant vacuoles. The Journal of biological chemistry 284:26526-26532.&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;/references&amp;gt;&lt;br /&gt;
&lt;br /&gt;
[[Category:Genes]]&lt;br /&gt;
[[Category:Japonica mRNA]]&lt;br /&gt;
[[Category:Oryza Sativa Japonica Group]]&lt;br /&gt;
[[Category:Japonica Genes]]&lt;br /&gt;
[[Category:Japonica Chromosome 12]]&lt;br /&gt;
[[Category:Chromosome 12]]&lt;/div&gt;</summary>
		<author><name>Lmw2015</name></author>	</entry>

	<entry>
		<id>https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os12g0282000&amp;diff=248926</id>
		<title>Os12g0282000</title>
		<link rel="alternate" type="text/html" href="https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os12g0282000&amp;diff=248926"/>
				<updated>2015-06-12T04:32:41Z</updated>
		
		<summary type="html">&lt;p&gt;Lmw2015: Replaced content with &amp;quot;
Category:Genes
Category:Japonica mRNA
Category:Oryza Sativa Japonica Group
Category:Japonica Genes
Category:Japonica Chromosome 12
[[Category:Chromoso...&amp;quot;&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&lt;br /&gt;
[[Category:Genes]]&lt;br /&gt;
[[Category:Japonica mRNA]]&lt;br /&gt;
[[Category:Oryza Sativa Japonica Group]]&lt;br /&gt;
[[Category:Japonica Genes]]&lt;br /&gt;
[[Category:Japonica Chromosome 12]]&lt;br /&gt;
[[Category:Chromosome 12]]&lt;/div&gt;</summary>
		<author><name>Lmw2015</name></author>	</entry>

	<entry>
		<id>https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os12g0281300&amp;diff=248925</id>
		<title>Os12g0281300</title>
		<link rel="alternate" type="text/html" href="https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os12g0281300&amp;diff=248925"/>
				<updated>2015-06-12T04:31:53Z</updated>
		
		<summary type="html">&lt;p&gt;Lmw2015: /* Structured Information */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;Please input one-sentence summary here.&lt;br /&gt;
&lt;br /&gt;
==Annotated Information==&lt;br /&gt;
===Function===&lt;br /&gt;
&lt;br /&gt;
The rice blast resistance gene, Pi-ta, originally introgressed into japonica from indica rice is important in breeding for rice blast resistance worldwide. In the southern USA, the rice cultivar Katy contains Pi-ta and is resistant to the predominant blast M. grisea races IB-49 and IC-17 and has been used as the blast resistant breeding parent. Three pairs of DNA primers specific to the dominant indica Pi-ta gene were designed to amplify the Pi-ta DNA fragments by polymerase chain reaction (PCR). &lt;br /&gt;
&lt;br /&gt;
[[File:Figure 4. Blast symptoms of rice.png]]&lt;br /&gt;
&lt;br /&gt;
Rice expressing the Pi-ta gene is resistant to strains of the rice blast fungus, Magnaporthe grisea, expressing AVR-Pita in a gene-for-gene relationship. Pi-ta encodes a putative cytoplasmic receptor with a centrally localized nucleotide-binding site and leucine-rich domain (LRD) at the C-terminus. AVR-Pita is predicted to encode a metalloprotease with an N-terminal secretory signal and pro-protein sequences. AVR-Pita176 lacks the secretory and pro-protein sequences.&lt;br /&gt;
&lt;br /&gt;
[[File:Figure 3. Structure diagram of rice accessions carrying Pi-ta.png]]&lt;br /&gt;
&lt;br /&gt;
In addition, the resistant Pi-ta allele (Pi-ta) found in the majority of US weedy rice belongs to the weedy group strawhull awnless (SH), suggesting a single source of origin for Pi-ta. Weeds with Pi-ta were resistant to two M. oryzae races, IC17 and IB49, except for three accessions, suggesting that component(s) required for the Pi-ta mediated resistance may be missing in these accessions.&lt;br /&gt;
The DNA sequences of the resistant Pi-ta allele of most rice cultivars distributed in different areas are identical; the rice cultivar 435 (GenBank no. AB364491) has some polymorphisms that differ from those of others. O. rufipogon and O. sativa have very similar patterns of resistant Pi-ta alleles, and no fixed polymorphism exists between H1 and Pi-ta alleles of cultivated rice . This characteristic further supports the above scenario. Cultivated rice might have directly acquired the resistant Pi-ta allele from its wild ancestor accompanying domestication or through gene flow between each other. Some differences in resistant Pi-ta alleles might have arisen from different standing genetic variations of O. sativa and O. rufipogon, or mutations may have recently accumulated.&lt;br /&gt;
&lt;br /&gt;
===Expression===&lt;br /&gt;
AVR-Pita176 protein is shown to bind specifically to the LRD of the Pi-ta protein, both in the yeast two-hybrid system and in an in vitro binding assay. Single amino acid substitutions in the Pi-ta LRD or in the AVR-Pita176 protease motif that result in loss of resistance in the plant also disrupt the physical interaction, both in yeast and in vitro. Rice seedlings were used in the blast inoculation because younger plants are quite susceptible. Resistance of rice plants to blast varies with the growth stage, and they become resistant after the bolting stage . Resistance to M. grisea also increases as the leaf age of rice plants increases on the same tillers. In most inoculation results, lesions formed only on the expanding leaf. Therefore, lesions on expanding leaves of each tiller were used to evaluate the resistance to blast . Twelve accessions showed the typical resistant phenotype. The accessions belonging to haplogroup H1 all exhibited resistance. Haplogroup H1 is distributed sporadically around the rim of the Indian Ocean . All but four accessions (OR3, OR5, OR8, and OR36) of haplogroup H2 were susceptible to M. grisea IK81-25. The 2pot21-02 collected from Lawrence County, AR, where Cypress once was grown, possesses the same pi-ta genomic region of the US cultivar Cypress. The susceptible pi-ta region in the weedy accessions of presumed crop-weed progenies was genetically identical to that in US cultivars, while other weedy accessions were genetically more similar to indica.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
[[File:Figure 2. Phylogenetic tree showing groups of US weedy rice among rice.png]]&lt;br /&gt;
&lt;br /&gt;
The Pi-ta containing rice lines, as determined by PCR analysis, were resistant to both IB-49 and IC-17 in standard pathogenicity assays.&lt;br /&gt;
&lt;br /&gt;
===Evolution===&lt;br /&gt;
You can also add sub-section(s) at will.&lt;br /&gt;
Rice expressing the Pi-ta gene is resistant to strains of the rice blast fungus, Magnaporthe grisea, expressing AVR-Pita in a gene-for-gene relationship. Pi-ta encodes a putative cytoplasmic receptor with a centrally localized nucleotide-binding site and leucine-rich domain (LRD) at the C-terminus. AVR-Pita is predicted to encode a metalloprotease with an N-terminal secretory signal and pro-protein sequences. AVR-Pita176 lacks the secretory and pro-protein sequences.&lt;br /&gt;
&lt;br /&gt;
[[File:Figure 5. Extended haplotype homozygosity (EHH) at and around Pi-ta.png]]&lt;br /&gt;
&lt;br /&gt;
The pattern of genomic diversity and population differentiation at/around the Pi-ta gene in all US weedy rice revealed that the Pi-ta locus in weedy rice was genetically more similar to that in Asian cultivated rice (indica) rather than US cultivars and O. rufipogon, respectively. US weedy accessions can be divided into two major subgroups, SH and BHA. Our sequence and marker data demonstrated that SH is similar to indica and BHA is similar with aus. These findings suggest that Pi-ta in weedy rice could be derived from Asian rice distinct from those used to introgress Pi-ta into US germplasm. In plants, some resistance genes show gene presence/absence polymorphisms (P/A). These P/A polymorphisms can be selectively maintained for long evolutionary periods with flanking regions bearing the molecular signatures of balancing selection.&lt;br /&gt;
Epidemic diseases could not have existed before the origins of agriculture, because they can sustain themselves only in large dense populations that did not exist before agriculture; hence, they are often called “crowded diseases” . For example, the origin of the fungal wheat pathogen Mycosphaerella graminicola coincided with the known domestication of wheat in the Fertile Crescent ∼8000–9000 BC . The virulent factor AVR-pita was present in both the Oryza and Setaria clades suggested that rice blast arose from a single origin of rice infection, following a host shift from Italian millet (Setaria italica). Both Italian millet and rice were domesticated and appeared to have co-occurred early in the history of agriculture in Asia. Bayesian-derived estimates suggested an early origin of the rice-infecting pathogen ∼9000 years ago, which may have been associated with rice domestication . Since wild Oryza and Setaria grasses grow in different habitats—wetlands and relatively dry land, respectively—we suggest a scenario of the new resistant allele arising during domestication. The widespread and dense distributions of Italian millet and rice presented frequent opportunities for contact, and a host shift occurred from the Setaria blast pathogen to rice. The relatively lower genetic variation of cultivated rice after artificial selection and dense planting on rice farmland allowed the rice blast to become an epidemic disease. Meanwhile, rice and its wild relatives are distributed sympatrically, and so the newly arising rice blast pathogen was also transferred to wild rice nearby. Wild rice faced a new virulent factor, the AVR-Pita of blast, that it had not encountered before. H1 was the mutation that allowed wild rice to fight the pathogen in the recent past.&lt;br /&gt;
&lt;br /&gt;
==Labs working on this gene==&lt;br /&gt;
1.Dale Bumpers National Rice Research Center, Agricultural Research Service, United States Department of Agriculture, Stuttgart, Arkansas, United States of America.&lt;br /&gt;
2.Institute of Plant Biology, National Taiwan University, Taipei 106, Taiwan.&lt;br /&gt;
3.Department of Botany, National Museum of Natural Science, Taichung 404, Taiwan.&lt;br /&gt;
4.Department of Life Science, National Taiwan Normal University, Taipei 116, Taiwan,&lt;br /&gt;
5.Department of Life Science, Pingtung University of Science and Technology, Pingtung 912, Taiwan.&lt;br /&gt;
6.Faculty of Agriculture, Hokkaido University, 060, Sapporo, Japan.&lt;br /&gt;
&lt;br /&gt;
==References==&lt;br /&gt;
1. Seonghee Lee;Yulin Jia;Melissa Jia;David R. Gealy;Kenneth M. Olsen;Ana L. Caicedo&lt;br /&gt;
  Molecular Evolution of the Rice Blast Resistance Gene Pi-ta in Invasive Weedy Rice in the USA&lt;br /&gt;
  PLoS ONE, 2011, 6(10): e26260&lt;br /&gt;
2. X. Wang;R. Fjellstrom;Y. Jia;W. G. Yan;M. H. Jia;B. E. Scheffler;D. Wu;Q. Shu;A. McClung&lt;br /&gt;
  Characterization of Pi-ta blast resistance gene in an international rice core collection&lt;br /&gt;
  Plant Breeding, 2010, 129(5): 491-501&lt;br /&gt;
3. Yulin Jia;Rodger Martin&lt;br /&gt;
  Identification of a New Locus, Ptr(t), Required for Rice Blast Resistance Gene Pi-ta–Mediated Resistance&lt;br /&gt;
  Molecular Plant-Microbe Interactions, 2008, 21(4): 396-403&lt;br /&gt;
4. Chun-Lin Huang;Shih-Ying Hwang;Yu-Chung Chiang;Tsan-Piao Lin&lt;br /&gt;
  Molecular Evolution of the Pi-ta Gene Resistant to Rice Blast in Wild Rice (Oryza rufipogon)&lt;br /&gt;
  Genetics, 2008, 179(3): 1527-1538&lt;br /&gt;
5. 王忠华;贾育林;吴殿星;夏英武&lt;br /&gt;
  水稻抗稻瘟病基因Pi-ta的分子标记辅助选择&lt;br /&gt;
  作物学报, 2004, 30(12): 1259-1265&lt;br /&gt;
6. Yulin Jia;Zhonghua Wang;Pratibha Singh&lt;br /&gt;
  Development of dominant rice blast Pi-ta resistance gene markers&lt;br /&gt;
  Crop Science, 2002, 42(6): 2145-2149&lt;br /&gt;
7. Yulin Jia;Sean A. McAdams;Gregory T. Bryan;Howard P. Hershey;Barbara Valent&lt;br /&gt;
  Direct interaction of resistance gene and avirulence gene products confers rice blast resistance&lt;br /&gt;
  The EMBO Journal, 2000, 19(15): 4004-4014&lt;br /&gt;
8. Gregory T. Bryan;Kun-Sheng Wu;Leonard Farrall;Yulin Jia;Howard P. Hershey;Sean A. McAdams;Kristina N. Faulk;Gail K. Donaldson;Renato Tarchini;Barbara Valent&lt;br /&gt;
  A Single Amino Acid Difference Distinguishes Resistant and Susceptible Alleles of the Rice Blast Resistance Gene Pi-ta&lt;br /&gt;
  The Plant Cell, 2000, 12(11): 2033-2046&lt;br /&gt;
9. Hittalmani-S;Parco-A;Mew-T-V;Zeigler-R-S;Huang-N&lt;br /&gt;
  Fine mapping and DNA marker-assisted pyramiding of the three major genes for blast resistance in rice&lt;br /&gt;
  Theoretical and Applied Genetics, 2000, 100(7): 1121-1128&lt;br /&gt;
10. Inukai T;Zeigler R S;Sarkarung S;Bronson M;Dung L V;Kinoshita T;Nelson R J&lt;br /&gt;
  Development of pre-isogenic lines for rice blast-resistance by marker-aided selection from a recombinant inbred population&lt;br /&gt;
  Theoretical and Applied Genetics, 1996, 93(4): 560-567&lt;br /&gt;
&lt;br /&gt;
[[Category:Genes]]&lt;br /&gt;
[[Category:Japonica mRNA]]&lt;br /&gt;
[[Category:Oryza Sativa Japonica Group]]&lt;br /&gt;
[[Category:Japonica Genes]]&lt;br /&gt;
[[Category:Japonica Chromosome 12]]&lt;br /&gt;
[[Category:Chromosome 12]]&lt;/div&gt;</summary>
		<author><name>Lmw2015</name></author>	</entry>

	<entry>
		<id>https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os12g0189500&amp;diff=248924</id>
		<title>Os12g0189500</title>
		<link rel="alternate" type="text/html" href="https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os12g0189500&amp;diff=248924"/>
				<updated>2015-06-12T04:31:33Z</updated>
		
		<summary type="html">&lt;p&gt;Lmw2015: /* References */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;Please input one-sentence summary here.&lt;br /&gt;
&lt;br /&gt;
==Annotated Information==&lt;br /&gt;
===Function===&lt;br /&gt;
The increase in IAA content was strongly correlated with the expression of putative&lt;br /&gt;
IAA biosynthesis genes, OsYUC9, OsYUC11 and OsTAR1, measured by&lt;br /&gt;
quantitative reverse transcriptase polymerase chain reaction&amp;lt;ref name=&amp;quot;pmid:16660061&amp;quot; /&amp;gt;. These results&lt;br /&gt;
conﬁrm the importance of the tryptophan aminotransferase/YUCCA pathway&lt;br /&gt;
in this system. All three genes were expressed in endosperm; expression&lt;br /&gt;
of OsYUC11 appeared to be conﬁned to endosperm tissue&amp;lt;ref name=&amp;quot;pmid:17889819&amp;quot; /&amp;gt;. Phylogenetic&lt;br /&gt;
analysis indicated that OsYUC11 and AtYUC10 belong to a separate clade of&lt;br /&gt;
YUCCAs, which do not have orthologues outside the Angiosperms&amp;lt;ref name=&amp;quot;pmid:18410479&amp;quot; /&amp;gt;. This clade&lt;br /&gt;
may have evolved with a speciﬁc role in endosperm. Expression of tryptophan&lt;br /&gt;
decarboxylase in developing rice grains did not correlate with IAA levels,&lt;br /&gt;
indicating that tryptamine is unlikely to be important for IAA synthesis in this&lt;br /&gt;
system&amp;lt;ref name=&amp;quot;pmid:16665995&amp;quot; /&amp;gt;. In light of these observations, we hypothesize that IAA production&lt;br /&gt;
in developing rice grains is controlled via expression of OsTAR1, OsYUC9,&lt;br /&gt;
OsYUC11 and that IAA may be important during starch deposition in addition&lt;br /&gt;
to its previously suggested role early in grain development.&lt;br /&gt;
&lt;br /&gt;
===Expression===&lt;br /&gt;
Quantitative RT–PCR results for OsYUC3, OsYUC 9, OsYUC 11, OsYUC 12, OsYUC 14, OsTAR1, OsTAR2 and OsTDC1. Total RNA was extracted using a Qiagen RNeasy Kit. Reaction tubes were prepared using a CAS-1200 Robotic liquid-handling system, Qiagen. Each tube contained 250 ng&lt;br /&gt;
RNA per 25 μL reaction and a ﬁnal primer concentration of 0.5 μM. Ampliﬁcation was carried out using a Qiagen QuantiTect SYBR Green RT–PCR kit in a Corbett Research Rotor-Gene 3000 thermocycler ﬁtted with a 72-tube rotor for 45 cycles. Expression was calculated relative to reference genes UBC using ROTORGENE software (Qiagen) &amp;lt;ref name=&amp;quot;pmid: 16690022 &amp;quot; /&amp;gt;. Melt curve analysis conﬁrmed that a single product was obtained for each gene ampliﬁed. Results shown are the means ± the standard error of three biological replicates and two technical replicates. Comparison of the expression of YUCCA, TAA/TAR and TDC orthologues during grain/seed development &amp;lt;ref name=&amp;quot;pmid: 17293439 &amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
===Evolution===&lt;br /&gt;
*Phylogenetic tree of Trp decarboxylases and sequence homologues: sequences were obtained by BLASTp search of proteomes of Rice (Os), Arabidopsis (At), Sorghum (Sb) and Poplar (POPTR) &amp;lt;ref name=&amp;quot;pmid: 22025721&amp;quot; /&amp;gt;. In addition, sequences of experimentally characterized TDCs from Catharanthus roseus (CatroTDC), Camptotheca acuminata (CaTDC1, CaTDC2), Ophiorrhiza pumila (OpTDC), TyDCs from Papaver somniferum (PapsoTYDC1, PapsoTYDC2) and Petroselinum crispum (PetcrTYD) and phenylacetaldehyde synthases from Petunia hybrida (PetuniaPAAS) and Rosa hybrid cultivar (RosaPAAS) were included. The tree was rooted with the putative TDC/TyDC from Chlamydomonas reinhardtii (Cre01.g028423). Multiple sequence alignments were carried out using MUSCLE (Edgar 2004); trees were constructed using PROTDIST and FITSCH； bootstrapping was conducted using SEQBOOT .&lt;br /&gt;
*Phylogenetic tree of FMOs from rice (Os), Arabidopsis (At), Selaginella (Smoe), Physcomitrella (Ppls) and Chlamydomonas (Cr/Cre). Human FMOs, translated Pinus cDNAs and four sequences from bacteria, representing the most closely related proteins to YUCCA from outside the plant kingdom were also included. Multiple sequence alignments were carried out using MUSCLE (Edgar 2004); trees were constructed using PROTDIST and FITSCH bootstrap values for major branches are indicated. Scale bar indicates 0.1 amino acid substitutions persite&amp;lt;ref name=&amp;quot;pmid: 19117763&amp;quot; /&amp;gt;. Examination of the expression of YUCCA in developing seeds using both RT–PCR and microarray data indicated that OsYUC11 and AtYUC10 appeared to be speciﬁc to, and highly expressed in, endosperm tissue. These two proteins are orthologues of each other and also of ZmYUC, which appears to be important for IAA synthesis in developing maize kernels.&lt;br /&gt;
&lt;br /&gt;
==Labs working on this gene==&lt;br /&gt;
*Department of applied biological science, Al-Ghad International AppliedMedical Science University, Jeddah, Saudi Arabia&lt;br /&gt;
&lt;br /&gt;
[[Category:Genes]]&lt;br /&gt;
[[Category:Japonica mRNA]]&lt;br /&gt;
[[Category:Oryza Sativa Japonica Group]]&lt;br /&gt;
[[Category:Japonica Genes]]&lt;br /&gt;
[[Category:Japonica Chromosome 12]]&lt;br /&gt;
[[Category:Chromosome 12]]&lt;/div&gt;</summary>
		<author><name>Lmw2015</name></author>	</entry>

	<entry>
		<id>https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os12g0123700&amp;diff=248923</id>
		<title>Os12g0123700</title>
		<link rel="alternate" type="text/html" href="https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os12g0123700&amp;diff=248923"/>
				<updated>2015-06-12T04:31:01Z</updated>
		
		<summary type="html">&lt;p&gt;Lmw2015: /* Structured Information */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;Please input one-sentence summary here.&lt;br /&gt;
&lt;br /&gt;
==Annotated Information==&lt;br /&gt;
===Function===&lt;br /&gt;
Please input function information here.&lt;br /&gt;
&lt;br /&gt;
Os12g0123700 includes NAC Family Genes in Oryza sativa,  NAC Family Genes has some functions such as Morphogenesis, the response to stress stimuli.&lt;br /&gt;
&lt;br /&gt;
Analysis of NAC Family Genes.[[File:https://www.google.com.hk/url?sa=i&amp;amp;rct=j&amp;amp;q=&amp;amp;esrc=s&amp;amp;source=images&amp;amp;cd=&amp;amp;cad=rja&amp;amp;uact=8&amp;amp;docid=8w_3eG7oUYI6HM&amp;amp;tbnid=5CtRXASPkggi8M:&amp;amp;ved=0CAUQjRw&amp;amp;url=%68%74%74%70%3a%2f%2f%61%62%63%2e%63%62%69%2e%70%6b%75%2e%65%64%75%2e%63%6e%2f%73%65%6d%69%6e%61%72%2f%63%61%61%73%31%32%66%32%2d%30%37%2e%70%64%66&amp;amp;ei=4-WGU6mLLYbj8AWGhIG4Dg&amp;amp;psig=AFQjCNEzzXS5x8fHD_NoUgjl21YTng1Jew&amp;amp;ust=1401435980393481]]    NAM are involved in shoot apical meristem  formation and development.&lt;br /&gt;
Functions of rice NAC transcriptional factors, ONAC122 and ONAC131, in defense responses against Magnaporthe grisea.&lt;br /&gt;
&lt;br /&gt;
NAC (NAM/ATAF/CUC) transcription factors have important functions in regulating plant growth, development, and abiotic and biotic stress responses.ONAC131 have important roles in rice disease resistance responses through the regulated expression of other defense- and signaling-related genes. &lt;br /&gt;
===Expression===&lt;br /&gt;
Please input expression information here.&lt;br /&gt;
&lt;br /&gt;
The proteins of this gene localize to the nucleus when express ectopically and have transcriptional activation activities&lt;br /&gt;
&lt;br /&gt;
===Evolution===&lt;br /&gt;
Please input evolution information here.&lt;br /&gt;
&lt;br /&gt;
You can also add sub-section(s) at will.&lt;br /&gt;
&lt;br /&gt;
==Labs working on this gene==&lt;br /&gt;
Please input related labs here.&lt;br /&gt;
&lt;br /&gt;
National Key Laboratory for Rice Biology, Institute of&lt;br /&gt;
Biotechnology, Zhejiang University, Hangzhou 310058,&lt;br /&gt;
Zhejiang, China&lt;br /&gt;
&lt;br /&gt;
==References==&lt;br /&gt;
Please input cited references here.&lt;br /&gt;
1. Lijun Sun;Huijuan Zhang;Dayong Li;Lei Huang;Yongbo Hong;Xin Shun Ding;Richard S. Nelson;Xueping Zhou;Fengming Song&lt;br /&gt;
  Functions of rice NAC transcriptional factors, ONAC122 and ONAC131, in defense responses against Magnaporthe grisea&lt;br /&gt;
  Plant Molecular Biology, 2013, 81(1-2): 41-56&lt;br /&gt;
2.Ooka H, Satoh K, Doi K, Nagata T, Otomo Y, Murakami K,Matsubara K, Osato N, Kawai J, Carninci P, Hayashizaki Y,&lt;br /&gt;
  Suzuki K, Kojima K, Takahara Y, Yamamoto K, Kikuchi S (2003) Comprehensive analysis of NAC family genes in Oryza&lt;br /&gt;
  sativa and Arabidopsis thaliana. DNA Res 10:239–247&lt;br /&gt;
&lt;br /&gt;
3.Ahn IP, Kim S, Kang S, Suh SC, Lee YH (2005) Rice defense mechanisms against Cochliobolus miyabeanus and Magnaporthe&lt;br /&gt;
  grisea are distinct. Phytopathology 95:1248–1255&lt;br /&gt;
&lt;br /&gt;
[[Category:Genes]]&lt;br /&gt;
[[Category:Japonica mRNA]]&lt;br /&gt;
[[Category:Oryza Sativa Japonica Group]]&lt;br /&gt;
[[Category:Japonica Genes]]&lt;br /&gt;
[[Category:Japonica Chromosome 12]]&lt;br /&gt;
[[Category:Chromosome 12]]&lt;/div&gt;</summary>
		<author><name>Lmw2015</name></author>	</entry>

	<entry>
		<id>https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os12g0111500&amp;diff=248922</id>
		<title>Os12g0111500</title>
		<link rel="alternate" type="text/html" href="https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os12g0111500&amp;diff=248922"/>
				<updated>2015-06-12T04:30:44Z</updated>
		
		<summary type="html">&lt;p&gt;Lmw2015: /* Structured Information */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;Please input one-sentence summary here.&lt;br /&gt;
&lt;br /&gt;
==Annotated Information==&lt;br /&gt;
===Function===&lt;br /&gt;
Please input function information here.&lt;br /&gt;
&lt;br /&gt;
===Expression===&lt;br /&gt;
Please input expression information here.&lt;br /&gt;
&lt;br /&gt;
==Labs working on this gene==&lt;br /&gt;
Please input related labs here.&lt;br /&gt;
&lt;br /&gt;
==References==&lt;br /&gt;
Please input cited references here.&lt;br /&gt;
&lt;br /&gt;
[[Category:Genes]]&lt;br /&gt;
[[Category:Japonica mRNA]]&lt;br /&gt;
[[Category:Oryza Sativa Japonica Group]]&lt;br /&gt;
[[Category:Japonica Genes]]&lt;br /&gt;
[[Category:Japonica Chromosome 12]]&lt;br /&gt;
[[Category:Chromosome 12]]&lt;/div&gt;</summary>
		<author><name>Lmw2015</name></author>	</entry>

	<entry>
		<id>https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os12g0105300&amp;diff=248921</id>
		<title>Os12g0105300</title>
		<link rel="alternate" type="text/html" href="https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os12g0105300&amp;diff=248921"/>
				<updated>2015-06-12T04:30:25Z</updated>
		
		<summary type="html">&lt;p&gt;Lmw2015: /* Structured Information */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;Actin-binding FH2 domain containing protein. (Os12t0105300-01); Actin-binding FH2 domain containing protein. (Os12t0105300-02)&lt;br /&gt;
&lt;br /&gt;
== Annotated Information ==&lt;br /&gt;
=== Function ===&lt;br /&gt;
Actin-binding FH2 domain containing protein. (Os12t0105300-01); Actin-binding FH2 domain containing protein. (Os12t0105300-02)&lt;br /&gt;
&lt;br /&gt;
=== Evolution ===&lt;br /&gt;
This gene is conserved in ''Arabidopsis'' (47% identity) and pea (50% identity). GA20ox-2 shows 47.8% identity to&lt;br /&gt;
GA20ox-1 in rice. There are at least three GA20-ox genes in Arabidopsis &amp;lt;ref name=&amp;quot;ref1&amp;quot; /&amp;gt;&amp;lt;ref name=&amp;quot;ref2&amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
=== Knowledge Extension ===&lt;br /&gt;
&lt;br /&gt;
== References ==&lt;br /&gt;
&amp;lt;references&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref1&amp;quot;&amp;gt;The Rice Annotation Project Database (RAP-DB): 2008 update.&lt;br /&gt;
Rice Annotation Project, et al. Nucleic Acids Res, 2008 Jan. PMID 18089549,&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref2&amp;quot;&amp;gt;Curated genome annotation of Oryza sativa ssp. japonica and comparative genome analysis with Arabidopsis thaliana.&lt;br /&gt;
Rice Annotation Project, et al. Genome Res, 2007 Feb. PMID 17210932,&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;/references&amp;gt;&lt;br /&gt;
&lt;br /&gt;
[[Category:Genes]]&lt;br /&gt;
[[Category:Japonica mRNA]]&lt;br /&gt;
[[Category:Oryza Sativa Japonica Group]]&lt;br /&gt;
[[Category:Japonica Genes]]&lt;br /&gt;
[[Category:Japonica Chromosome 12]]&lt;br /&gt;
[[Category:Chromosome 12]]&lt;/div&gt;</summary>
		<author><name>Lmw2015</name></author>	</entry>

	<entry>
		<id>https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os12g0102400&amp;diff=248920</id>
		<title>Os12g0102400</title>
		<link rel="alternate" type="text/html" href="https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os12g0102400&amp;diff=248920"/>
				<updated>2015-06-12T04:30:07Z</updated>
		
		<summary type="html">&lt;p&gt;Lmw2015: /* Structured Information */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;Please input one-sentence summary here.&lt;br /&gt;
&lt;br /&gt;
==Annotated Information==&lt;br /&gt;
===Function===&lt;br /&gt;
It is a gene encoding RING-C2 type protein in rice, called OsRINGC2-2 located on chromosome 12 function as E3 ligases.&lt;br /&gt;
&lt;br /&gt;
The sequences of both genes displayed highly significant identities of 99% (3271/3295) at the nucleotide level (data not shown). In particular, no differences between the two genes were found in both the 5′-and 3′-terminal sequences, indicating that gene-specific primer pairs cannot be designed to clone the full-length&lt;br /&gt;
genes. We further examined the differences between the sequences, which are recognized by any restriction enzyme, and found that one single nucleotide polymorphism displayed a difference in recognition of the HindIII endonuclease (Fig. 1A).&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
[[File: liu-Os12g0102400-Fig1.jpg|right|thumb|200px|''Gene identification via enzyme digestion. A: Schematic diagram of the pBIN35S-RINGC2 constructs. Restriction enzyme sites are indicated. B: Restriction profiles of each genes.. (from reference &amp;lt;ref name=&amp;quot;Jung&amp;quot; /&amp;gt;).'']]&lt;br /&gt;
&lt;br /&gt;
===Expression===&lt;br /&gt;
It is a gene encoding RING-C2 type protein in rice. Two RING-C2 types are the modified types of canonical types RING-H2 and RING-HC.&lt;br /&gt;
Some modified types of RINGs including RING-v, RING-D, RINGS/T, RING-G, and RING-C2 exist in various plant genomes. Interestingly, only two RING-C2 types exist in the rice genome, whereas 10 occur in Arabidopsis and 10 in apple, respectively. Functions of the modified RING domains remain largely unidentified.&lt;br /&gt;
&lt;br /&gt;
Subcellular localizations were strikingly different; OsRINGC2-1 was found only in the cytoplasm with many punctate complexes, whereas OsRINGC2-2 was observed in both the nucleus and cytoplasm. The expression patterns of both genes showed striking differences in response to salt stress, whereas plants heterogeneous for both genes mediated salt tolerance in Arabidopsis, supporting the notion of concerted evolution.&lt;br /&gt;
&lt;br /&gt;
===Evolution===&lt;br /&gt;
Complete genome sequences and bioinformatics provide new insights into the evolutionary history of plant genomes. In particular, the Poaceae genome, which includes major food crops such as rice, wheat, corn, and sorghum, is believed to have undergone a pregrass whole-genome duplication event with a common ancestor 70–90 million years ago (Mya)(Paterson et al., 2009; Salse et al., 2008, 2009; Wang et al., 2005) followed by independent gene loss during speciation.&lt;br /&gt;
&lt;br /&gt;
Investigation on the dynamic expansion and genomic localization of rice RING finger protein genes over evolution revealed only two RING-C2 type protein genes located on the distal part on each of rice chromosomes 11 and 12 (Lim et al., 2010).&lt;br /&gt;
&lt;br /&gt;
The finding that the distal regions of rice chromosomes 11 and 12 diverged 70–90 Mya and may have undergone frequent illegitimate recombination such as gene conversion  raises the question regarding the evolutionary fate of OsRINGC2-1 and OsRINGC2-2 located on the distal parts of these chromosomes.We attempted to choose each of 10 OsRINGC2-1 and OsRINGC2-2 neighboring genes, respectively, and 100 randomly selected duplicate genes, which were generated by whole-genome duplication elsewhere in the genome. Strikingly low Ka, Ks, and dsm values were observed between duplicate genes (but not all) located on the distal parts of chromosomes 11 and 12 as compared to those of random sets (Fig 3).&lt;br /&gt;
&lt;br /&gt;
[[File: liu-Os12g0102400-Fig2.jpg|right|thumb|200px|''A phylogenic tree of RING-C2 type genes in Viridiplantae. The numbers on the left side indicate percent bootstrap values.  Solid circles indicate OsRINGC2-1 and OsRINGC2-2. The species abbreviations are listed as follows; At, Arabidopsis thaliana; Al, Arabidopsis lyrata; Cp, Carica papaya; Cs, Cucumis sativus; Rc, Ricinus communis; Me, Manihot esculenta; Gm, Glycine max; Mt, Medicago truncatula; Bd, Brachypodium distachyon; Zm, Zea mays; Os, Oryza sativa, Sb, Sorghum bicolor; Si, Setaria italica; Ac, Aquilegia coerulea; Pp, Prunus persica; Pt, Populus trichocarpa; Mg, Mimulus guttatus; Sm, Selaginella moellendorffii; Vv, Vitis vinifera. (from reference &amp;lt;ref name=&amp;quot;Jung&amp;quot; /&amp;gt;).'']]&lt;br /&gt;
&lt;br /&gt;
[[File: liu-Os12g0102400-Fig3.jpg|right|thumb|200px|''Sequence divergence of duplicated genes pairs in upstream and downstream of Os11g01190 and Os12g01190.. (from reference &amp;lt;ref name=&amp;quot;Jung&amp;quot; /&amp;gt;).'']]&lt;br /&gt;
&lt;br /&gt;
==Labs working on this gene==&lt;br /&gt;
Plant Genomics Lab, Department of Applied Plant Sciences, Kangwon National University, Chuncheon 200‐713, Korea&lt;br /&gt;
&lt;br /&gt;
==Reference==&lt;br /&gt;
Jung, Chang Gyo, Lim, Sung Don, Hwang, Sun-Goo, &amp;amp; Jang, Cheol Seong. (2012). Molecular characterization and concerted evolution of two genes encoding RING-C2 type proteins in rice. Gene, 505(1), 9-18. doi: http://dx.doi.org/10.1016/j.gene.2012.05.060&lt;br /&gt;
&lt;br /&gt;
Lim, S.D., et al., 2010. A gene family encoding RING finger proteins in rice: their expansion, expression diversity, and co-expressed genes. Plant Mol. Biol. 72, 369–380.&lt;br /&gt;
&lt;br /&gt;
Paterson, A.H., et al., 2009. The Sorghum bicolor genome and the diversification of grasses. Nature 457, 551–556.&lt;br /&gt;
&lt;br /&gt;
Wang, X., et al., 2005. Duplication and DNA segmental loss in the rice genome: implications for diploidization. New Phytol. 165, 937–946.&lt;br /&gt;
&lt;br /&gt;
[[Category:Genes]]&lt;br /&gt;
[[Category:Japonica mRNA]]&lt;br /&gt;
[[Category:Oryza Sativa Japonica Group]]&lt;br /&gt;
[[Category:Japonica Genes]]&lt;br /&gt;
[[Category:Japonica Chromosome 12]]&lt;br /&gt;
[[Category:Chromosome 12]]&lt;/div&gt;</summary>
		<author><name>Lmw2015</name></author>	</entry>

	<entry>
		<id>https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os12g0100500&amp;diff=248919</id>
		<title>Os12g0100500</title>
		<link rel="alternate" type="text/html" href="https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os12g0100500&amp;diff=248919"/>
				<updated>2015-06-12T04:29:38Z</updated>
		
		<summary type="html">&lt;p&gt;Lmw2015: /* Structured Information */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;Please input one-sentence summary here.&lt;br /&gt;
&lt;br /&gt;
==Annotated Information==&lt;br /&gt;
''Os12g0100500'' in rice hasn't been studied. However, by running blast, we can find that query coverage is 100% with predicted protein [Hordeum vulgare subsp. vulgare]. This gene is predicted to be coding Lysophospholipase [Lipid metabolism]; COG2267.  &lt;br /&gt;
===Function===&lt;br /&gt;
In enzymology, a lysophospholipase (EC 3.1.1.5) is an enzyme that catalyzes the chemical reaction&lt;br /&gt;
&lt;br /&gt;
2-lysophosphatidylcholine + H2O \rightleftharpoons glycerophosphocholine + a carboxylate&lt;br /&gt;
Thus, the two substrates of this enzyme are 2-lysophosphatidylcholine and H2O, whereas its two products are glycerophosphocholine and carboxylate.&lt;br /&gt;
This enzyme belongs to the family of hydrolases, specifically those acting on carboxylic ester bonds. This family consists of lysophospholipase / phospholipase B EC 3.1.1.5 and cytosolic phospholipase A2 which also has a C2 domain IPR000008. Phospholipase B enzymes catalyse the release of fatty acids from lysophospholipids and are capable in vitro of hydrolyzing all phospholipids extractable from yeast cells.[1] Cytosolic phospholipase A2 associates with natural membranes in response to physiological increases in Ca2+ and selectively hydrolyses arachidonyl phospholipids,[2] the aligned region corresponds the carboxy-terminal Ca2+-independent catalytic domain of the protein as discussed in.[2]&lt;br /&gt;
===Expression===&lt;br /&gt;
Please input expression information here.&lt;br /&gt;
&lt;br /&gt;
===Evolution===&lt;br /&gt;
Please input evolution information here.&lt;br /&gt;
&lt;br /&gt;
You can also add sub-section(s) at will.&lt;br /&gt;
&lt;br /&gt;
==Labs working on this gene==&lt;br /&gt;
Please input related labs here.&lt;br /&gt;
&lt;br /&gt;
==References==&lt;br /&gt;
[1] Nalefski EA, Sultzman LA, Martin DM, Kriz RW, Towler PS, Knopf JL, Clark JD (1994). &amp;quot;Delineation of two functionally distinct domains of cytosolic phospholipase A2, a regulatory Ca(2+)-dependent lipid-binding domain and a Ca(2+)-independent catalytic domain&amp;quot;. J. Biol. Chem. 269 (27): 18239–18249. PMID 8027085.&lt;br /&gt;
[2]Jump up to: a b Lee KS, Patton JL, Fido M, Hines LK, Kohlwein SD, Paltauf F, Henry SA, Levin DE (1994). &amp;quot;The Saccharomyces cerevisiae PLB1 gene encodes a protein required for lysophospholipase and phospholipase B activity&amp;quot;. J. Biol. Chem. 269 (31): 19725–19730. PMID 8051052.&lt;br /&gt;
&lt;br /&gt;
[[Category:Genes]]&lt;br /&gt;
[[Category:Japonica mRNA]]&lt;br /&gt;
[[Category:Oryza Sativa Japonica Group]]&lt;br /&gt;
[[Category:Japonica Genes]]&lt;br /&gt;
[[Category:Japonica Chromosome 12]]&lt;br /&gt;
[[Category:Chromosome 12]]&lt;/div&gt;</summary>
		<author><name>Lmw2015</name></author>	</entry>

	<entry>
		<id>https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os11g0685700&amp;diff=248918</id>
		<title>Os11g0685700</title>
		<link rel="alternate" type="text/html" href="https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os11g0685700&amp;diff=248918"/>
				<updated>2015-06-12T04:29:08Z</updated>
		
		<summary type="html">&lt;p&gt;Lmw2015: /* Structured Information */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&lt;br /&gt;
==Annotated Information==&lt;br /&gt;
&lt;br /&gt;
===Function===&lt;br /&gt;
1,Roles in disease resistance and responses to salicylic acid:  The major role of WRKY genes in flowering plants is to mediate defense responses.WRKY18, WRKY40, and WRKY60 form both homocomplexes and heterocomplexes to regulate Arabidopsis responses to the hemibiotrophic bacterial pathogen Pseudomonas syringae and the necrotrophic fungal pathogen Botrytis cinerea.An indica rice WRKY gene, which is identical to OsWRKY12,is induced by the bacterial pathogen Xanthomonas oryzae pv. oryzae.For japonica, an analysis of OsWRKY genes revealed that the expression level of 15 WRKY genes is increased in an interaction between rice and Magnaporthe frisea, a fungal pathogen that causes devastating rice blast disease. Besides,the expression of two OsWRKY genes was increased in SA-treated leaves and that of three OsWRKY genes was increased by jasmonic acid (JA) treatment.&lt;br /&gt;
&lt;br /&gt;
2.Roles in seed development and germination: MINI3 encodes WRKY10, a WRKY class transcription factor, which is responsible for seed growth and development. Besides, two WRKY genes are induced during somatic embryo genesis of orchardgrass. The products of WRKY genes, which named SUSIBA2,is a regulatory transcription factor in starch synthesis. OsWRKY51 and OsWRKY71 are  two ABA-inducible and gibberellin (GA)-repressible rice WRKY genes, which mediate the cross-talk of GA and ABA signaling,can repress the expression of α- amylase gene, as the figure shows. TTG2,a group I WRKY protein is also responsible for trichome development and mucilage production in the seed coat of rice. What's more,WRKY genes is also involved in the process of senescence.Arabidopsis AtWRKY53 is expressed&lt;br /&gt;
in an age-dependent manner and, when overexpressed, leads to early flowering and senescence.&lt;br /&gt;
[[File:tang1.jpg]]&lt;br /&gt;
&lt;br /&gt;
3，Roles in responses to abiotic stresses and ABA: In the desert plant Retama raetam, a WRKY gene was only induced when the plant was exposed to a combination of heat shock and drought.Several rice WRKY genes to be capable of regulating the ABA-inducible HVA22 promoter in a positive(OsWRKY72 and -77) or negative (OsWRKY24 and -45) manner.A dozen rice WRKY genes are induced by heat shock, cold stress, high salinity, and polyethylene glycol.Hv-WRKY38,the ortholog of OsWRKY51 and -71 ,is upregulated in response to drought and cold in vegetative tissues. Moreover,OsWRKY71 was upregulated by SA,JA, 1-aminocyclo-propane-1-carboxylic acid (ACC), wounding,&lt;br /&gt;
and pathogen infection. Overexpression of OsWRKY71 in rice resulted in enhanced resistance to virulent Xoo 13751.&lt;br /&gt;
&lt;br /&gt;
4,Roles in the biosynthesis of secondary metabolites: WRKY genes regulate the biosynthesis of sesquiterpene and benzylisoquinoline alkaloid.CjWRKY1 in C. japonica protoplasts was found to be responsible for the level of transcripts of berberine biosynthetic genes.&lt;br /&gt;
&lt;br /&gt;
===Evolution===&lt;br /&gt;
WRKY domains were initially defined by a nearly 60 amino acid long motif possessing the well-conserved amino acid signature WRKYGQK at their N-terminus and containing a novel zinc finger-like structure of the form CX4–5CX22–23HXH.WRKY proteins containing a single WRKY domain are group II proteins; those with two are group I.The group II WRKY proteins are further subdivided into subgroups a–e based on the presence of short conserved structural motifs.The group IId WRKY proteins have been shown to bind calmodulin through the defining non-classical calmodulin-binding domain (CaMBD) VSSFK(K/R) VISLL.A third group, group III, contains a single WRKY domain with a variant zinc-finger CX7CX23HXC.The terminal histidine of the zinc-finger of groups Ib and III is replaced with cysteine and the spacing is altered within group III.Group IV WRKY proteins contain the WRKY motif, but lack a complete zinc-finger.&lt;br /&gt;
Multiple domain acquisition and loss events appear to have shaped the WRKY family. Numerous WRKY gene duplications occurred after the divergence of the monocotyledons from dicotyledons some 50–80 million years ago. The WRKY domains are found in expressed sequence tags (ESTs) from over 40 species of land plants.There is no evidence for WRKY genes in the archaea,eubacteria, the eukaryotic fungi, or animal lineages. However,a single WRKY gene with two WRKY domains exists in thegenomes of the protist Giardia lamblia and the slime mold Dictyostelium discoideum.the WRKY family may occur in primitive eukaryotes, before the emergence of the plant phyla, and its gross expansion during the course of plant evolutionary radiation, likely because of selective pressures favoring greater adaptability.The presence of a group I WRKY protein in these ancient organisms suggests that group I WRKY genes represent the ancestral form, with other groups arising later through losses and gains of a WRKY domain, and that this family originated some 1.8–2 billion years ago.Only group Ia genes, but not group Ib genes, appear to be derived from ancestral forms of the WRKY genes in plants.&lt;br /&gt;
Researchers find evidence of loss of the N-terminus in the evolution of single-domain group II and group IV genes from group Ia genes and independent loss of the C-terminus in the evolution of a single-domain group II gene. Other group II genes may have evolved by this process.The group Ib OsWRKY genes are likely to have evolved by intramolecular duplication of a group III WRKY domain that had already evolved the C2HC type zinc-finger.Figure 2 shows that there is a difference between N- and C-terminal WRKY domains for those WRKY proteins with two WRKY domains. These domains tend to cluster into discrete groupings and there is more variability among the N- than the C-terminal WRKY domains. In the WRKY protein,the C-terminal domains are required for DNA-binding activity, thus are constrained in their ability to mutate without losing function, whereas the N-terminal domains mediate protein-protein interactions and may be less functionally constrained. The group II rice WRKY genes arose from the two-domain group Ia WRKY genes through a single domain loss event. The group Ib genes were derived from group III by domain duplication. The C- and N-terminal domains of group Ib genes are exclusively clustered with those of group 3 genes. The group Ia genes arose from a fusion of two group II WRKY genes evolved at an early time.The WRKY80 domain may represent the extant descendent of the group Ia C-terminal progenitor and WRKY57 a descendent of the N-terminal progenitor.&lt;br /&gt;
&lt;br /&gt;
[[File:RIVER2.jpg]]&lt;br /&gt;
&lt;br /&gt;
===Expression===&lt;br /&gt;
The precise mechanism of WRKY-mediated gene regulation remains unclear. WRKY mRNA accumulates rapidly after induction and seemingly does not require the synthesis of new transcription factors. Some studies indicate that a few of WRKY proteins may be the target of mitogen-activated protein kinases (MAPK) that alter their activity.Both WIPK and SIPK, which are two well-studied stress-responsive kinases and can be phosphorylated by MAPK NtMEK2 (in tobacco) in response to infection and an unknown upstream MAPK,appear to be upstream of NtWRKY1 and NtWRKY3 in a defense-signaling cascade in Nicotiana. Besides,AtWRKY22 and AtWRKY29 have also been identified as being downstream of MAPK signaling cascades. A hypothetical model to explain PcPR10 gene activation, which which may be similarly applicable to other WRKY factors in other plants, demonstrates that W-box elements are generally occupied by WRKY factors that are either inactive or promoting basal RNA expression.Following recognition of an elicitor molecule by a receptor, an MAPK cascade is activated, with a protein kinase being translocated into the nucleus of the cell where it can hypothetically modify bound WRKY factors directly.This allosteric interaction causes them to release from their cognate W-box elements, thereby derepressing PcPR10 and PcWRKY1, which interacts with additional target promoters and also autoregulates its own expression.&lt;br /&gt;
&lt;br /&gt;
[[Category:Genes]]&lt;br /&gt;
[[Category:Japonica mRNA]]&lt;br /&gt;
[[Category:Oryza Sativa Japonica Group]]&lt;br /&gt;
[[Category:Japonica Genes]]&lt;/div&gt;</summary>
		<author><name>Lmw2015</name></author>	</entry>

	<entry>
		<id>https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os11g0648000&amp;diff=248917</id>
		<title>Os11g0648000</title>
		<link rel="alternate" type="text/html" href="https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os11g0648000&amp;diff=248917"/>
				<updated>2015-06-12T04:28:47Z</updated>
		
		<summary type="html">&lt;p&gt;Lmw2015: /* Structured Information */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;''OsNHX3(Os11g0648000)'', is a Na&amp;lt;sup&amp;gt;+&amp;lt;/sup&amp;gt;and H&amp;lt;sup&amp;gt;+&amp;lt;/sup&amp;gt;exchanger in rice (''Oryza sativa'')&amp;lt;ref name=&amp;quot;ref1&amp;quot;/&amp;gt;.&lt;br /&gt;
==Annotated Information==&lt;br /&gt;
===Function===&lt;br /&gt;
[[File: OsNHX3 Genomic organization.jpg|right|thumb|300px|'''Figure 1.''''' Genomic organization of the OsNHX3 genes.(from reference &amp;lt;ref name=&amp;quot;ref1&amp;quot;/&amp;gt;).'']] &lt;br /&gt;
*''OsNHX3'' can suppress the Na&amp;lt;sup&amp;gt;+&amp;lt;/sup&amp;gt;, Li&amp;lt;sup&amp;gt;+&amp;lt;/sup&amp;gt;, and hygromycin sensitivity of yeast ''nhx1'' mutants and their sensitivity to a high K&amp;lt;sup&amp;gt;+&amp;lt;/sup&amp;gt; concentration. The expression of [[Os07g0666900|''OsNHX1'']], [[Os05g0148600|''OsNHX2'']], ''OsNHX3'', and [[Os09g0286400|''OsNHX5'']] is regulated differently in rice tissues and is increased by salt stress, hyperosmotic stress, and ABA&amp;lt;ref name=&amp;quot;ref1&amp;quot;/&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
*The genomic organization of OsNHX3 is graphically presented in Figure 1. ''OsNHX3'' had 15 exons&amp;lt;ref name=&amp;quot;ref1&amp;quot;/&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
'''GO assignment(s):''' [http://amigo.geneontology.org/amigo/term/GO:0006814 GO:0006814], [http://amigo.geneontology.org/amigo/term/GO:0006885 GO:0006885], [http://amigo.geneontology.org/amigo/term/GO:0015299 GO:0015299], [http://amigo.geneontology.org/amigo/term/GO:0015385 GO:0015385], [http://amigo.geneontology.org/amigo/term/GO:0016021 GO:0016021]&lt;br /&gt;
&lt;br /&gt;
===Expression===&lt;br /&gt;
[[File: OsNHX Expression01.jpg|right|thumb|210px|'''Figure 2.''''' Expression of OsNHX1, 2, 3, and 5 in rice tissues.(from reference &amp;lt;ref name=&amp;quot;ref1&amp;quot;/&amp;gt;).'']] &lt;br /&gt;
''Fukuda et al.'' examined the expression of [[Os07g0666900|''OsNHX1'']], [[Os05g0148600|''OsNHX2'']], ''OsNHX3'', and [[Os09g0286400|''OsNHX5'']] in various rice tissues by Northern-blot analysis with total RNA extracted from 8-day-old rice seedlings and 12-weekold rice (7 days after heading). Expression of these genes was regulated differently in different rice tissues (Fig. 2). Compared with other tissues, those of OsNHX3 were higher in flag leaf sheaths and blades &amp;lt;ref name=&amp;quot;ref1&amp;quot;/&amp;gt;&lt;br /&gt;
&lt;br /&gt;
*Treatment with salt stress, hyperosmotic stress (mannitol), and ABA increased the transcript levels of [[Os07g0666900|''OsNHX1'']], [[Os05g0148600|''OsNHX2'']], ''OsNHX3'', and [[Os09g0286400|''OsNHX5'']] in rice seedlings&amp;lt;ref name=&amp;quot;ref1&amp;quot;/&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
*Treatment with high concentrations of KCl scarcely changed transcript levels of OsNHX3 (Fig. 5b). In Figure 3, OsNHX3-mediated less K&amp;lt;sup&amp;gt;+&amp;lt;/sup&amp;gt; tolerance than the other family genes in yeast mutants. These results suggest that OsNHX3 might have low transport capacity of K&amp;lt;sup&amp;gt;+&amp;lt;/sup&amp;gt; and not function in the tolerance of rice seedlings to high concentrations of KCl&amp;lt;ref name=&amp;quot;ref1&amp;quot;/&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
*The expression of [[Os07g0666900|''OsNHX1'']], [[Os05g0148600|''OsNHX2'']], ''OsNHX3'', and [[Os09g0286400|''OsNHX5'']] might be regulated through different ABA-dependent pathways&amp;lt;ref name=&amp;quot;ref1&amp;quot;/&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
===Evolution===&lt;br /&gt;
[[File: OsNHX Phylogenetic01.jpg|left|thumb|220px|'''Figure 3.''''' Phylogenetic analysis of Na&amp;lt;sup&amp;gt;+&amp;lt;/sup&amp;gt;/H&amp;lt;sup&amp;gt;+&amp;lt;/sup&amp;gt; antiporter proteins.(from reference &amp;lt;ref name=&amp;quot;ref1&amp;quot;/&amp;gt;).'']] &lt;br /&gt;
[[File: OsNHX Phylogenetic02.jpg|right|thumb|220px|'''Figure 4.''''' Phylogenetic tree of intracellular NHE/NHX exchangers.(from reference &amp;lt;ref name=&amp;quot;ref4&amp;quot;/&amp;gt;).'']] &lt;br /&gt;
*The OsNHX proteins shared between 29 and 75% identity. OsNHX1 through 4 in particular shared high similarity, with more than 70% identity among OsNHX1 through 3 and more than 50% identity among OsNHX1 through 4. The sequence of LFFIYLLPPI, which is identified as the binding site of amiloride, an inhibitor of eukaryotic Na&amp;lt;sup&amp;gt;+&amp;lt;/sup&amp;gt;/H&amp;lt;sup&amp;gt;+&amp;lt;/sup&amp;gt; antiporters, was identical among OsNHX1 through 3 and highly conserved in OsNHX4 and 5. The membrane-spanning segments M5 and M6 of OsNHX1, which are well conserved in the eukaryotic Na&amp;lt;sup&amp;gt;+&amp;lt;/sup&amp;gt;/H&amp;lt;sup&amp;gt;+&amp;lt;/sup&amp;gt; antiporters, also shared high similarity with OsNHX2 through 5, and all of the OsNHX proteins contained the residues important for Na&amp;lt;sup&amp;gt;+&amp;lt;/sup&amp;gt;/H&amp;lt;sup&amp;gt;+&amp;lt;/sup&amp;gt; antiport activity&amp;lt;ref name=&amp;quot;ref2&amp;quot;/&amp;gt;&amp;lt;ref name=&amp;quot;ref3&amp;quot;/&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
*OsNHX1 through 4, AtNHX1 through 4, and other most plant NHXtype antiporters are classified into a type I group, and OsNHX5, AtNHX5, AtNHX6, and LeNHX2 from ''L. esculentum'' are classified into the type II group (Fig. 3)&amp;lt;ref name=&amp;quot;ref1&amp;quot;/&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
*''Arabidopsis'' contains six NHX genes and rice has five, which are distributed in a similar way: AtNHX1–4 and OsNHX1–4 constitute class&lt;br /&gt;
I, and AtNHX5–6 and OsNHX5 constitute class II (Fig. 4). Members of the class-I category of Arabidopsis and rice show 54–87% similarity. Similarity among class-II members is 72–79%, but they are only 21–23% similar to class-I isoforms. These data indicate that divergence between class-I and class-II exchangers in plants occurred before the separation of dicotyledons and monocotyledons&amp;lt;ref name=&amp;quot;ref2&amp;quot;/&amp;gt;. &lt;br /&gt;
&lt;br /&gt;
*''Pires et al.'' observe that multiple independent duplication events have occurred throughout the evolutionary history of the NHX family. Based on the reconciled phylogeny, ''Pires et al.'' estimate 27 independent gene duplication and 40 gene loss events during the diversification of this gene family&amp;lt;ref name=&amp;quot;ref5&amp;quot;/&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
===Knowledge Extension===&lt;br /&gt;
*The Na&amp;lt;sup&amp;gt;+&amp;lt;/sup&amp;gt;/H&amp;lt;sup&amp;gt;+&amp;lt;/sup&amp;gt;exchanger that catalyzes the exchange of Na&amp;lt;sup&amp;gt;+&amp;lt;/sup&amp;gt;for H&amp;lt;sup&amp;gt;+&amp;lt;/sup&amp;gt;across membranes, contributes to regulation of internal pH, cell volume, and sodium level in the cytoplasm)&amp;lt;ref name=&amp;quot;ref6&amp;quot;/&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
*Na&amp;lt;sup&amp;gt;+&amp;lt;/sup&amp;gt;/H&amp;lt;sup&amp;gt;+&amp;lt;/sup&amp;gt; antiporters, which catalyze the exchange of Na&amp;lt;sup&amp;gt;+&amp;lt;/sup&amp;gt; for H&amp;lt;sup&amp;gt;+&amp;lt;/sup&amp;gt; across membranes, contribute to the regulation of internal pH, cell volume and the sodium level in the cytoplasm&amp;lt;ref name=&amp;quot;ref7&amp;quot;/&amp;gt;&amp;lt;ref name=&amp;quot;ref8&amp;quot;/&amp;gt;. The antiporters are widespread membrane proteins found in animals, yeasts, bacteria and plants. In particular, vacuolar Na&amp;lt;sup&amp;gt;+&amp;lt;/sup&amp;gt;/H&amp;lt;sup&amp;gt;+&amp;lt;/sup&amp;gt; antiporters, which compartmentalize Na&amp;lt;sup&amp;gt;+&amp;lt;/sup&amp;gt; into the vacuoles for detoxification, have been investigated as the key to salt tolerance in yeasts and plants&amp;lt;ref name=&amp;quot;ref9&amp;quot;/&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
==Labs working on this gene==&lt;br /&gt;
*Division of Plant Sciences, National Institute of Agrobiological Sciences, Kannondai 2-1-2, Tsukuba, Ibaraki 305-8602, Japan&lt;br /&gt;
*Graduate School of Life and Environmental Sciences, Tsukuba University, Tennoudai 1-1-1, Tsukuba, Ibaraki 305-8572, Japan&lt;br /&gt;
*Instituto de Recursos Naturales y Agrobiologı´a, Consejo Superior de Investigaciones Cientı´ficas, Reina Mercedes 10, Sevilla 41012, Spain &lt;br /&gt;
*Department of Biology and Center for Genomics and Systems Biology, New York University, New York, US &lt;br /&gt;
&lt;br /&gt;
==References==&lt;br /&gt;
&amp;lt;references&amp;gt;&lt;br /&gt;
* &amp;lt;ref name=&amp;quot;ref1&amp;quot;&amp;gt;&lt;br /&gt;
Fukuda A, Nakamura A, Hara N, et al. Molecular and functional analyses of rice NHX-type Na+/H+ antiporter genes[J]. Planta, 2011, 233(1): 175-188.&lt;br /&gt;
&amp;lt;/ref&amp;gt;&lt;br /&gt;
* &amp;lt;ref name=&amp;quot;ref2&amp;quot;&amp;gt;&lt;br /&gt;
Bowers K, Levi B P, Patel F I, et al. The sodium/proton exchanger Nhx1p is required for endosomal protein trafficking in the yeast Saccharomyces cerevisiae[J]. Molecular Biology of the Cell, 2000, 11(12): 4277-4294.&lt;br /&gt;
&amp;lt;/ref&amp;gt;&lt;br /&gt;
* &amp;lt;ref name=&amp;quot;ref3&amp;quot;&amp;gt;&lt;br /&gt;
Hamada A, Hibino T, Nakamura T, et al. Na+/H+ Antiporter fromSynechocystis Species PCC 6803, Homologous to SOS1, Contains an Aspartic Residue and Long C-Terminal Tail Important for the Carrier Activity[J]. Plant physiology, 2001, 125(1): 437-446.&lt;br /&gt;
&amp;lt;/ref&amp;gt;&lt;br /&gt;
* &amp;lt;ref name=&amp;quot;ref4&amp;quot;&amp;gt;&lt;br /&gt;
Pardo J M, Cubero B, Leidi E O, et al. Alkali cation exchangers: roles in cellular homeostasis and stress tolerance[J]. Journal of Experimental Botany, 2006, 57(5): 1181-1199.     &lt;br /&gt;
&amp;lt;/ref&amp;gt;&lt;br /&gt;
* &amp;lt;ref name=&amp;quot;ref5&amp;quot;&amp;gt;&lt;br /&gt;
Pires I S, Negrão S, Pentony M M, et al. Different evolutionary histories of two cation/proton exchanger gene families in plants[J]. BMC plant biology, 2013, 13(1): 97.&lt;br /&gt;
&amp;lt;/ref&amp;gt;&lt;br /&gt;
* &amp;lt;ref name=&amp;quot;ref6&amp;quot;&amp;gt;&lt;br /&gt;
Orlowski J, Grinstein S. Na+/H+ exchangers of mammalian cells[J]. Journal of Biological Chemistry, 1997, 272(36): 22373-22376.&lt;br /&gt;
&amp;lt;/ref&amp;gt;&lt;br /&gt;
* &amp;lt;ref name=&amp;quot;ref7&amp;quot;&amp;gt;&lt;br /&gt;
Aronson P S. Kinetic properties of the plasma membrane Na+-H+ exchanger[J]. Annual Review of Physiology, 1985, 47(1): 545-560.&lt;br /&gt;
&amp;lt;/ref&amp;gt;&lt;br /&gt;
* &amp;lt;ref name=&amp;quot;ref8&amp;quot;&amp;gt;&lt;br /&gt;
Numata M, Orlowski J. Molecular cloning and characterization of a novel (Na+, K+)/H+ exchanger localized to the trans-Golgi network[J]. Journal of Biological Chemistry, 2001, 276(20): 17387-17394.&lt;br /&gt;
&amp;lt;/ref&amp;gt;&lt;br /&gt;
* &amp;lt;ref name=&amp;quot;ref9&amp;quot;&amp;gt;&lt;br /&gt;
Blumwald E, Aharon G S, Apse M P. Sodium transport in plant cells[J]. Biochimica et Biophysica Acta (BBA)-Biomembranes, 2000, 1465(1): 140-151.&lt;br /&gt;
&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;/references&amp;gt;&lt;br /&gt;
&lt;br /&gt;
[[Category:Genes]]&lt;br /&gt;
[[Category:Japonica mRNA]]&lt;br /&gt;
[[Category:Oryza Sativa Japonica Group]]&lt;br /&gt;
[[Category:Japonica Genes]]&lt;br /&gt;
[[Category:Japonica Chromosome 11]]&lt;br /&gt;
[[Category:Chromosome 11]]&lt;/div&gt;</summary>
		<author><name>Lmw2015</name></author>	</entry>

	<entry>
		<id>https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os11g0639100&amp;diff=248916</id>
		<title>Os11g0639100</title>
		<link rel="alternate" type="text/html" href="https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os11g0639100&amp;diff=248916"/>
				<updated>2015-06-12T04:28:29Z</updated>
		
		<summary type="html">&lt;p&gt;Lmw2015: /* Structured Information */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;Please input one-sentence summary here.&lt;br /&gt;
&lt;br /&gt;
==Annotated Information==&lt;br /&gt;
This gene(''Pikh; Pi54; Pi54rh'') confers a high degree of resistance to diverse strains of the fungus Magnaporthe oryzae. The rice blast resistance gene Pi-kh has been isolated from the indica rice line Tetep showing resistance to different M. oryzae strains in the North-Western Himalayan region of India &amp;lt;ref name=&amp;quot;ref4&amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
===Function===&lt;br /&gt;
Pi54 (Pi-kh cloned from the rice line Tetep) confers broad spectrum resistance against geographically diverse strains of M. oryzae collected from various parts of India and the US &amp;lt;ref name=&amp;quot;ref1&amp;quot; /&amp;gt;. In order to develop sustainably successful blast-resistant rice lines, a comprehensive dissection of the reactions downstream of R–Avr interactions is highly desirable.The co-expression patterns of bacterial disease resistance genes and their transcriptional regulators in transgenic rice have indicated that the resistance genes trigger an immune response &amp;lt;ref name=&amp;quot;ref2&amp;quot; /&amp;gt;. The expression patterns of defence response genes involved in rice–M. oryzae interaction have been widely studied &amp;lt;ref name=&amp;quot;ref3&amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
[[File:Functional analysis of differentially regulated genes of.png]]&amp;lt;ref name=&amp;quot;ref5&amp;quot; /&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The transgenic lines continually show a high degree of resistance and hypersensitive response to the blast pathogen in the fifth generation as well. Typical blast lesions as observed in the non-transgenic susceptible rice line Taipei 309 (TP). No such disease symptoms were observed in the resistant transgenic line (TP-Pi54); hypersensitive response (HR) was observed in the TP-Pi54 line.&amp;lt;ref name=&amp;quot;ref5&amp;quot; /&amp;gt;&lt;br /&gt;
&lt;br /&gt;
[[File:Gene ontology score-based categorization of differen-.png]]&amp;lt;ref name=&amp;quot;ref5&amp;quot; /&amp;gt;&lt;br /&gt;
&lt;br /&gt;
Adopting a stringent criterion for the expression fold change value (FCA) of &amp;gt;2.0 and the P value &amp;lt;0.05, a total of 1154 differentially expressed genes were identified in TP-Pi54 plants. Of these, 587 were up-regulated, whereas 567 genes were found to be down-regulated. All the genes that showed differential expression in the transgenic blast-resistant line TP-Pi54 were clustered and functionally annotated. The level of expression of these genes in TP-Pi54 plants was compared with that in TP plants. Based on K-means clustering, the functionally annotated genes were classified into eight different clusters. These genes were also analysed on the basis of their Gene Ontology (GO) score into three main GO categories, including biological process (BP), molecular function (MF), and cellular component (CC).&lt;br /&gt;
&lt;br /&gt;
[[File:Functional categorization of genes differentially expressed in the TP-Pi54 line.png]] &amp;lt;ref name=&amp;quot;ref5&amp;quot; /&amp;gt;&lt;br /&gt;
&lt;br /&gt;
The number of genes was finalized using the filtering criteria of fold change &amp;gt;2.0 and P-value correction &amp;lt;¼0.05 by FDR (Benjamini-Hochberg). Genes were classified into 16 different categories based on Gene Ontology. The number of up- and down-regulated genes for each functional category is shown in the histogram. The functional categories are: A, binding; B, catalytic activity; C, transporter activity; D, transcription regulator activity; E, molecular transducer activity; F, antioxidant activity; G, metabolic processes; H, cellular processes; I, biological regulation; J, establishment of localization; K, response to stimulus; L, anatomical structure function; M, cell part; N, organelle; O, organelle part; and P, molecular complex. (A) Up-regulated genes, (B) Down-regulated genes.&lt;br /&gt;
&lt;br /&gt;
===Expression===&lt;br /&gt;
All the putative transformants (T0) were first screened for the presence of transgene by PCR. Genomic DNA was isolated from the leaves of putative transformants by using DNeasy Plant Mini Kit (QIAGEN, Cologne, USA) as per manufacturer’s instructions. Three primer sets were designed for the screening of transformants by PCR (Fig. 1a). The first pair of primer, CaPi-F: GAGGAGGTTTCCCGATATTAC and CaPi-R: GGTAGGTTCTCCAACCATTCTG was se-&lt;br /&gt;
lected to get amplification of the region between CaMV35S promoter and Pi54 gene with an amplicon size of 1.43 kb. The second pair HyPi-F: CGGTGAGTTCAGGCTTTTTC and Hypi-R: TGCAGTGCTCTCAATTTTGG was designed from within hpt gene to give an amplification of 1 kb. The third pair GUS-F: ATGGTAGATCTGAGGGG and GUS-R: AAGTCGAAGTTCGGCT was designed from within the β-glucuronidase gene with an amplicon of 750 bp. &lt;br /&gt;
&lt;br /&gt;
[[File:Development of gene construct used in plant transformation.png]]&amp;lt;ref name=&amp;quot;ref6&amp;quot; /&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Evolution===&lt;br /&gt;
[[File:Phylogenetic analysis of.png]]&amp;lt;ref name=&amp;quot;ref7&amp;quot; /&amp;gt;&lt;br /&gt;
&lt;br /&gt;
Phylogenetic analysis of the Pi54rh with 19 blast resistance genes cloned from rice. Bootstrap values, corresponding to the match times of branching orders (1,000 replicates), are shown at the nodes of each branch point. The unit of branch length is 0.2 nucleotide substitutions per site, as indicated by a bar at the bottom left corner of the tree.&lt;br /&gt;
&lt;br /&gt;
[[File:Structural components of Pi54 orthologues..png]]&amp;lt;ref name=&amp;quot;ref7&amp;quot; /&amp;gt;&lt;br /&gt;
&lt;br /&gt;
Structural components of Pi54 orthologues. '''a''' Nipponbare; '''b''' Tetep ; '''c''' O. rhizomatis and '''d'''&lt;br /&gt;
tertiary structure of PI54RH protein generated by homology modelling using Modeller module of Accelrys Discovery Studio Software. CC domain (sky blue), NBS domain (parrot green), LRR domains (violet) and Zn-finger domain (yellow), N indicates amino terminal and C indicates carboxy terminal of PI54RH protein.&lt;br /&gt;
&lt;br /&gt;
===Detection of callose deposition===&lt;br /&gt;
To analyze this important aspect of defense response by the rice plants and understand about the possible involvement of Pi54 gene in the deposition of callose, 15 m thick transverse sections of leaf epidermis were prepared from the transgenic and non-transgenic plants after 0, 72, 96 and 120 hpi and stained with callose specific aniline blue stain. Stained sections were observed under fluorescent light microscope. Careful histochemical examination of these sections revealed the gradually increasing deposition of callose resulting into thickened cell walls in the plants of transgenic line TP-Pi54-2, which has earlier been found to be highly resistant to M. oryzae.&amp;lt;ref name=&amp;quot;ref6&amp;quot; /&amp;gt;&lt;br /&gt;
&lt;br /&gt;
[[File:Effect of blast inoculation on deposition of Callose and other.png]]&amp;lt;ref name=&amp;quot;ref6&amp;quot; /&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==Labs working on this gene==&lt;br /&gt;
&lt;br /&gt;
# National Research Centre on Plant Biotechnology, Indian Agricultural Research Institute,India.&lt;br /&gt;
&lt;br /&gt;
# Department of Biotechnology, Himachal Pradesh University, India.&lt;br /&gt;
&lt;br /&gt;
==References==&lt;br /&gt;
&amp;lt;references&amp;gt;&lt;br /&gt;
* &amp;lt;ref name=&amp;quot;ref1&amp;quot;&amp;gt;Costanzo S, Jia Y. 2010. Sequence variation at the rice blast resistance gene Pi-km locus: implications for the development of allele specific markers. Plant Science 178, 523–530.&amp;lt;/ref&amp;gt;&lt;br /&gt;
* &amp;lt;ref name=&amp;quot;ref2&amp;quot;&amp;gt;Sana TR, Fischer S, Wholgemuth G, Kalrekar A, Jung K, Ronald PC, Fiehn O. 2010. Metabolomic and transcriptomic analysis of the rice response to the bacterial blight pathogen Xanthomonas oryzae pv. oryzae. Metabolomics 6, 451–465. &amp;lt;/ref&amp;gt;&lt;br /&gt;
* &amp;lt;ref name=&amp;quot;ref3&amp;quot;&amp;gt;Kim S, Ahn IP, Park CH, Park SG, Park SY, Jwa NS, Lee YH. 2001. Molecular characterization of the cDNA encoding an acidic isoform of PR-1 protein in rice. Molecular Cells 11, 115–121. &amp;lt;/ref&amp;gt;&lt;br /&gt;
* &amp;lt;ref name=&amp;quot;ref4&amp;quot;&amp;gt;Sharma TR, Shanker P, Singh BK, Jana TK, Madhav MS, Gaikwad K, Singh NK, Plaha P, Rathour R. 2005a. Molecular&lt;br /&gt;
mapping of rice blast resistance gene Pi-kh in rice variety Tetep. Journal of Plant Biochemistry and Biotechnology 14, 127–133. &amp;lt;/ref&amp;gt;&lt;br /&gt;
* &amp;lt;ref name=&amp;quot;ref5&amp;quot;&amp;gt;Santosh Kumar Gupta;Amit Kumar Rai;Shamsher Singh Kanwar;Duni Chand;Nagendera Kumar Singh;Tilak Raj Sharma. The single functional blast resistance gene Pi54 activates a complex defence mechanism in rice, Journal of Experimental Botany, 2012, 63(2): 757-772&amp;lt;/ref&amp;gt;&lt;br /&gt;
* &amp;lt;ref name=&amp;quot;ref6&amp;quot;&amp;gt;Amit Kumar Rai;Satya Pal Kumar;Santosh Kumar Gupta;Naveen Gautam;Nagendera Kumar Singh;Tilak Raj Sharma. Functional complementation of rice blast resistance gene Pi-kh(Pi54) conferring resistance to diverse strains of Magnaporthe oryzae, Journal of Plant Biochemistry and Biotechnology, 2011, 20(1): 55-65&amp;lt;/ref&amp;gt;&lt;br /&gt;
* &amp;lt;ref name=&amp;quot;ref7&amp;quot;&amp;gt;Alok Das;D. Soubam;P. K. Singh;S. Thakur;N. K. Singh;T. R. Sharma. A novel blast resistance gene, Pi54rh cloned from wild species of rice, Oryza rhizomatis confers broad spectrum resistance to Magnaporthe oryzae, Functional &amp;amp; Integrative Genomics, 2012, 12(2): 215-228&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;/references&amp;gt;&lt;br /&gt;
&lt;br /&gt;
[[Category:Genes]]&lt;br /&gt;
[[Category:Japonica mRNA]]&lt;br /&gt;
[[Category:Oryza Sativa Japonica Group]]&lt;br /&gt;
[[Category:Japonica Genes]]&lt;br /&gt;
[[Category:Japonica Chromosome 11]]&lt;br /&gt;
[[Category:Chromosome 11]]&lt;/div&gt;</summary>
		<author><name>Lmw2015</name></author>	</entry>

	<entry>
		<id>https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os11g0582500&amp;diff=248915</id>
		<title>Os11g0582500</title>
		<link rel="alternate" type="text/html" href="https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os11g0582500&amp;diff=248915"/>
				<updated>2015-06-12T04:27:57Z</updated>
		
		<summary type="html">&lt;p&gt;Lmw2015: /* Structured Information */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;Please input one-sentence summary here.&lt;br /&gt;
&lt;br /&gt;
==Annotated Information==&lt;br /&gt;
===Function===&lt;br /&gt;
The role of a tapetum-specific gene,OsC6, in the formation of pollen exine and orbicules.OsC6 belongs to a unique LTP clade and is regulated by two anther developmental regulators, TDR and GAMYB. The OsC6 protein is secreted into extracellular spaces of the anther, including anther cuticle, anther locule, and the space between the tapetum and middle layer.&lt;br /&gt;
&lt;br /&gt;
===Expression===&lt;br /&gt;
OsC6 expression was detectable in anthers starting from early stage 9 of development, high at stage 10, weak at stage 11, and hardly detectable at stage 13 and was not detectable in root, shoot, leaf, and other floral organs. Expression of OsC6 was down-regulated in tdr,which is able to bind to the E-box (5#-CATTTG-3#;2881 to2712bp) within the promoter region of OsC6 (Li et al., 2006).&lt;br /&gt;
&lt;br /&gt;
===Evolution===&lt;br /&gt;
Totally, 82 LTP genes from Arabidopsis, rice, Zea mays, Triticum aestivum, Sorghum bicolor, Vitis vinifera, and Ricinus communis were obtained (Supplemental Table S1). In addition, reported members of the LTP1 subfamily, including OsLTP1(Cheng et al., 2004), AtLTP1 (Thoma et al., 1994), and AtLTP2 (Clark and Bohnert, 1999), the LTP2 subfamily, including OsLTP2 (Samuel et al., 2002) and TaLTP2 (Douliez et al., 2001), as well as another new subfamily member, AtDIR1 (for defective in induced resistance 1; Maldonado et al., 2002), were used for analysis. The phylogenetic tree of these genes was constructed using the characteristic eight-Cys&lt;br /&gt;
motif of plant LTPs (C…C…CC…CXC…C…C, where X represents any amino acid) as described by Boutrot et al. (2008; Supplemental Fig. S1). The phylogenetic tree showed that OsC6 was not classified into the LTP1 or LTP2 subfamily, and OsC6 and TAAK330179 (from T. aestivum) were closely grouped with relatively strong support (Fig. 1C, gray clade). A gene from S. bicolor (SBXM002446579) and two genes (AC206507.3FGP004 and GRMZM2G414620) from Z. mays were grouped in the OsC6 clade with relatively lower support (Fig. 1C). Nevertheless, no LTP members from dicots were found to be close to the OsC6 clade, implying that OsC6 likely represents a diversified LTP in monocots.&lt;br /&gt;
&lt;br /&gt;
==Labs working on this gene==&lt;br /&gt;
School of Life Science and Biotechnology (Das.Z., W.L., C.Y., J.Z., F.G., Dab.Z.) and Bio-X Research Center,&lt;br /&gt;
Key Laboratory of Genetics and Development and Neuropsychiatric Diseases, Ministry of Education (Dab.Z.),&lt;br /&gt;
Shanghai Jiao Tong University, Shanghai 200240, China&lt;br /&gt;
&lt;br /&gt;
==References==&lt;br /&gt;
Dasheng Zhang;Wanqi Liang;Changsong Yin;Jie Zong;Fangwei Gu;Dabing Zhang&lt;br /&gt;
OsC6, Encoding a Lipid Transfer Protein, Is Required for Postmeiotic Anther Development In Rice&lt;br /&gt;
Plant Physiology, 2010, 154(1): 149-162&lt;br /&gt;
&lt;br /&gt;
[[Category:Genes]]&lt;br /&gt;
[[Category:Japonica mRNA]]&lt;br /&gt;
[[Category:Oryza Sativa Japonica Group]]&lt;br /&gt;
[[Category:Japonica Genes]]&lt;br /&gt;
[[Category:Japonica Chromosome 11]]&lt;br /&gt;
[[Category:Chromosome 11]]&lt;/div&gt;</summary>
		<author><name>Lmw2015</name></author>	</entry>

	<entry>
		<id>https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os11g0559200&amp;diff=248914</id>
		<title>Os11g0559200</title>
		<link rel="alternate" type="text/html" href="https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os11g0559200&amp;diff=248914"/>
				<updated>2015-06-12T04:27:38Z</updated>
		
		<summary type="html">&lt;p&gt;Lmw2015: /* Structured Information */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;The rice ''Os11g0559200'' was recongized as '''''OsXa21''''' in 1990s. However, the related research of this gene can date back to the year 1977, when Indian Plant Pathologist Dr. S. Devadath found a strain of ''Oryza barthii'' from Manila is resistant to all the races of bacterial blight&amp;lt;ref name=&amp;quot;ref1&amp;quot; /&amp;gt;. &lt;br /&gt;
&lt;br /&gt;
==Annotated Information==&lt;br /&gt;
[[File:Xa21-1.jpg|right|thumb|350px|'''Figure 1.''' ''Graphical representation of the chromosome of Xanthomonas oryzae pv. oryzae(from reference&amp;lt;ref name=&amp;quot;ref7&amp;quot; /&amp;gt;).'']]&lt;br /&gt;
===Function===&lt;br /&gt;
[http://en.wikipedia.org/wiki/Bacterial_blight_(barley) Bacterial blight] is the most destructive bacterial disease of rice distributed all over the world, especiallyin Asia and Africa. '''''OsXa21''''' is the first disease resistance gene cloned from rice, which encodes a receptor-like kinase and confers broad spectrum resistance against Xanthomonas oryzae pv. oryzae ( Xoo ). As a member of pattern recognition receptors (PRRs), '''''OsXa21''''' plays an imortant role in pathogen-associated molecular patterns (PAMPs). It is a resistance gene in plants which is critical to the activation of innate immune response.&lt;br /&gt;
* Xa21 encodes a receptor-like kinase, which has 3 parts: a receptor-like kinase (RLK) with leucine-rich repeats (LRR) in the presumed extracellular domain, a transmembrane domain and a serine–threonine protein kinase domain&amp;lt;ref name=&amp;quot;ref2&amp;quot; /&amp;gt;, the last two part are the most important, because they have correlation with the resistance of Xa21. And this disease resistance gene is a member of a multigene family which has seven family members. Xa21D, an Xa21 gene family member, encodes a predicted protein consisting of a signal peptide and a LRR domain, which is highly similar to the LRR domain of XA21. RLKs play important roles in many biological processes, including development and growth, in both animals and plants&amp;lt;ref name=&amp;quot;ref3&amp;quot; /&amp;gt;. In the Xa21 gene family, LRRs of different members may have evolved to recognize different pathovars and may confer altered resistance phenotypes.&lt;br /&gt;
*In 1992, Ronald located Xa21 on chromosome11&amp;lt;ref name=&amp;quot;ref4&amp;quot; /&amp;gt;. Based on the frequency with which they discovered polymorphic Xa21-1inked markers, they estimate the size of the introgressed region containing Xa21 to be approximately 800 kb&amp;lt;ref name=&amp;quot;ref5&amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
'''GO assignment(s):''' [http://amigo.geneontology.org/amigo/term/GO:0004672 GO:0004672], [http://amigo.geneontology.org/amigo/term/GO:0004674 GO:0004674], [http://amigo.geneontology.org/amigo/term/GO:0005524 GO:0005524], [http://amigo.geneontology.org/amigo/term/GO:0006468 GO:0006468]&lt;br /&gt;
&lt;br /&gt;
===Expression===&lt;br /&gt;
* The expression analysis made by ''Chang-Jin Park1'' et al. in 2010 showed that ''Xoo'' infection could induce the expression of ''OsXa21'', then regulates XA21-mediated immune response (Figure 2). They further found that the constitutive expression of ''OsXa21'' could enhance resistance to Xoo and the overexpression of ''OsXa21'' up-regulate a new set of defense-related genes&amp;lt;ref name=&amp;quot;ref8&amp;quot; /&amp;gt;. &amp;lt;br&amp;gt;&lt;br /&gt;
[[File:Xa21-2.jpg|right|thumb|350px|'''Figure 2.''' ''The expression pattern of OsXa21 after infected by Xoo(from reference&amp;lt;ref name=&amp;quot;ref8&amp;quot; /&amp;gt;).'']]&lt;br /&gt;
* Thus, they conclude that altering the regulation of ''OsXa21'' could be used for enhancing resistance to ''Xoo'' at multiple developmental stages&amp;lt;ref name=&amp;quot;ref8&amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
===Evolution===&lt;br /&gt;
*Synteny and phylogenetic analysis showed that frequent gene translocation, duplication and/or loss, have occurred at Xa21 homologous loci, suggesting that they have undergone or are undergoing rapid generation of copy number variations. Many researchers have domenstated that during the evolution of the Xa21 gene family, it’s common to find gene duplication and diversification and they think these processes may associated with the creation of novel resistance phenotypes&amp;lt;ref name=&amp;quot;ref3&amp;quot; /&amp;gt;.&lt;br /&gt;
*The study by Yang J et al. showed that Xa21 gene in different generation and genetic background could be stably inherited and presented sustained resistance to RBB and no re-sistance decline or loss were found in successive planting for 16 generations&amp;lt;ref name=&amp;quot;ref6&amp;quot; /&amp;gt;.&lt;br /&gt;
===Conserved Domains===&lt;br /&gt;
[[File:Xa21-3.png|center|thumb|727px|'''Figure 3.''' ''Structure of OsXa21 (from NCBI BLASTP).'']]&lt;br /&gt;
&lt;br /&gt;
==Labs working on this gene==&lt;br /&gt;
* Department of Plant Pathology and the Genome Center, University of California Davis, Davis, California 95616, USA. &lt;br /&gt;
* Center for Engineering Plants for Resistance against Pathogens, University of California, Davis, California 9561 6&lt;br /&gt;
* Department of Plant Molecular Systems Biotechnology, Crop Biotech Institute, Kyung Hee University, Yongin 446-701, Korea.&lt;br /&gt;
* Department of Molecular Microbiology, School of Medicine, Washington University, St. Louis, MO 63110, USA.&lt;br /&gt;
* State Key Laboratory of Pharmaceutical Biotechnology, School of Life Sciences, Nanjing University, Nanjing 210093, China&lt;br /&gt;
* Genetic Diversity Department, National Institute of Agrobiological Sciences (Tsukuba, Ibaraki 305–8602, Japan)&lt;br /&gt;
* Graduate School of Biotechnology &amp;amp; Crop Biotech Institute, Kyung Hee University, Yongin 446-701, South Korea&lt;br /&gt;
&lt;br /&gt;
==References==&lt;br /&gt;
&amp;lt;references&amp;gt;&lt;br /&gt;
* &amp;lt;ref name=&amp;quot;ref1&amp;quot;&amp;gt;&lt;br /&gt;
KHUSH G S, BACALANGCO E, Ogawa T. 18. A New Gene for Resistance to Bacterial Blight from O. longistaminata. Rice Genet Newslett 1990, 7: 121 ~ 122.&lt;br /&gt;
&amp;lt;/ref&amp;gt;&lt;br /&gt;
* &amp;lt;ref name=&amp;quot;ref2&amp;quot;&amp;gt;&lt;br /&gt;
Ronald P C, Albano B, Tabien R, et al. Genetic and physical analysis of the rice bacterial blight disease resistance locus, Xa21[J]. Molecular and General Genetics MGG, 1992, 236(1): 113-120.&lt;br /&gt;
&amp;lt;/ref&amp;gt;&lt;br /&gt;
* &amp;lt;ref name=&amp;quot;ref3&amp;quot;&amp;gt;&lt;br /&gt;
Tan S, Wang D, Ding J, et al. Adaptive evolution of Xa21 homologs in Gramineae[J]. Genetica, 2011, 139(11-12): 1465-1475.&lt;br /&gt;
&amp;lt;/ref&amp;gt;&lt;br /&gt;
* &amp;lt;ref name=&amp;quot;ref4&amp;quot;&amp;gt;&lt;br /&gt;
Song W Y, Wang G L, Chen L L, et al. A receptor kinase-like protein encoded by the rice disease resistance gene, Xa21[J]. Science, 1995, 270(5243): 1804-1806.&lt;br /&gt;
&amp;lt;/ref&amp;gt;&lt;br /&gt;
* &amp;lt;ref name=&amp;quot;ref5&amp;quot;&amp;gt;&lt;br /&gt;
Andaya C B, Ronald P C. A catalytically impaired mutant of the rice Xa21 receptor kinase confers partial resistance to Xanthomonas oryzae pv oryzae[J]. Physiological and molecular plant pathology, 2003, 62(4): 203-208.&lt;br /&gt;
&amp;lt;/ref&amp;gt;&lt;br /&gt;
* &amp;lt;ref name=&amp;quot;ref6&amp;quot;&amp;gt;&lt;br /&gt;
Yang J, Ni D, Wu J. Breeding and food safety evaluation of transgenic hybrid rice harboring Xa21 gene[J]. Molecular Plant Breeding, 2006, 14.&lt;br /&gt;
&amp;lt;/ref&amp;gt;&lt;br /&gt;
* &amp;lt;ref name=&amp;quot;ref7&amp;quot;&amp;gt;&lt;br /&gt;
Ochiai H, Inoue Y, Takeya M, et al. Genome sequence of Xanthomonas oryzae pv. oryzae suggests contribution of large numbers of effector genes and insertion sequences to its race diversity[J]. Japan Agricultural Research Quarterly, 2005, 39(4): 275.&lt;br /&gt;
&amp;lt;/ref&amp;gt;&lt;br /&gt;
* &amp;lt;ref name=&amp;quot;ref8&amp;quot;&amp;gt;&lt;br /&gt;
Ronald P C, Albano B, Tabien R, et al. Genetic and physical analysis of the rice bacterial blight disease resistance locus, Xa21[J]. Molecular and General Genetics MGG, 1992, 236(1): 113-120.&lt;br /&gt;
&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;/references&amp;gt;&lt;br /&gt;
&lt;br /&gt;
[[Category:Genes]]&lt;br /&gt;
[[Category:Japonica mRNA]]&lt;br /&gt;
[[Category:Oryza Sativa Japonica Group]]&lt;br /&gt;
[[Category:Japonica Genes]]&lt;br /&gt;
[[Category:Japonica Chromosome 11]]&lt;br /&gt;
[[Category:Chromosome 11]]&lt;/div&gt;</summary>
		<author><name>Lmw2015</name></author>	</entry>

	<entry>
		<id>https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os11g0549635&amp;diff=248913</id>
		<title>Os11g0549635</title>
		<link rel="alternate" type="text/html" href="https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os11g0549635&amp;diff=248913"/>
				<updated>2015-06-12T04:27:19Z</updated>
		
		<summary type="html">&lt;p&gt;Lmw2015: /* Structured Information */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;Please input one-sentence summary here.&lt;br /&gt;
&lt;br /&gt;
==Annotated Information==&lt;br /&gt;
''OsABC1-14'' contains 17 extrons, locates in chromosome 11, and encodes a 430-amino-acid protein.&lt;br /&gt;
===Function===&lt;br /&gt;
Members of the activity of bc1 complex (ABC1) family are widely existed in prokaryotes and eukaryotes as protein kinases. These protein kinase members were initially isolated from Saccharomyces cerevisiae and were responsible to suppress a defect in mRNA translation of cytochrome b and maintain the activity of the bc1 complex in the mitochondrial respiratory chain &amp;lt;ref name=&amp;quot;ref1&amp;quot; /&amp;gt;. Mitochondrial and chloroplast ABC1 proteins is associated in respiratory electron transport system and as a lipid-soluble antioxidant in ''yeast'', ''Escherichia col'', and human &amp;lt;ref name=&amp;quot;ref2&amp;quot; /&amp;gt;&amp;lt;ref name=&amp;quot;ref3&amp;quot; /&amp;gt;.&lt;br /&gt;
There are 15 non-redundant ABC1genes distributed on all rice chromosomes randomly except chromosomes 3, 8, 10, and 12 in rice, and were named from OsABC1-1 to OsABC1-15 according to their chromosomal location (table 1). However, there are 17 members of ABC1 family in ''Arabidopsis''. All of these genes contain introns and the number of intron varies greatly, and intron gain was an important event accompanying the recent evolution of the rice ABC1 family &amp;lt;ref name=&amp;quot;ref4&amp;quot; /&amp;gt;.&lt;br /&gt;
[[File:abc1-table.jpg|middle|thumb|530px|'''Table.1'' Basic information of the rice ABC1 genes.(from reference) &amp;lt;ref name=&amp;quot;ref4&amp;quot; /&amp;gt;.]]&lt;br /&gt;
ABC1 domain is an important part of the ABC1 proteins, and aligned results show that the domains of all proteins were from 102–126 amino acids, except the OsABC1-14 and OsABC1-15 proteins. The length of the domain in OsABC1-14 and OsABC1-15 is 92 amino acids and 184 amino acids, respectively &amp;lt;ref name=&amp;quot;ref4&amp;quot; /&amp;gt;. The XaXasX2QV segment that functions as a nucleotide-binding motif for protein kinases is highly conserved in ABC1 domain as well as lysine residue in N-terminal that as a binding site for chemical groups. In addition, other conserved amino acid valine and aspartate acid in the middle of the domain and glutamate acid in the C-terminal. It is also suggested that there are 10 putative motifs in rice ABC1 proteins. &lt;br /&gt;
The real-time PCR results show that 14 genes express mainly in leaves. The subcellular localization is predicted that OsABC1-1 and OsABC1-8 were localized in the cytoplasm, OsABC1-3 and OsABC1-6 in the plasma membrane, OsABC1-10 in mitochondria, OsABC1-14 in vacuoles and the others in chloroplasts &amp;lt;ref name=&amp;quot;ref4&amp;quot; /&amp;gt;.&lt;br /&gt;
Members of this family participate in the extensive abiotic stress response and may play roles in the tolerance of plants to adverse environments. Furthermore, some of the rice ABC1 genes may be involved in the oxidative stress response and ABA signaling&amp;lt;ref name=&amp;quot;ref4&amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
===Expression===&lt;br /&gt;
Please input expression information here.&lt;br /&gt;
&lt;br /&gt;
===Evolution===&lt;br /&gt;
Please input evolution information here.&lt;br /&gt;
&lt;br /&gt;
You can also add sub-section(s) at will.&lt;br /&gt;
&lt;br /&gt;
==Labs working on this gene==&lt;br /&gt;
*Jiangsu Provincial Key Laboratory of Crop Genetics and Physiology&lt;br /&gt;
*Key Laboratory of Plant Functional Genomics of the Ministry of Education, Yangzhou University, China&lt;br /&gt;
&lt;br /&gt;
==References==&lt;br /&gt;
&amp;lt;references&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref1&amp;quot;&amp;gt; Bousquet I, Dujardin G, Slonimski P P. 1991. ABC1, a novel yeast nuclear gene has a dual function in mitochondria: It suppresses a cytochrome b mRNA translation defect and is essential for the electron transfer in the bc 1 complex. EMBO J, 10(8): 2023–2031.&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref2&amp;quot;&amp;gt; Villalba J M, Navas P. 2000. Plasma membrane redox system in the control of stress-induced apoptosis. Antioxid Redox Signal, 2(2): 213–230.&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref3&amp;quot;&amp;gt; Ernster L, Forsmark-Andree P. 1993. Ubiquinol: an endogenous antioxidant in aerobic organisms. Clin Investig, 71(8 Suppl): S60–S65.&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref4&amp;quot;&amp;gt;GAOQing-song, ZHANGDan, XULiang, XUChen-wu. Systematic Identification of Rice ABC1Gene Family and Its Response to Abiotic Stress. Rice Science, 2011, 18(2).&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;/references&amp;gt;&lt;br /&gt;
&lt;br /&gt;
[[Category:Genes]]&lt;br /&gt;
[[Category:Japonica mRNA]]&lt;br /&gt;
[[Category:Oryza Sativa Japonica Group]]&lt;br /&gt;
[[Category:Japonica Genes]]&lt;br /&gt;
[[Category:Japonica Chromosome 11]]&lt;br /&gt;
[[Category:Chromosome 11]]&lt;/div&gt;</summary>
		<author><name>Lmw2015</name></author>	</entry>

	<entry>
		<id>https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os11g0523800&amp;diff=248912</id>
		<title>Os11g0523800</title>
		<link rel="alternate" type="text/html" href="https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os11g0523800&amp;diff=248912"/>
				<updated>2015-06-12T04:27:01Z</updated>
		
		<summary type="html">&lt;p&gt;Lmw2015: /* Structured Information */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;The rice ''Os11g0523800'' was reported as '''''OsARF1''''' in 2002 and 2008 by researchers from Japan and Egypt respectively&amp;lt;ref name=&amp;quot;ref1&amp;quot; /&amp;gt;&amp;lt;ref name=&amp;quot;ref2&amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
==Annotated Information==&lt;br /&gt;
[[File:OsARF1.jpg|right|thumb|280px|'''Figure 1.''' ''Mutant VS. WT(from reference) &amp;lt;ref name=&amp;quot;ref2&amp;quot; /&amp;gt;.'']]&lt;br /&gt;
[[File:OsARF2.jpg|right|thumb|280px|'''Figure 2.''' ''Transcript abundance of OsARF1 in wild type rice from &amp;lt;ref name=&amp;quot;ref2&amp;quot; /&amp;gt;.'']]&lt;br /&gt;
[[File:OsARF3.jpg|right|thumb|280px|'''Figure 3.''' Auxin concentration dependence of ''OsARF1'' expression.&amp;lt;ref name=&amp;quot;ref1&amp;quot; /&amp;gt;.'']]&lt;br /&gt;
===Function===&lt;br /&gt;
'''''OsARF1''''' is the first full-length member of auxin response factor (ARF) gene family to be cloned from monocot plant&amp;lt;ref name=&amp;quot;ref1&amp;quot; /&amp;gt;. It was shown to be essential for developmental growth stages of the life cycle of rice. The knock down of '''''OsARF1''''' turned off some key switches for transformation from vegetative stage to the reproductive stage&amp;lt;ref name=&amp;quot;ref2&amp;quot; /&amp;gt;. As an early response gene in auxin signaling, '''''OsARF1''''' could be associated with embryogenesis and may play a key role in fertility and regulate quite a few downstream genes associated with growth and reproduction&amp;lt;ref name=&amp;quot;ref1&amp;quot; /&amp;gt;&amp;lt;ref name=&amp;quot;ref2&amp;quot; /&amp;gt;. Further elucidation of the downstream targets of '''''Os-ARF1''''' will help to understand the regulation of plant growth by auxin-mediated gene expression&amp;lt;ref name=&amp;quot;ref2&amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
'''GO assignment(s):''' [http://amigo.geneontology.org/amigo/term/GO:0003677 GO:0003677], [http://amigo.geneontology.org/amigo/term/GO:0005634 GO:0005634], [http://amigo.geneontology.org/amigo/term/GO:0006445 GO:0006445], [http://amigo.geneontology.org/amigo/term/GO:0009725 GO:0009725], [http://amigo.geneontology.org/amigo/term/GO:0045449 GO:0045449], [http://amigo.geneontology.org/amigo/term/GO:0046983 GO:0046983]&lt;br /&gt;
&lt;br /&gt;
===Wild Type VS. Mutant===&lt;br /&gt;
An antisense '''''OsARF1''''' recombinant plasmid was transformed into rice embryogenic calli through Agrobacterium-mediated transformation by ''Attia et al'' and they found that the growth of transgenic rice was inhibited&amp;lt;ref name=&amp;quot;ref2&amp;quot; /&amp;gt;.&lt;br /&gt;
* The '''''AS-OsARF1''''' transformed plants showed significantly lower growth and vigor that included smaller leaves and shorter heights, compared to nontransformed plants. Interestingly, the length of the tillering node didn’t change significantly in transgenic plants (Figure 1). Also, the leaves curled across the width&amp;lt;ref name=&amp;quot;ref2&amp;quot; /&amp;gt;. &amp;lt;br&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
* Eight of 11 transgenic plants failed to head and the remaining three were sterile, although they were able to develop to the heading stage 13–15 days later than the non-transformed plants. Hence, no F2 progeny was obtained&amp;lt;ref name=&amp;quot;ref2&amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
===Expression===&lt;br /&gt;
* RT-PCR Analyses by ''Attia et al.'' showed that '''''OsARF1''''' was transcript accumulated in callus and young panicle at much higher amount than in leaf and root(Figure 2). This indicates that '''''OsARF1''''' may be associated with embryogenesis, because of the higher transcript abundance in young panicles and calli, which both are embryonic tissues&amp;lt;ref name=&amp;quot;ref2&amp;quot; /&amp;gt;.(1.embryogenic callus; 2. differentiating callus; 3. young panicles; 4. leaves;5. roots. Lower lanes: Actin mRNAas a control.)&amp;lt;br&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
* The study by ''Frank Waller et al.'' showed that '''''OsARF1''''' mRNA levels are rapidly induced by auxin&amp;lt;ref name=&amp;quot;ref1&amp;quot; /&amp;gt;. They extracted total RNA from coleoptile segments which had been incubated in different auxin concentrations after depletion of internal auxin. Then they measured the abundance of '''''OsARF1''''' mRNA in northern blot experiments and found that the highest level of '''''OsARF1 '''''transcript was detected after incubation with either 1 or 3 μM auxin, whereas incubation in 100 μM auxin produced low '''''OsARF1''''' transcript levels&amp;lt;ref name=&amp;quot;ref1&amp;quot; /&amp;gt;. '''''OsARF1''''' mRNA steady-state levels therefore follow an optimum curve with a maximum of between 1 and 3 μM auxin&amp;lt;ref name=&amp;quot;ref1&amp;quot; /&amp;gt;.&amp;lt;br&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
* Microarray analysis of the transgenic plants by ''Attia et al.'' showed that 435 genes were differently expressed, 255 of them were down regulated and 180 were up regulated. The annotated genes were located in 9 sub-categories of molecular functions in gene ontology. Most of the differently expressed genes were categorized among those encoding proteins with catalytic activity&amp;lt;ref name=&amp;quot;ref2&amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
===Localization===&lt;br /&gt;
The study by ''Frank Waller et al.'' showed that '''''OsARF1''''' was localized to the nucleus in vivo&amp;lt;ref name=&amp;quot;ref1&amp;quot; /&amp;gt;.[[File:Example.gif|left|thumb|400px|'''Figure 4.''' '' Analysis of the nuclear localization signal (NLS) in OsARFs&amp;lt;ref name=&amp;quot;ref3&amp;quot; /&amp;gt;.'']]&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
A monopartite NLS in the DBD is responsible for nuclear localization of OsARFs.In OsARFs, the first NLS with a bipartite NLS structure is predicted to be in the middle of DBD, and the second, which resembles the monopartite NLS of simian virus 40, is predicted to be at the end of the DBD(DNA binding domain). The fluorescence of the 35S: OsARF19–sGFP fusion protein was observed only in the nucleus of onion epidermal cells, while the control 35S: sGFP fluorescence was observed throughout the entire cell (Fig. 2A, B, positive and negative control). Proteins fused to a bipartite NLS containing element II were detected throughout transformed cells, not only in the nucleus (Fig. 2A, aII–dII). Elements I, III, V, or VI fused to OsARF–sGFP caused expression throughout the entire cell, similar to 35S:sGFP (Fig. 2A, aI–dI and aIII–dIII; 2B, aV–dV and aVI–dVI). The fluorescence of sGFP fused to a monopartite NLS containing element IV accumulated exclusively in the nucleus (Fig. 2B, aIV–dIV). These data indicate that a monopartite NLS in the DBD had the capacity to direct nuclear localization of OsARF&amp;lt;ref name=&amp;quot;ref3&amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
===Evolution===&lt;br /&gt;
Auxin is one of the two most important plant hormones, and regulates various growth and developmental processes by controlling the expression of auxin-response genes (Ulmasov et al., 1995). Auxin responsiveness is conferred to several genes by conserved promoter elements, termed ‘auxin-responsive elements'(AuxRE) AuxRE promoter elements are bound by a new class of plant-specific transcription factors, named auxin response factors (ARFs) (Ulmasov et al., 1997a). Because of the extremely low expression of genes encoding ARFs, none were isolated until 1997. The first auxin response factor (ARF1) was isolated from Arabidopsis (Ulmasov, et al., 1997a). It was found that all members of the ARF gene family have an amino-terminal DNA-binding domain and most contain a C-terminal region with two conserved domains, which are involved in homo-and hetero-dimerization (Ulmasov et al., 1999). In Arabidopsis, it has been reported that the ARF proteins are encoded by a gene family with 23 members and some of them have been shown to repress or to activate expression of reporter genes with an AuxRE promoter element (Ulmasov et al., 1999a; Remington et al., 2004; Okushima et al., 2005). Recently, the first full-length ARF gene of a monocot plant was cloned from rice (Frank et al., 2002). Several rice ARF family transcriptional regulators were also identified homologous to Arabidopsis ARF1 (Waller et al., 2002). From genome sequences many ARF genes in Arabidopsis and in rice have been isolated (Akila et al., 2004; Wang et al., 2007)&amp;lt;ref name=&amp;quot;ref2&amp;quot; /&amp;gt;.&lt;br /&gt;
===Knowledge Extension===&lt;br /&gt;
[[File:OsARF4.jpg|left|thumb|400px|'''Figure 5.''' ''The modular structure of the OsARF family.(from reference) &amp;lt;ref name=&amp;quot;ref3&amp;quot; /&amp;gt;.'']]&lt;br /&gt;
* Auxin signaling plays a vital role in plant growth and development processes like, in apical dominance, tropic responses, lateral root formation, vascular differentiation, embryo patterning and shoot elongation&amp;lt;ref name=&amp;quot;ref1&amp;quot; /&amp;gt;&amp;lt;ref name=&amp;quot;ref2&amp;quot; /&amp;gt;&amp;lt;ref name=&amp;quot;ref3&amp;quot; /&amp;gt;&amp;lt;ref name=&amp;quot;ref4&amp;quot; /&amp;gt;. The auxin response factor (ARF) and auxin/indole acetic acid (Aux/IAA) protein families are required for transcriptional regulation of auxin response genes, and they are very important in auxin signalling and plant development&amp;lt;ref name=&amp;quot;ref3&amp;quot; /&amp;gt;.&amp;lt;br&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
* An ARF protein contains a DNA-binding domain (DBD) in the N-terminal region, a middle region that functions as an activation domain (AD) or repression domain (RD), and a carboxyl-terminal dimerization domain (CTD) that are similar to those found in the C terminus of Aux/IAAs, which is a protein-protein interaction domain that mediates the homo- and heterodimerization of ARFs and also the hetero-dimerization of ARF and Aux/IAA proteins (Figure 5).&amp;lt;ref name=&amp;quot;ref3&amp;quot; /&amp;gt;&amp;lt;ref name=&amp;quot;ref4&amp;quot; /&amp;gt; &amp;lt;br&amp;gt;&amp;lt;br&amp;gt;&lt;br /&gt;
* The ARF proteins are encoded by a large gene family, with 23, 25 and 31 members in Arabidopsis, Rice and Maize respectively. Genetic divergence between Arabidopsis and rice ARF gene family investigated by genome-wide analysis revealed that most of the rice '''''OsARFs''''' and maize '''''ZmARFs''''' are related to Arabidopsis ARFs and fall into sister pairs as in Arabidopsis&amp;lt;ref name=&amp;quot;ref4&amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
==Labs working on this gene==&lt;br /&gt;
* Institut für Biologie II, Albert-Ludwigs-Universität, Schänzlestrasse 1, 79104 Freiburg&lt;br /&gt;
* Hitachi Advanced Research Laboratory, Hatoyama, Saitama 350-0395&lt;br /&gt;
* Present address: Nara Institute of Science and Technology, 8916-5 Takayama, Ikoma, Nara 630-0101, Japan&lt;br /&gt;
* Rice Biotechnology Lab., Rice Research &amp;amp; Training Center, Sakha, Kafr EL-Sheikh, 33717, Egypt&lt;br /&gt;
* Institute of Genetic Engineering, School of Life Science, Fudan University, Shanghai, 200433, China&lt;br /&gt;
* Plant Biotechnology and Genomics Core-Facility, Department of Plant, Soil, and Agricultural Systems,Southern Illinois University, Carbondale, IL 62901–4415, USA&lt;br /&gt;
* Department of Genetics, Faculty of Agriculture, Alexandria University, Alexandria, Egypt&lt;br /&gt;
* Faculty of Agriculture Research Park (FARP) and Biochemistry Department, Faculty of Agriculture, Cairo University,12613 Giza, Egypt&lt;br /&gt;
&lt;br /&gt;
==References==&lt;br /&gt;
&amp;lt;references&amp;gt;&lt;br /&gt;
* &amp;lt;ref name=&amp;quot;ref1&amp;quot;&amp;gt;&lt;br /&gt;
Waller F, Furuya M, Nick P. OsARF1, an auxin response factor from rice, is auxin-regulated and classifies as a primary auxin responsive gene[J]. Plant molecular biology, 2002, 50(3): 415-425.&lt;br /&gt;
&amp;lt;/ref&amp;gt;&lt;br /&gt;
* &amp;lt;ref name=&amp;quot;ref2&amp;quot;&amp;gt;&lt;br /&gt;
Attia K A, Abdelkhalik A F, Ammar M H, et al. Antisense phenotypes reveal a functional expression of OsARF1, an auxin response factor, in transgenic rice[J]. Current issues in molecular biology, 2009, 11(1): I29.&lt;br /&gt;
&amp;lt;/ref&amp;gt;&lt;br /&gt;
* &amp;lt;ref name=&amp;quot;ref3&amp;quot;&amp;gt;&lt;br /&gt;
Shen C J, Wang S K, Bai Y H, et al. Functional analysis of the structural domain of ARF proteins in rice (Oryza sativa L.)[J]. Journal of experimental botany, 2010, 61(14): 3971-3981.&lt;br /&gt;
&amp;lt;/ref&amp;gt;&lt;br /&gt;
* &amp;lt;ref name=&amp;quot;ref4&amp;quot;&amp;gt;&lt;br /&gt;
Xing H, Pudake R, Guo G, et al. Genome-wide identification and expression profiling of auxin response factor (ARF) gene family in maize[J]. BMC genomics, 2011, 12(1): 178.&lt;br /&gt;
&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;/references&amp;gt;&lt;br /&gt;
&lt;br /&gt;
[[Category:Genes]]&lt;br /&gt;
[[Category:Japonica mRNA]]&lt;br /&gt;
[[Category:Oryza Sativa Japonica Group]]&lt;br /&gt;
[[Category:Japonica Genes]]&lt;br /&gt;
[[Category:Japonica Chromosome 11]]&lt;br /&gt;
[[Category:Chromosome 11]]&lt;/div&gt;</summary>
		<author><name>Lmw2015</name></author>	</entry>

	<entry>
		<id>https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os11g0508600&amp;diff=248911</id>
		<title>Os11g0508600</title>
		<link rel="alternate" type="text/html" href="https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os11g0508600&amp;diff=248911"/>
				<updated>2015-06-12T04:26:32Z</updated>
		
		<summary type="html">&lt;p&gt;Lmw2015: /* Structured Information */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;Please input one-sentence summary here.&lt;br /&gt;
&lt;br /&gt;
==Annotated Information==&lt;br /&gt;
===Function===&lt;br /&gt;
Os-11N3 is represented in databases by a 1494-base full-length cDNA (National Center for Biotechnology Information accession number AK101913), has four introns, and a predicted coding frame of 909 bp (Figure 2B). BLAST analysis was performed with the predicted protein product of Os11N3 (Os-11N3), and 18 of the most similar proteins from monocotyledonous species and three sequences of the most similar proteins from representative dicotyledonous species were subjected to phylogenetic analysis(Figure 3). While closely related to Os-8N3, Os-11N3 is a member of a distinct clade of N3 proteins (clade II) that are separated from the Os-8N3 clade (clade I) prior to the divergence of dicots and monocots as some members from Arabidopsis thaliana (At5g23660), pepper (Capsicum annuum; CaUPA16), and soybean (Glycine max; GmABT17358) are more similar to Os-11N3 (Figure 3). Os-11N3 is more closely related to another clade represented by the rice N3 gene Os12g0476200. The separation of Os-11N3 from Os12g0476200 occurred prior to the divergence of rice, sorghum (Sorghum bicolor), and maize (Zea mays;Figure 3). The separation of Os-S11N3 from the other members within rice indicates a possible specialization of this protein in plant development or environmental responses.&lt;br /&gt;
&lt;br /&gt;
===Expression===&lt;br /&gt;
Loss or Suppression ofOs-11N3 Expression Results in Loss of TAL Effector-Specific Susceptibility in Rice.The T-DNA insertion event PFG_3D-03008 was previously reported to have occurred within the first intron of Os-11N3 in rice cultivar Hwayoung (Jeong et al., 2006).The requirement for Os-11N3 in AvrXa7- and PthXo3-mediated virulence was also assessed by RNA-mediated gene silencing (RNAi). Transgenic rice plants were generated that expressed a unique 341-base portion of the 39-UTR of Os-11N3 as a small double-stranded RNA to initiate silencing of the full transcript.&lt;br /&gt;
&lt;br /&gt;
===Evolution===&lt;br /&gt;
Variations in the TAL effector repetitive domains are driven by selection to overcome both dominant and recessive forms of resistance to bacterial blight in rice. The finding that Os-8N3 and Os-11N3 encode closely related proteins also provides evidence that N3 proteins have a specific function in facilitating bacterial blight disease.&lt;br /&gt;
&lt;br /&gt;
==Labs working on this gene==&lt;br /&gt;
a Department of Plant Pathology, Kansas State University, Manhattan, Kansas 66506&lt;br /&gt;
b Department of Genetics, Development, and Cell Biology, Iowa State University, Ames, Iowa 50011&lt;br /&gt;
&lt;br /&gt;
==References==&lt;br /&gt;
Ginny Antony;Junhui Zhou;Sheng Huang;Ting Lib;Bo Liu;Frank White;Bing Yang&lt;br /&gt;
Rice xa13 Recessive Resistance to Bacterial Blight Is Defeated by Induction of the Disease Susceptibility Gene Os-11N3&lt;br /&gt;
The Plant Cell, 2010, 22(11): 3864-3876&lt;br /&gt;
&lt;br /&gt;
[[Category:Genes]]&lt;br /&gt;
[[Category:Japonica mRNA]]&lt;br /&gt;
[[Category:Oryza Sativa Japonica Group]]&lt;br /&gt;
[[Category:Japonica Genes]]&lt;br /&gt;
[[Category:Japonica Chromosome 11]]&lt;br /&gt;
[[Category:Chromosome 11]]&lt;/div&gt;</summary>
		<author><name>Lmw2015</name></author>	</entry>

	<entry>
		<id>https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os11g0490600&amp;diff=248910</id>
		<title>Os11g0490600</title>
		<link rel="alternate" type="text/html" href="https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os11g0490600&amp;diff=248910"/>
				<updated>2015-06-12T04:26:11Z</updated>
		
		<summary type="html">&lt;p&gt;Lmw2015: /* Structured Information */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;Please input one-sentence summary here.&lt;br /&gt;
&lt;br /&gt;
==Annotated Information==&lt;br /&gt;
===Function===&lt;br /&gt;
LAZY1 (LA1) gene regulates shoot gravitropism by which the rice tiller angle is controlled. LA1, a novel grass-specific gene, is temporally and spatially expressed, and plays a negative role in polar auxin transport (PAT). Loss-of-function of LA1 enhances PAT greatly and thus alters the endogenous IAA distribution in shoots, leading to thereduced gravitropism, and therefore the tiller-spreading phenotype of rice plants.&lt;br /&gt;
LA1 is an essential regulator of tiller angle of rice, opening a promising way for&lt;br /&gt;
breeders to develop elite rice cultivars and other cereal crops with optimal plant architecture.&lt;br /&gt;
LA1ΔN100 is the truncated LA1 with a deletion of amino-acid residues1-100 that&lt;br /&gt;
contain a predicted transmembrane domain. LA1ΔNLS refers to the LA1 truncated from amino-acid residues 286 to 312, a segment containing a putative nuclear localization signal (NLS) domain. The 996-1571 bp region of the LA1 gene was subcloned into the T-easy vector and used as templates to generate sense and antisense RNA probes.&lt;br /&gt;
Rice LA1gene is responsible for the tiller-spreading phenotype of mutant plants.&lt;br /&gt;
&lt;br /&gt;
==  Mutation==&lt;br /&gt;
Mutations were also identified in the la1-Shiokari allele with a prostrate phenotype similar to la1-ZF802.[[File:Zhangshuling1.jpg]]&lt;br /&gt;
Sequence analysis revealed a single base substitute (TGG→TGA) at the second exon of LOC_Os03g03150 in tad1, which produces a premature stop codon. LOC_Os03g03150 is the TAD1 gene and the premature mutation is responsible for the phenotypes of the tad1 mutant plant.[[File:Zhangshuling2.jpg]]&lt;br /&gt;
TAD1 is involved in regulating the exit of mitosis and it is indeed a functional cell-cycle switch protein homolo¬gous to Cdh1.[[File:Zhangshuling3.jpg]]&lt;br /&gt;
Mutation in LA1 results in a significant increase in PAT and thus impairs the IAA differential distribution in la1-ZF802, which ultimately leads to a reduced gravitropic response in the mutant shoots.[[File:Zhangshuling4.jpg]]&lt;br /&gt;
&lt;br /&gt;
== Expression==&lt;br /&gt;
LA1 is a finely regulated temporally and spatially expressed gene, and that the region of its specific expression may play an important role in controlling the rice tiller angle.[[File:Zhangshuling5.jpg]]  [[File:Zhangshuling6.jpg]]  [[File:Zhangshuling7.jpg]]&lt;br /&gt;
&lt;br /&gt;
===Evolution===&lt;br /&gt;
LA1 may represent a new type of regulating proteins that shuttle between the plasma membrane and the nucleus. Further investigations of LA1 functions will allow for a better understanding of the mechanism underlying the monocotyledonous shoot gravitropism.&lt;br /&gt;
&lt;br /&gt;
==Labs working on this gene==&lt;br /&gt;
1、State Key Laboratory of Plant Genomics and National Center for Plant Gene Research, Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, Beijing 100101, China; &lt;br /&gt;
2、State Key Laboratory of Rice Biology, China National Rice Research Institute, Chinese Academy of Agricultural Sciences, Hangzhou 310006, China&lt;br /&gt;
&lt;br /&gt;
==References==&lt;br /&gt;
1. Morita MT, Tasaka M. Gravity sensing and signaling. Curr Opin Plant Biol 2004; 7:712-718.&lt;br /&gt;
2. Perbal G, Driss-Ecole D. Mechanotransduction in gravisensing cells. Trends Plant Sci 2003; 8:498-504.&lt;br /&gt;
3.Fukaki H, Wysocka-Diller J, Kato T, Fujisawa H, Benfey PN Tasaka M. Genetic evidence that the endodermis is essential for shoot gravitropism in Arabidopsis thaliana. Plant J 1998; 14:425-430.&lt;br /&gt;
4. Tsugeki R, Olson ML, Fedoroff NV. Transposon tagging and the study of root development in Arabidopsis. Gravit Space Biol Bull 1998; 11:79-87.&lt;br /&gt;
5. Moore I. Gravitropism: lateral thinking in auxin transport. CurrBiol 2002; 12:452-454.&lt;br /&gt;
6. Kim SK, Chang SC, Lee EJ, et al. Involvement of brassinosteroids in the gravitropic response of primary root of maize. Plant Physiol 2000; 123:997-1004.&lt;br /&gt;
7. Gutjahr C, Riemann M, Muller A, Duchting P, Weiler EW, Nick P. Cholodny-Went revisited: a role for jasmonate in gravitropism of rice coleoptiles. Planta 2005; 222:575-585.&lt;br /&gt;
8. Aloni R, Langhans M, Aloni E, Ullrich CI. Role of cytokinin in the regulation of root gravitropism. Planta 2004; 220:177-182.&lt;br /&gt;
9 Gutjahr C, Riemann M, Muller A, Duchting P, Weiler EW, Nick P. Cholodny-Went revisited: a role for jasmonate in gravitropism of rice coleoptiles. Planta 2005; 222:575-585.&lt;br /&gt;
10 Aloni R, Langhans M, Aloni E, Ullrich CI. Role of cytokinin in the regulation of root gravitropism. Planta 2004; 220:177-182.&lt;br /&gt;
11 Heilmann I, Shin J, Huang J, Perera IY, Davies E. Transient dissociation of polyribosomes and concurrent recruitment of calreticulin and calmodulin transcripts in gravistimulated maize pulvini. Plant Physiol 2001; 127:1193-1203.&lt;br /&gt;
12 Belyavskaya NA. Changes in calcium signalling, gravitropism, and statocyte ultrastructure in pea roots induced by calcium channel blockers. J Gravit Physiol 2004; 11:P209-P210.&lt;br /&gt;
13 Fasano JM, Swanson SJ, Blancaflor EB, Dowd PE, Kao TH, Gilroy S. Changes in root cap pH are required for the gravityresponse of the Arabidopsis root. Plant Cell 2001; 13:907-921.&lt;br /&gt;
14 Monshausen GB, Sievers A. Basipetal propagation of gravityinduced surface pH changes along primary roots of Lepidium sativum L. Planta 2002; 215:980-988.&lt;br /&gt;
15 Perera IY, Heilmann I, Chang SC, Boss WF, Kaufman PB. A role for inositol 1,4,5-trisphosphate in gravitropic signaling and the retention of cold-perceived gravistimulation of ooat shoot pulvini. Plant Physiol 2001; 125:1499-1507.&lt;br /&gt;
16 Perera IY, Hung CY, Brady S, Muday GK, Boss WF. A universal role for inositol 1,4,5-trisphosphate-mediated signaling in plant gravitropism. Plant Physiol 2006; 140:746-760.&lt;br /&gt;
17 Guan C, Rosen ES, Boonsirichai K, Poff KL, Masson PH. The ARG1-LIKE2 gene of Arabidopsis functions in a gravity signal transduction pathway that is genetically distinct from the PGM pathway. Plant Physiol 2003; 133:100-112.&lt;br /&gt;
18 Sedbrook JC, Chen R, Masson PH. ARG1 (Altered Response to Gravity) encodes a DnaJ-like protein that potentially interacts with the cytoskeleton. Proc Natl Acad Sci USA 1999; 96:1140-1145.&lt;br /&gt;
19 Went FW, Thimann KV, eds. Phytohormones. New York: Macmillan, 1937.&lt;br /&gt;
20 Richard D, Firn, Wagstaff C, Digby J. The use of mutants to probe models of gravitropism. J Exp Bot 2000; 51:1323-1340.&lt;br /&gt;
21 Sieberer T, Leyser O. Plant science: auxin transport, but in which direction? Science 2006; 312:858-860.&lt;br /&gt;
22 Petrasek J, Mravec J, Bouchard R, et al. PIN proteins perform a rate-limiting function in cellular auxin efflux. Science 2006; 312:914-918.&lt;br /&gt;
23 Okada K, Ueda J, Komaki MK, Bell CJ, Shimura Y. Requirement of the auxin polar transport system in early stages of Arabidopsis floral bud formation. Plant Cell 1991; 3:677-684.&lt;br /&gt;
24 Luschnig C, Gaxiola RA, Grisafi P, Fink GR. EIR1, a root-specific protein involved in auxin transport, is required for gravitropism in Arabidopsis thaliana. Genes Dev 1998; 12:2175-2187.&lt;br /&gt;
25 Galweiler L, Guan C, Muller A, et al. Regulation of polar auxin transport by AtPIN1 in Arabidopsis vascular tissue. Science 1998; 282:2226-2230.&lt;br /&gt;
26 Muller A, Guan C, Galweiler L, et al. AtPIN2 defines a locus of Arabidopsis for root gravitropism control. EMBO J 1998; 17:6903-6911.&lt;br /&gt;
27 Friml J, Wisniewska J, Benkova E, Mendgen K, Palme K. Lateral relocation of auxin efflux regulator PIN3 mediates tropism in Arabidopsis. Nature 2002; 415:806-809.&lt;br /&gt;
28 Benjamins R, Quint A, Weijers D, Hooykaas P, Offringa R. The PINOID protein kinase regulates organ development in Arabidopsis by enhancing polar auxin transport. Development 2001; 128:4057-4067.&lt;br /&gt;
29 Noh B, Bandyopadhyay A, Peer WA, Spalding EP, Murphy ASEnhanced gravi- and phototropism in plant mdr mutants mislocalizing the auxin efflux protein PIN1. Nature 2003; 423:999-1002.&lt;br /&gt;
30 Wisniewska J, Xu J, Seifertova D, et al. Polar PIN localization directs auxin flow in plants. Science 2006; 312:883.&lt;br /&gt;
31 Marchant A, Kargul J, May ST, et al. AUX1 regulates root gravitropism in Arabidopsis by facilitating auxin uptake within root apical tissues. EMBO J 1999; 18:2066-2073.&lt;br /&gt;
32 Yang Y, Hammes UZ, Taylor CG, Schachtman DP, Nielsen E. High-affinity auxin transport by the AUX1 influx carrier protein. Curr Biol 2006; 16:1123-1127.&lt;br /&gt;
33 Terasaka K, Blakeslee JJ, Titapiwatanakun B, et al. PGP4, an ATP binding cassette P-glycoprotein, catalyzes auxin transport in Arabidopsis thaliana roots. Plant Cell 2005; 17:2922-2939.&lt;br /&gt;
34 Overbeek JV. “Lazy”, an a-geotropic form of maize. J Heredity 1936; 27:93-96.&lt;br /&gt;
&lt;br /&gt;
== Supplementary information==&lt;br /&gt;
It is linked to the online version of the paper on the Cell Research website.&lt;br /&gt;
&lt;br /&gt;
[[Category:Genes]]&lt;br /&gt;
[[Category:Japonica mRNA]]&lt;br /&gt;
[[Category:Oryza Sativa Japonica Group]]&lt;br /&gt;
[[Category:Japonica Genes]]&lt;br /&gt;
[[Category:Japonica Chromosome 11]]&lt;br /&gt;
[[Category:Chromosome 11]]&lt;/div&gt;</summary>
		<author><name>Lmw2015</name></author>	</entry>

	<entry>
		<id>https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os11g0454000&amp;diff=248909</id>
		<title>Os11g0454000</title>
		<link rel="alternate" type="text/html" href="https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os11g0454000&amp;diff=248909"/>
				<updated>2015-06-12T04:25:45Z</updated>
		
		<summary type="html">&lt;p&gt;Lmw2015: /* Structured Information */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;The description of the rice '''Os11g0454000'''gene is the  ''rab 16c'' gene. The  ''rab 16c'' is ABA response protein.Therefore, the rice '''Os11g0454000'''gene is a functional gene in response to abiotic stresses, such as drought and salt.&lt;br /&gt;
==Annotated Information==&lt;br /&gt;
===Function===&lt;br /&gt;
Drought and salt are two adverse factors affecting seriously growth, development, and productivity of rice. when subjecting rice to drought and salt as stresses, plants increase ABA sensitivity in rice . The  ''rab 16c'' gene and other functional genes are expression in a high level to response to the stresses.&lt;br /&gt;
The expression of ''rab 16c''is controlled by ABA which appears to mediate important physiological and developmental processes in plants. These include embryo morphogenesis and germination in seeds as well&lt;br /&gt;
as stomatal function and the response of plant tissues to osmotic stress.&lt;br /&gt;
===Expression===&lt;br /&gt;
Its expression is not tissue specific high in ABA-treated seedlings and roots and  responsive to osmotic stress. Its mRNA accumulates to detectable levels in mature embryos.&lt;br /&gt;
&lt;br /&gt;
===Evolution===&lt;br /&gt;
Two types of conserved DNA sequence motifs are found in the promoter regions of the ''rab 16C'' genes . The core of Motif I (PuTACGTGGCPu), reminiscent of the cAMP response element (TGACGTA [5]), appears to be conserved in the promoter regions of several cotton lea genes. The&lt;br /&gt;
core of Motif II (CGG/CCGCGCT), found once in ''rab 16C'', is 80% homologous with the binding site of SP1, an auxilliary transcription factor . These elements may play a role in modulating the transcriptional activation in the rab genes.Another conserved sequence, whose core is found in the promoter regions of ABA-responsive cotton genes, is reminiscent of the cAMP responsive element.&lt;br /&gt;
Ose717 shared a 91% homology with the 140 nucleotide coding sequences of a rice ABA response gene, ''rab16C''. The high degree of homology within the coding region implied that the genes were closely related.&lt;br /&gt;
&lt;br /&gt;
You can also add sub-section(s) at will.&lt;br /&gt;
&lt;br /&gt;
==Labs working on this gene==&lt;br /&gt;
Please input related labs here.&lt;br /&gt;
&lt;br /&gt;
==References==&lt;br /&gt;
[1]Yamaguchi-Shinozaki, K., J. Mundy, and N.H. Chua. Four tightly linked rab genes are differentially expressed in rice. Plant Mol. Biol.(1990) 14: 29_39.&lt;br /&gt;
[2]Peng-Wen Chen1, Li-Wen Fang2, Juey-Wen Lin3, et al.Isolation of cDNA clones for genes that are specifically expressed in the rice embryo.Bot. Bull. Acad. Sin. (1997) 38: 13-20.&lt;br /&gt;
[3]Hao-Wen Li, Bai-Sheng Zang, Xing-Wang Deng,et al.Overexpression of the trehalose-6-phosphate synthase gene OsTPS1 enhances abiotic stress tolerance in rice.Planta (2011) 234:1007–1018.&lt;br /&gt;
[4]NÉLIDA OLAVE-CONCHA1, SIMÓN RUIZ-LARA2, XIMENA MUÑOZ1, et al.Accumulation of dehydrin transcripts and proteins in response to abiotic stresses in Deschampsia antarctica. Antarctic Science (2004)16 (2): 175–184.&lt;br /&gt;
[5]John Mundy, Nam-Hal Chua. Abscisic acid and water-stress induce the expression of a novel rice gene.The EMBO Journal (1988) 7(8): 2279-2286.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
[[Category:Genes]]&lt;br /&gt;
[[Category:Japonica mRNA]]&lt;br /&gt;
[[Category:Oryza Sativa Japonica Group]]&lt;br /&gt;
[[Category:Japonica Genes]]&lt;br /&gt;
[[Category:Japonica Chromosome 11]]&lt;br /&gt;
[[Category:Chromosome 11]]&lt;/div&gt;</summary>
		<author><name>Lmw2015</name></author>	</entry>

	<entry>
		<id>https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os11g0446000&amp;diff=248908</id>
		<title>Os11g0446000</title>
		<link rel="alternate" type="text/html" href="https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os11g0446000&amp;diff=248908"/>
				<updated>2015-06-12T04:25:19Z</updated>
		
		<summary type="html">&lt;p&gt;Lmw2015: /* Structured Information */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;RSS3(rice salt sensitive 3) is a rice nuclear factor,that regulates root cell elongation during adaptation to salinity.&lt;br /&gt;
&lt;br /&gt;
==Annotated Information==&lt;br /&gt;
===Function===&lt;br /&gt;
[[File:Figure2. RSS3 and JAZ9 together Suppress bHLH094-Mediated Gene Activation.jpg|right|thumb|60px|&amp;quot;RSS3 and JAZ9 together Suppress bHLH094-Mediated Gene Activation(from reference &amp;lt;ref name=&amp;quot;ref1&amp;quot; /&amp;gt;.&amp;quot;]]&lt;br /&gt;
RSS3(rice salt sensitive 3), has a regulatory role in root cell elongation. RSS3 interacts not only with JAZs, but also with non-R/B-like bHLH transcription factors and forms an RSS3-JAZ-bHLH ternary complex in the nucleus. Loss of function of RSS3 activates the expression of a subset of JA-induced genes in the root apex and restricts cell elongation but does not primarily affect cell division activity. Under high-salinity conditions, rss3 mutants exhibit severely inhibited root growth, concomitant with root cell swelling&amp;lt;ref name=&amp;quot;ref1&amp;quot; /&amp;gt;.Loss of function of RSS3 only moderately inhibits cell elongation under normal conditions, but it provokes spontaneous root cell swelling, accompanied by severe root growth inhibition, under saline conditions.&lt;br /&gt;
RSS3 and bHLH094 can interact in plant cells.Among more than 150 bHLH factors in rice, bHLH094 belongs to the class-C group. The distinguishing feature of class-C members is the conservation of bHLH sequences and the subsequent C-terminal regions.RSS3 can specifically interact with bHLH094 and bHLH089,but not with bHLH092.bHLH089 is classified in the same minor clade that bHLH094 belongs to.Interestingly, both full-length bHLH094 and bHLH089 lack the N-terminal regulatory domains that are conserved among R/B-like bHLH factors and RSS3. The genes encoding bHLH094 and bHLH089 were expressed in the root tip, so RSS3 acts as a regulatory module for bHLH094 and bHLH089 and thus is directly involved in transcriptional regulation in the root tip.&lt;br /&gt;
As described above, RSS3, but not bHLH094 or bHLH089, contains the regulatory domain conserved among R/B-like bHLH transcription factors. Considering that region II of the regulatory domain is a part of the JAZ interacting domain, so RSS3 is capable of binding to JAZ proteins. &lt;br /&gt;
RSS3 forms a ternary complex with rice bHLH094 and JAZ9,and RSS3 and JAZ together repress bHLH094-mediated transcriptional activation.&lt;br /&gt;
&lt;br /&gt;
===Mutant===&lt;br /&gt;
[[File:Impaired Root Growth of rss3 under Salinity Conditions.jpg|right|thumb|150px|&amp;quot;Impaired Root Growth of rss3 under Salinity Conditions(from reference &amp;lt;ref name=&amp;quot;ref1&amp;quot; /&amp;gt;.&amp;quot;]]&lt;br /&gt;
In the course of a genetic screen of rice to identify loci responsible for salt tolerance, we identified a recessive mutant designated rss3. When grown under high-salinity conditions, rss3 exhibited severely impaired root growth compared with the wild type. Root growth in the absence of salinity stress was also inhibited in rss3, but only moderately. The length of cells in the MTZ of roots of rss3 plants grown under unstressed conditions was markedly shorter than those of the wild type. The inhibition of root growth in rss3 appeared to be primarily due to reduced cell elongation because the size of the EZ, but not of the MZ, was reduced in the mutant, and the number of cells in both the EZ and MZ was not affected in the mutant. The exaggerated inhibition of root growth under salinity conditions also appeared to be mainly due to compromised cell elongation but was accompanied by aberrant cellular arrangement and the formation of oblique cell plates in the MZ, swelling of the cells in the EZ, and a waviness of the root surface at the MTZ. Moreover, rss3 roots show impaired flexibility, in a salinity-dependent manner. When extracted from the medium, the wild-type roots exhibited a paintbrush-like shape, but rss3 roots did not, due to stiffness&amp;lt;ref name=&amp;quot;ref1&amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
===Expression===&lt;br /&gt;
[[File:RSS3 Encodes a Nuclear Protein Homologous to the Regulatory Domains of RB-Like bHLH Proteins.jpg|right|thumb|150px|&amp;quot;RSS3 Encodes a Nuclear Protein Homologous to the Regulatory Domains of RB-Like bHLH Proteins(from reference &amp;lt;ref name=&amp;quot;ref1&amp;quot; /&amp;gt;,&amp;lt;ref name=&amp;quot;ref2&amp;quot; /&amp;gt;]]&lt;br /&gt;
RSS3 Encodes a Nuclear Protein Homologous to the Regulatory Domain of the R/B-Like bHLH Transcription Factors.RSS3 encodes a protein consisting of 458 amino acids. RSS3 contains a region homologous to the postulated regulatory domain conserved among the R/B-like bHLH transcription factors, which contains four conserved regions (I to IV). Region II is predicted to constitute the central sequence of the JAZ interacting domain. However, RSS3 does not contain a bHLH domain or another known DNA binding motif. rss3 contains a 47-bp deletion at the junction between the 6th intron and 7th exon , which results in an altered splicing pattern and the production of a mutated protein that lacks 15 amino acids in region IV and six amino acids in the subsequent C-terminal nonconserved region.&lt;br /&gt;
In seedlings, RSS3 was expressed predominantly in the roots, particularly in the root tip. A truncated form of RSS3 transcript was expressed in the mutant roots, at levels that were apparently higher than those of the nondeleted RSS3 transcript in the wild type. When enhanced green fluorescent protein (EGFP)–tagged RSS3 was expressed under the control of the RSS3 promoter, EGFP signals were detected at high levels in the MZ and at low levels in the EZ of the root tip. The fusion protein was localized almost exclusively in the nuclei of the MZ cells. By contrast, nonfused EGFP expressed under the control of the constitutive actin gene promoter was localized in both nuclei and the cytoplasm of MZ cells. In the EZ region bordering the MZ, RSS3-EGFP was detected in both the nucleus and the cytoplasm&amp;lt;ref name=&amp;quot;ref1&amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
===Evolution===&lt;br /&gt;
Please input evolution information here.&lt;br /&gt;
&lt;br /&gt;
==Labs working on this gene==&lt;br /&gt;
&lt;br /&gt;
*Bioscience and Biotechnology Center, Nagoya University, Chikusa, Nagoya 464-8601, Japan  &lt;br /&gt;
&lt;br /&gt;
*National Institute of Agrobiological Sciences, Kannondai, Tsukuba 305-8602, Japan  &lt;br /&gt;
&lt;br /&gt;
*Bioproduction Research Institute, National Institute of Advanced Industrial Science and Technology, Tsukuba 305-8562, Japan&lt;br /&gt;
&lt;br /&gt;
==References==&lt;br /&gt;
1. Yosuke Toda;Maiko Tanaka;Daisuke Ogawa;Kyo Kurata;Ken-ichi Kurotani;Yoshiki Habu;Tsuyu Ando;Kazuhiko Sugimoto;Nobutaka Mitsuda;Etsuko Katoh;Kiyomi Abe;Akio Miyao;Hirohiko Hirochika;Tsukaho Hattori;Shin Takeda. RICE SALT SENSITIVE3 Forms a Ternary Complex with JAZ and Class-C bHLH Factors and Regulates Jasmonate-Induced Gene Expression and Root Cell Elongation. The Plant Cell, 2013, 25(5): 1709-1725.&lt;br /&gt;
&lt;br /&gt;
2. Godoy M., Franco-Zorrilla J.M., Pérez-Pérez J., Oliveros J.C., Lorenzo Ó., Solano R.Improved protein-binding microarrays for the identification of DNA-binding specificities of transcription factors. Plant J.2011, 66: 700–711.&lt;br /&gt;
&lt;br /&gt;
[[Category:Genes]]&lt;br /&gt;
[[Category:Japonica mRNA]]&lt;br /&gt;
[[Category:Oryza Sativa Japonica Group]]&lt;br /&gt;
[[Category:Japonica Genes]]&lt;br /&gt;
[[Category:Japonica Chromosome 11]]&lt;br /&gt;
[[Category:Chromosome 11]]&lt;/div&gt;</summary>
		<author><name>Lmw2015</name></author>	</entry>

	<entry>
		<id>https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os11g0249000&amp;diff=248907</id>
		<title>Os11g0249000</title>
		<link rel="alternate" type="text/html" href="https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os11g0249000&amp;diff=248907"/>
				<updated>2015-06-12T04:24:51Z</updated>
		
		<summary type="html">&lt;p&gt;Lmw2015: /* Structured Information */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;Please input one-sentence summary here.&lt;br /&gt;
&lt;br /&gt;
==Annotated Information==&lt;br /&gt;
===Introduction===&lt;br /&gt;
One of the main defense mechanisms is resistance (R) gene-mediated disease resistance. The majority of R genes characterized encode proteins that have a central nucleotide-binding region (NB) plus a C- terminal leucine-rich repeat (LRR).The NB-LRR proteins recognize the corresponding avirulence (Avr) effectors produced by the pathogen and activate defense responses. In most cases, these defense responses are&lt;br /&gt;
accompanied by a hypersensitivity response (HR) in the infected cells, triggering the rapid production of reactive oxygen species (ROS).These defense responses are also associated with accumulation of salicylic acid (SA), which functions in the induction of numerous pathogenesis-related (PR) genes, and the establishment of systemic acquired resistance (SAR).SA is required in R gene-mediated defense signaling pathways.&lt;br /&gt;
It is assumed that R proteins are present in an auto-inhibited state and are unable to activate defense responses in the absence of pathogens.&lt;br /&gt;
Here, we describe the semi-dominant rice mutant nls1-1D ( necrotic leaf sheath 1 ), which displayed tissue-specific and age-dependent spontaneous necrotic lesions and defense-related phenotypes.&lt;br /&gt;
&lt;br /&gt;
Keywords: NLS1, CC-NB-LRR, disease resistance protein, lesion, salicylic acid, rice.&lt;br /&gt;
&lt;br /&gt;
===Function===&lt;br /&gt;
NLS1 displays spontaneous lesions, specifically on leaf sheaths, with a developmental pattern. nls1-1D plants also exhibited constitutively activated defense responses, including extensive cell death, excess hydrogen peroxide and salicylic acid (SA) accumulation, up-regulated expressions of pathogenesis-related genes, and enhanced resistance to bacterial pathogens.NLS1 encodes a typical CC-NB-LRR-type protein in rice and causes a S367N substitution in the non-conserved region close to the GLPL motif of the NB domain. An adjacent S366T substitution was found in another semi-dominant mutant, nls1-2D, which exhibited the same phenotypes as nls1-1D. Combined analyses of wild-type plants transformed with the mutant NLS1 gene (nls1-1D), NLS1 RNAi and over-expression transgenic lines showed that nls1-2D is allelic to nls1-1D, and both mutations may cause constitutive auto-activation of the NLS1 R protein. Further real-time PCR analysis revealed that NLS1 is expressed constitutively in an age-dependent manner. In addition, because the morphology and constitutive defense responses of nls1-1D were not suppressed by blocking SA or NPR1 transcript accumulation, we suggest that NLS1 mediates both SA and NPR1-independent defense signaling pathways in rice.&lt;br /&gt;
&lt;br /&gt;
===Expression===&lt;br /&gt;
The nls1-1D mutant was identified initially in the hetero-zygous state by screening a T-DNA insertion population of rice cultivar Nipponbare ( Oryza sativa ssp. japonica) (Ma et al., 2009). Among offspring of the original mutant plants, approximately 25.9% of the progeny exhibited a&lt;br /&gt;
wild-type phenotype, and 47.9% of the progeny exhibited a mild mutant phenotype: despite their morphological appearance of very aggressive lesions, the vast majority of these mild mutants developed reproductive tissues and set seeds, and their offspring also segregated in a 3:1&lt;br /&gt;
mutant:wild-type Mendelian ratio.&lt;br /&gt;
&lt;br /&gt;
===Evolution===&lt;br /&gt;
In recent years, some reports have shown that R protein mutations are sufficient to cause pathogen-independent defense responses; for example, single amino acid substitutions in the TIR-NB-LRR-type R proteins SSI4 and SNC1 and the CC-NB-LRR-type R protein UNI all cause constitutive expression of defense responses in Arabidopsis (Shirano et al., 2002; Zhang et al., 2003; Noutoshi et al., 2005; Igari et al., 2008). Furthermore, a single amino acid insertion in the WRKY domain of Arabidopsis SLH1, a TIR-NB-LRR-WRKY-type R protein, also activates pathogen-independent defense responses (Noutoshi et al., 2005). In addition, modifications to the coding sequences of some CC-NB-LRR-type R genes, such as the tomato (Lycopersicon esculentum) Mi gene,the potato (Solanum tuberosum) Rx gene and the maize(Zea mays) Rp1 gene, often result in mutants with constitutive defense activity (Hulbert, 1997; Hwang et al., 2000;Bendahmane et al., 2002). On the other hand, several other studies have demonstrated that over-expression of R genes,for example Arabidopsis At4g16890 (SNC1) or tomato Pto or Prf, results in pathogen-independent resistance responses.Recently, it has been shown that constitutive expression of the Arabidopsis CC-NB-LRR-type R gene&lt;br /&gt;
ADR1, caused by the insertion of CaMV 35S enhancers 4 kb upstream of its promoter, also leads to a constitutive defense phenotype .&lt;br /&gt;
&lt;br /&gt;
===Summary===&lt;br /&gt;
In this study, we characterized the semi-dominant mutant nls1-1D (necrotic leaf sheath 1) of rice, which displays spontaneous lesions, specifically on leaf sheaths, with a developmental pattern. nls1-1D plants also exhibited constitutively activated defense responses, including extensive cell death, excess hydrogen peroxide and salicylic acid (SA) accumulation, up-regulated expressions of pathogenesis-related genes, and enhanced resistance to bacterial pathogens. Map-based cloning revealed that NLS1 encodes a typical CC-NB-LRR-type&lt;br /&gt;
protein in rice. The nls1-1D mutation causes a S367N substitution in the non-conserved region close to the GLPL motif of the NB domain. An adjacent S366T substitution was found in another semi-dominant mutant, nls1-2D, which exhibited the same phenotypes as nls1-1D. Combined analyses of wild-type plants transformed with the mutant NLS1 gene (nls1-1D), NLS1 RNAi and over-expression transgenic lines showed that nls1-2D is allelic to nls1-1D, and both mutations may cause constitutive auto-activation of the NLS1 R protein. Further real-time PCR analysis revealed that NLS1 is expressed constitutively in an age-dependent manner. In addition, because the morphology and constitutive defense responses of nls1-1D were not suppressed by blocking SA or NPR1 transcript accumulation, we suggest that NLS1 mediates both SA and NPR1-independent defense signaling pathways in rice.&lt;br /&gt;
&lt;br /&gt;
==Labs working on this gene==&lt;br /&gt;
State Key Laboratory of Plant Genomics and National Center for Plant Gene Research (Beijing), Institute of Genetics and&lt;br /&gt;
Developmental Biology, Chinese Academy of Sciences, Beijing 100101, China,&lt;br /&gt;
&lt;br /&gt;
Graduate School of the Chinese Academy of Sciences, Beijing 100101, China, and&lt;br /&gt;
&lt;br /&gt;
China National Rice Research Institute, Chinese Academy of Agricultural Sciences, Hangzhou 310006, China&lt;br /&gt;
&lt;br /&gt;
==References==&lt;br /&gt;
Jiuyou Tang, Xudong Zhu, Yiqin Wang, Linchuan Liu,BoXu, Feng Li, Jun Fang and Chengcai Chu.(2011)Semi-dominant mutations in the CC-NB-LRR-type R gene,NLS1, lead to constitutive activation of defense responses in rice.the Plant Journal,66,996-1007.&lt;br /&gt;
&lt;br /&gt;
Tang, X., Xie, M., Kim, Y.J., Zhou, J., Klessig, D.F. and Martin, G.B. (1999) Overexpression of Pto activates defense responses and confers broad resistance. Plant Cell, 11, 15–29.&lt;br /&gt;
&lt;br /&gt;
Takken, F.L., Albrecht, M. and Tameling, W.I. (2006) Resistance proteins:&lt;br /&gt;
molecular switches of plant defence. Curr. Opin. Plant Biol. 9, 383–390.&lt;br /&gt;
&lt;br /&gt;
[[Category:Genes]]&lt;br /&gt;
[[Category:Japonica mRNA]]&lt;br /&gt;
[[Category:Oryza Sativa Japonica Group]]&lt;br /&gt;
[[Category:Japonica Genes]]&lt;br /&gt;
[[Category:Japonica Chromosome 11]]&lt;br /&gt;
[[Category:Chromosome 11]]&lt;/div&gt;</summary>
		<author><name>Lmw2015</name></author>	</entry>

	<entry>
		<id>https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os11g0247300&amp;diff=248906</id>
		<title>Os11g0247300</title>
		<link rel="alternate" type="text/html" href="https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os11g0247300&amp;diff=248906"/>
				<updated>2015-06-12T04:24:32Z</updated>
		
		<summary type="html">&lt;p&gt;Lmw2015: /* Structured Information */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;Please input one-sentence summary here.&lt;br /&gt;
&lt;br /&gt;
==Annotated Information==&lt;br /&gt;
Small and round seed 5 gene encodes alpha-tubulin regulating seed cell elongation in rice&lt;br /&gt;
===Function===&lt;br /&gt;
&lt;br /&gt;
Seed size is an important trait in determinant of rice seed quality and yield. In this study, we report a novel semi-dominant mutant Small and round seed 5 (Srs5) that encodes alpha-tubulin protein. Lemma cell length was reduced in Srs5 compared with that of the wild-type. Mutants defective in the G-protein alpha subunit (d1-1) and brassinosteroid receptor, BRI1 (d61-2) also exhibited short seed phenotypes, the former due to impaired cell numbers and the latter due to impaired cell length. Seeds of the double mutant of Srs5 and d61-2 were smaller than those of Srs5 or d61-2. Furthermore, SRS5 and BRI1 genes were highly expressed in Srs5 and d61-2 mutants. These data indicate that SRS5 independently regulates cell elongation of the brassinosteroid signal transduction pathway.&lt;br /&gt;
&lt;br /&gt;
===Expression===&lt;br /&gt;
Seed size and weight are important traits for rice yield (Song and Ashikari 2008, Takeda and Matsuoka 2008). Several quantitative trait loci (QTLs) affecting seed size have been identified, namely GW2 encoding a RING-type protein that functions as an E3 ubiquitin ligase (Song et al. 2007), qSW5 encoding a novel protein with no known domains (Shoumura et al. 2008), and GS3 encoding a membrane protein with various conserved domains (Fan et al. 2006, Takano-Kai et al. 2009). Loss of GW2 and qSW5 function leads to a wider seed phenotype, and loss of GS3 function leads to a longer seed phenotype, both resulting in increased yield.&lt;br /&gt;
&lt;br /&gt;
Causal genes of the small (or short) seed mutants have also been identified, namely d1 (also named RGA1) encoding the heterotrimeric G protein alpha subunit (Ashikari et al. 1999, Fujisawa et al. 1999), d11 encoding a cytochrome P450 involved in brassinosteroid (BR) biosynthesis (Tanabe et al. 2005), d2 and brd2 encoding another type of cytochrome P450 involved in BR synthesis (Hong et al. 2003, Hong et al. 2005), d61 (also named OsBRI1) encoding the BR receptor (Yamamuro et al. 2000), srs1 encoding a novel protein that has no known functional domains (Abe et al. 2010), and finally, srs3 encoding a kinesin 13 protein (Kitagawa et al. 2010). During seed formation in rice, it was demonstrated that D1 regulates cell number (Izawa et al. 2010), and SRS1 and SRS3 regulate cell length (Abe et al. 2010, Kitagawa et al. 2010). From these observations, SRS1 and SRS3 seem to affect seed size through signaling pathways other than G-protein signal transduction.&lt;br /&gt;
&lt;br /&gt;
Although several genes regulating seed size have been identified, their molecular network underlying seed formation remains unclear. Here we report molecular cloning of a novel small and round seed mutant in Srs5 (&lt;br /&gt;
&lt;br /&gt;
===Evolution===&lt;br /&gt;
In linkage analysis, we could not clearly distinguish seed size in F2 seed derived from distant cross between Srs5 and Kasalath. This was likely to be caused by background difference between indica and japonica. To overcome this, we used a chromosome segment substitution line (CSSL), which is a plant series that possesses relatively large chromosome segments of donor parent chromosomes in the recurrent parental chromosome background (Yano and Sasaki 1997, Yano 2001, Ebitani et al. 2005, Ashikari and Matsuoka 2006, Fukuoka et al. 2010). CSSLs can be used to achieve high accuracy in phenotyping in F2 populations. In fact, we could make classification of two seed size, wild and mutant type, in the F2 population derived from a cross between Srs5 and a CSSL.&lt;br /&gt;
&lt;br /&gt;
Genetic analysis of the F2 population derived from a cross between Srs5 and SL233 demonstrated that the Srs5 gene act as semi-dominant manner. This semi-dominant effect was also confirmed in complementation test. Although The Srs5 mutants carrying WT SRS5 gene showed longer seeds than that of the plants containing empty vector, the degree of recovery was not completely same as WT (Figure 4B). The reason that the rescue by WT SRS5 gene was partial may be due to compete between WT and mutation gene products or incomplete conformation of the tubulin complex.&lt;br /&gt;
&lt;br /&gt;
In this study, we demonstrated that the SRS5 gene encodes alpha-tubulin, which has been reported to be the causal gene of the rice mutation&lt;br /&gt;
&lt;br /&gt;
T&lt;br /&gt;
w&lt;br /&gt;
i&lt;br /&gt;
sted&lt;br /&gt;
d&lt;br /&gt;
warf 1(Tid1) (Sunohara 2009). The Tid1 mutation acts as a semi-dominant gene by affecting the interaction of alpha and beta tubulin. Since Srs5 was also a semi-dominant mutation, it was likely caused by incomplete conformation of the tubulin complex. Tid1 shows right helical growth, in addition to a semi-dominant dwarf phenotype. Additionally, Arabidopsis Lefty1 and Lefty2 mutations in genes orthologous to SRS5 also show semi-dominant and left helical growth (Thitamadee et al. 2002). These two mutants were gain-of-function alleles and exhibited similar twisted plant phenotypes. As the Srs5 mutant does not exhibit a twisted phenotype, different mutations in alpha-tubulin seem to lead to different phenotypes. In spikelets, higher accumulation of SRS5 mRNA was detected in the Srs5 mutant than in the WT (Figure 5A). This seems to compensate for the reduced function of alpha-tubulin protein. Higher expression of SRS5 was also detected in d61-2 but not in d1-1 (Figure 5B and 5C). Furthermore, BRI1 gene highly expresses in Srs5 and d61-2 but not in d1-1 (Figure 5B and 5C). These results suggest that the expression of SRS5 and BRI1 genes are compensated by sensing the cell elongation inhibition in the SRS5 and d61-2 mutants, although SRS5 and BRI1 genes regulate cell elongation independently (Figure 6D). Three other alpha-tubulin genes are present in the rice genome, and they share a high homology (Sunohara et al. 2009). In organs that exhibited no significant change in phenotype in the Srs5 mutant, these alpha-tubulins might work redundantly to maintain rice body planning.&lt;br /&gt;
&lt;br /&gt;
==Labs working on this gene==&lt;br /&gt;
&lt;br /&gt;
Shuhei Segami1, Izumi Kono23, Tsuyu Ando24, Masahiro Yano5, Hidemi Kitano6, Kotaro Miura1* and Yukimoto Iwasaki1*&lt;br /&gt;
&lt;br /&gt;
1 Faculty of Biotechnology, Fukui Prefectural University, 4-1-1 Kenjojima, Matsuoka, Eiheiji-Town, Fukui 910-1195, Japan&lt;br /&gt;
&lt;br /&gt;
2 Institute of the Society for Techno-innovation of Agriculture, Forestry and Fisheries, 446-1 Ippaizuka, Kamiyokoba, Tsukuba, Ibaraki 305-0854, Japan&lt;br /&gt;
&lt;br /&gt;
3 Laboratory of Synaptic Plasticity and Connectivity RIKEN Brain Science Institute, 2-1 Hirosawa, Wako, Saitama 351-0198, Japan&lt;br /&gt;
&lt;br /&gt;
4 National Institute of Agrobiological Science, 2-1-1 Kannondai, Tsukuba, Ibaraki 305-8602, Japan&lt;br /&gt;
&lt;br /&gt;
5 National Institute of Agrobiological Science, 1-2 Ohwashi, Tsukuba, Ibaraki 305-8634 Japan&lt;br /&gt;
&lt;br /&gt;
6 Bioscience and Biotechnology Center, Nagoya University, Furo, Chikusa, Nagoya, Aichi 464-8601, Japan&lt;br /&gt;
&lt;br /&gt;
==References==&lt;br /&gt;
&lt;br /&gt;
Abe Y, Mieda K, Ando T, Kono I, Yano M, Kitano H, Iwasaki Y (2010) The SMALL AND ROUND SEED1 (SRS1/DEP2) gene is involved in the regulation of seed size in rice. Genes Genet Syst 85:327-39&lt;br /&gt;
&lt;br /&gt;
Ashikari M, Sakakibara H, Lin S, Yamamoto T, Takashi T, Nishimura A, Angeles ER, Qian Q, Kitano H, Matsuoka M (2005) Cytokinin oxidase regulates rice grain production. Science 309:741-5&lt;br /&gt;
&lt;br /&gt;
Small and round seed 5 gene encodes alpha-tubulin regulating seed cell elongation in rice&lt;br /&gt;
Shuhei Segami1, Izumi Kono23, Tsuyu Ando24, Masahiro Yano5, Hidemi Kitano6, Kotaro Miura1* and Yukimoto Iwasaki1*&lt;br /&gt;
&lt;br /&gt;
Ashikari M, Matsuoka M (2006) Identification, isolation and pyramiding of quantitative trait loci for rice breeding. Trends Plant Sci 11:344-50&lt;br /&gt;
&lt;br /&gt;
[[Category:Genes]]&lt;br /&gt;
[[Category:Japonica mRNA]]&lt;br /&gt;
[[Category:Oryza Sativa Japonica Group]]&lt;br /&gt;
[[Category:Japonica Genes]]&lt;br /&gt;
[[Category:Japonica Chromosome 11]]&lt;br /&gt;
[[Category:Chromosome 11]]&lt;/div&gt;</summary>
		<author><name>Lmw2015</name></author>	</entry>

	<entry>
		<id>https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os11g0235200&amp;diff=248905</id>
		<title>Os11g0235200</title>
		<link rel="alternate" type="text/html" href="https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os11g0235200&amp;diff=248905"/>
				<updated>2015-06-12T04:24:14Z</updated>
		
		<summary type="html">&lt;p&gt;Lmw2015: /* Structured Information */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;''SP1'' encodes a putative transporter that belongs to the peptide transporter (PTR) family,and regulates panicle development and seed size in rice.&lt;br /&gt;
&lt;br /&gt;
==Annotated Information==&lt;br /&gt;
===Function===&lt;br /&gt;
''SP1'' encodes a putative transporter that belongs to the peptide transporter (PTR) family. ''SP1'' is preferentially expressed in young panicle，especially in the phloem of the branches of young panicle.''SP1'' regulates panicle development and seed size in rice.&lt;br /&gt;
&lt;br /&gt;
===Mutation===&lt;br /&gt;
[[File:SP1图1.png|right|thumb|250px|Figure1. Phenotype of the ''sp1-2'' mutant. (from reference&amp;lt;ref name=&amp;quot;ref1&amp;quot; /&amp;gt;)]]&lt;br /&gt;
''sp1-2'' is one TOS17 insertion mutant. &amp;lt;br&amp;gt;&lt;br /&gt;
'''(1) Phenotypic comparison between wild-type and ''sp1-2'' plants after heading.''' &amp;lt;br&amp;gt;&lt;br /&gt;
The ''sp1-2'' mutant plant showed a slight reduction in plant height, owing to the shorted panicle (Figure 1a). &amp;lt;br&amp;gt;&lt;br /&gt;
'''(2) Comparison of panicle sizes between the wild-type and ''sp1-2'' plants at the grain filling stage.''' &amp;lt;br&amp;gt;&lt;br /&gt;
In comparison with the wild type, the mature panicle length of ''sp1-2'' was strikingly reduced (Figure 1b). &amp;lt;br&amp;gt;&lt;br /&gt;
'''(3) Comparison of mature grains size between the wild type and ''sp1-2''.''' &amp;lt;br&amp;gt;&lt;br /&gt;
The seed size of the ''sp1-2'' mutant was smaller than the wild type (Figure 1c). &amp;lt;br&amp;gt;&lt;br /&gt;
'''(4) Comparison of mature grains weight between the wild type and ''sp1-2''.'''&amp;lt;br&amp;gt;&lt;br /&gt;
In consisted with the smaller seeds, the weight of 1000 seeds was lower of the ''sp1-2'' mutant compared to the wild type (Figure 1d). &amp;lt;br&amp;gt;&lt;br /&gt;
These results indicated that the ''SP1'' affects not only the panicle size, but also the grain size.&lt;br /&gt;
&lt;br /&gt;
===Cloning of the ''SP1'' gene===&lt;br /&gt;
[[File:SP1图2.png|right|thumb|250pxFigure 2. Map-based cloning and confirmation of the ''SP1'' gene. (from reference&amp;lt;ref name=&amp;quot;ref1&amp;quot; /&amp;gt;)]]&lt;br /&gt;
Map-based approach was used to clone the ''SP1'' gene. Primary gene mapping showed that the ''SP1''locus is located between the molecular markers S21074 and RM3701 on chromosome 11 (Figure 2a), and then fine mapping narrowed the locus to an 8-kb region between markers M7 and M8 (Figure 2b). Annotation of the 8-kb sequence identified an open reading frame (ORF), LOC_Os11g12740, which is composed of five exons and four introns (Figure 2c). DNA sequence comparison revealed a 31-bp deletion in the third exon in ''sp1-2''. The identity of ''SP1'' is further confirmed by genetic complementation. The plasmid pSPC containing the entire LOC_Os11g12740 ORF and pSPCT containing the partial coding region of the ORF were introduced into the ''sp1-2'' mutant (Figure 2d). All the 10 transgenic lines of pSPC showed a complementation of the sp1-2 phenotype, whereas all of the eight lines of pSPCT failed to rescue the ''sp1-2'' phenotype (Figure 2e,f). RT-PCR analysis showed that the transcription level of the ''SP1'' gene is dramatically decreased in young panicles of ''sp1-2'' (Figure 2g). These results presented above showed that the rice ''SP1'' gene and its mutation is responsible for the altered phenotype of sp1.&lt;br /&gt;
&lt;br /&gt;
===Expression===&lt;br /&gt;
[[File:SP1图3.png|right|thumb|250px|Figure 3. Expression pattern of ''SP1''.(from reference&amp;lt;ref name=&amp;quot;ref1&amp;quot; /&amp;gt;)]]&lt;br /&gt;
The spatial and temporal expression pattern of ''SP1'' is analyzed by GUS reporter system and RT-PCR.&amp;lt;br&amp;gt; &lt;br /&gt;
As shown in figure 3a-m, weak GUS signals could be detected in panicle axes upon the formation of spikelets (Figure 3a), subsequently, the GUS signals become stronger in rachis, branches, stigmas, ovules, and the surfaces of palea and lemma during the elongation stage of the young panicle (Figure 3b-g). The GUS signals are barely detectable in mature panicle (Figure 3h). And the GUS signals are hardly detected in root, culm and leaf (Figure 3i-k). Interesting, the SP1-GUS fusion protein is specially located in the phloem of vascular bundles of panicle rachis (Figure 3l-m). RT-PCR analysis results indicated that ''SP1'' highly expressed in young panicle (Figure 3n).&lt;br /&gt;
&lt;br /&gt;
===Evolution===&lt;br /&gt;
[[File:SP1图4.png|left|thumb|250px|Figure 4. Phylogentic analysis of the ''SP1'' amino acid sequence with plant peptide transporter (PTR) proteins. (from reference&amp;lt;ref name=&amp;quot;ref1&amp;quot; /&amp;gt;)]]&lt;br /&gt;
Bioinformatic analysis revealed that the deduced amino acid sequence of ''SP1'' contains a conserved PTR2 domain, implying that ''SP1'' may encode a PTR family protein. Phylogenetic analysis showed that the ''SP1'' gene is classified into a distinct clade for nitrate transporters, and is closest to AtNRT1:2, an Arabidopsis nitrate transporter (Figure 4). &amp;lt;br&amp;gt;&lt;br /&gt;
(Footnote: In Figure 4,the amino acid sequences of the entire proteins were aligned by CLUSTALX, and the phylogenetic tree was constructed using the neighbor-joining algorithm. Bootstrap values are shown at each node. The circle and the triangle indicate peptide and nitrate transporters, respectively. The square indicates a dicarboxylate transporter.)&lt;br /&gt;
&lt;br /&gt;
===Knowledge Expansion===&lt;br /&gt;
[[File:SP1图5.png|right|thumb|250px|Figure 5. ''SP1'' sequences and the predicted hydropathy profile of ''SP1''.(from reference&amp;lt;ref name=&amp;quot;ref1&amp;quot; /&amp;gt;)]]&lt;br /&gt;
[[File:SP1图6.png|left|thumb|250px|Figure 6. Subcellular localization of the SP1-GFP fusion protein. .(from reference&amp;lt;ref name=&amp;quot;ref1&amp;quot; /&amp;gt;)]]&lt;br /&gt;
Most members of the PTR family contain 12 a-helical transmembrane domains, and are classified into four groups according to their structure &amp;lt;ref name=&amp;quot;ref2&amp;quot;/&amp;gt;. Hydropathy analysis shows that SP1 protein indeed contained 12 transmembrane domains (TMDs), harboring a long hydrophilic loop between TM6 and TM7 (Figure 5b,c). Three consensus sequences, GxxIADxWLGxFx TIxxxxxVxxxG, LGTGGIKPxV and FxxFYLxINxGSL, have been characterized for PTR proteins. However, these motifs were not strictly conserved in all PTR proteins &amp;lt;ref name=&amp;quot;ref3&amp;quot;/&amp;gt;&amp;lt;ref name=&amp;quot;ref4&amp;quot;/&amp;gt;. This is also the case in ''SP1'', in which there are several alternatives within the conserved motifs (GxxLSDxYLGxFxTMxxxxxVxxxG, LGSGCLKPxI and FxxAYFxFCxGEL). In consistent with the 12 TMDs, the ''SP1'' is located at the plasma membrane ,which is correlates with the ''SP1'' action ,as one nitrate transporter(figure 6). In contrast with the control, signal is observed ubiquitously in onion epidermal cells, in which the SP1-GFP fusion protein is exclusively localized in the plasma membrane (Figure 6a–d). And analysis of ACTIN:SP1-GFP transgenic rice also indicates that ''SP1'' localizes at the plasma membrane in rice (Figure 6e–f).&amp;lt;br&amp;gt;&lt;br /&gt;
(Footnote: In Figure 5,(a) The nucleotide sequence and the deduced amino acid sequences of ''SP1''. Numbers at left refer to the positions of nucleic acids. The box highlights the 31-bp deletion in sp1-2. The asterisk indicates the stop codon introduced by the 31-bp deletion. The shaded letters refer to the conserved PTR2 domains, and the underlined letters indicate the 12 transmembrane domains. (b) Prediction of membrane-spanning regions and their orientation of ''SP1'' made by the TMPRED program. (c) A prediction model for the transmembrane topology of ''SP1''.)&lt;br /&gt;
&lt;br /&gt;
==Labs working on this gene==&lt;br /&gt;
*State Key Laboratory of Plant Genomics and National Center for Plant Gene Research, Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, Beijing 100101, China,&lt;br /&gt;
*State Key Laboratory of Rice Biology, China National Rice Research Institute, Chinese Academy of Agricultural Sciences,Hangzhou 310006, China,&lt;br /&gt;
*Graduate School of Agricultural and Life Sciences, University of Tokyo, Yayoi, Bunkyo, Tokyo 113-8652, Japan,&lt;br /&gt;
*Research Institute for Bioresources, Okayama University, 2-20-1, Chuo, Kurashiki, Okayama 710-0046, Japan&lt;br /&gt;
&lt;br /&gt;
==References==&lt;br /&gt;
&amp;lt;references&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref1&amp;quot;&amp;gt;Shengben Li, Qian Qian, Zhiming Fu, Dali Zeng, et al. (2009) ''Short panicle1'' encodes a putative PTR family transporternand determines rice panicle size.The Plant Journal . 58, 592–605.&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref2&amp;quot;&amp;gt;Chiang, C.S., Stacey, G. and Tsay, Y.F. (2004) Mechanisms and functional properties of two peptide transporters, AtPTR2 and fPTR2. J. Biol. Chem. 279, 30150–30157.&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref3&amp;quot;&amp;gt;Fei, Y.J., Ganapathy, V. and Leibach, F.H. (1998) Molecular and structural features of the proton-coupled oligopeptide transporter superfamily. Prog. Nucleic Acid Res. Mol. Biol. 58, 239–261.&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref4&amp;quot;&amp;gt;Stacey, G., Koh, S., Granger, C. and Becker, J.M. (2002) Peptide transport in plants. Trends Plant Sci. 7, 257–263.&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;/references&amp;gt;&lt;br /&gt;
&lt;br /&gt;
[[Category:Genes]]&lt;br /&gt;
[[Category:Japonica mRNA]]&lt;br /&gt;
[[Category:Oryza Sativa Japonica Group]]&lt;br /&gt;
[[Category:Japonica Genes]]&lt;br /&gt;
[[Category:Japonica Chromosome 11]]&lt;br /&gt;
[[Category:Chromosome 11]]&lt;/div&gt;</summary>
		<author><name>Lmw2015</name></author>	</entry>

	<entry>
		<id>https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os11g0225300&amp;diff=248904</id>
		<title>Os11g0225300</title>
		<link rel="alternate" type="text/html" href="https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os11g0225300&amp;diff=248904"/>
				<updated>2015-06-12T04:23:55Z</updated>
		
		<summary type="html">&lt;p&gt;Lmw2015: /* Structured Information */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;Please input one-sentence summary here.&lt;br /&gt;
&lt;br /&gt;
==Annotated Information==&lt;br /&gt;
===Function===&lt;br /&gt;
&lt;br /&gt;
Plant resistance to microbial pathogens is a complex process relying on two major levels of resistance controlled by distinct types of plant receptors (Jones and Dangl, 2006; Dodds and Rathjen, 2010). The first line of plant defense is activated by plasma membrane proteins called pattern recognition receptors,which perceive conserved microbial molecules called pathogenassociated molecular patterns (PAMPs). Adapted plant pathogens are able to bypass this PAMP-triggered immunity by producing secreted effectors that act inside or outside the host cell and manipulate key components of plant defense (Jones and Dangl, 2006). The second layer of plant immunity relies on the specific recognition of certain pathogen-derived effectors called Avirulence (Avr) proteins by so-called plant resistance (R) proteins. This effector-triggered immunity (ETI) gives rise to stronger and faster defense responses than PAMP-triggered immunity and often involves a form of localized programmed cell death called the hypersensitive response (HR) (Dodds and Rathjen, 2010). The largest class of R proteins belongs to the conserved family of NB-LRR proteins (Tameling and Takken,2007). They contain a central nucleotide binding (NB) domain,also known as the NB-ARC (for NB adaptor shared by Apaf-1,certain R proteins, and CED-4) domain, and a C-terminal leucinerich repeat (LRR) domain. In monocot R proteins, the LRR repeatmotif is often not conserved (Bai et al., 2002) and in those cases,the domain is called leucine-rich domain (Monosi et al., 2004;Zhou et al., 2004). NB-LRR proteins are further subdivided according&lt;br /&gt;
to their N-terminal domain into two major subclasses(Meyers et al., 1999; Pan et al., 2000). Proteins of the TIR-NB-LRR class possess an N-terminal Toll Interleukin-1 (TIR) domain,whereas CC-NB-LRR class proteins harbor a structured coiledcoil(CC) domain. Both N-terminal domains seem to be involved in R protein homodimerization and in the activation of defensesignaling (Bernoux et al., 2011; Maekawa et al., 2011). In the absence of the Avr protein, R proteins are maintained in an inactive conformation to avoid inappropriate defense activationand cell death (Takken and Goverse, 2012).&amp;lt;ref name=&amp;quot;ref1&amp;quot; /&amp;gt; &amp;lt;ref name=&amp;quot;ref2&amp;quot; /&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Expression===&lt;br /&gt;
Seven Avr genes from M. oryzae have been cloned. Except ACE1 and AVR-Pita, which encode an enzyme involved in the synthesis of a secondary metabolite (Böhnert et al., 2004) and a putative metalloprotease (Orbach et al., 2000), respectively,Avr genes from the rice blast fungus encode small secreted proteins of unknown function. Experimental evidence indicates that recognition of AVR-Pita, AVR-Pia, and AVR-Pik/km/kp occurs inside host cells by their corresponding cytoplasmic R&lt;br /&gt;
proteins (Jia et al., 2000; Yoshida et al., 2009; Kanzaki et al.,2012). Recently, we characterized molecularly the AVR1-CO39gene and demonstrated that it encodes a small secreted protein,expressed specifically during infection (Ribot et al., 2013). AVR1-CO39 is translocated inside the cytoplasm of rice cells where it is&lt;br /&gt;
recognized by the product of the so far uncharacterized Pi-CO39R gene (Ribot et al., 2013).&amp;lt;ref name=&amp;quot;ref3&amp;quot; /&amp;gt;&lt;br /&gt;
The molecular mechanism of M. oryzae Avr protein recognition has only been investigated in the case of AVR-Pita and AVR-Pik (Jia et al., 2000; Kanzaki et al., 2012). AVR-Pita is recognized through direct binding to the Pi-ta C-terminal LRD domain, whereas AVR-Pik specifically associates with an N-terminal domain of Pik-1, including the CC domain and additional unclassified sequences upstream of the NB domain.Hence, those examples illustrate two cases of direct recognitionthat seem to implicate different R protein domains and different mechanisms.&amp;lt;ref name=&amp;quot;ref4&amp;quot; /&amp;gt;&lt;br /&gt;
Transient Protein Expression in N. benthamiana For Agrobacterium-mediated N. benthamiana leaf transformations,transformed GV3101 pMP90 strains were grown in Luria-Bertani liquid medium containing 50 mg mL21 rifampicin, 15 mg mL21 gentamycin, and 25 mg mL21 kanamycin at 28°C for 24 h before use. Bacteria were.&amp;lt;ref name=&amp;quot;ref5&amp;quot; /&amp;gt;&lt;br /&gt;
harvested by centrifugation, resuspended in infiltration medium (10 mM MES, pH 5.6, 10 mM MgCl2, and 150 mM acetosyringone) to an OD600 of1, and incubated for 2 h at room temperature before leaf infiltration. The infiltrated plants were incubated for 36 or 48 h in growth chambers under controlled conditions for FRET-FLIM or coimmunoprecipitation experiments,respectively.&amp;lt;ref name=&amp;quot;ref6&amp;quot; /&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Evolution===&lt;br /&gt;
Phylogenetic Analysis:To identify homologous protein sequences in the Nipponbare rice reference genome, BLASTp searches (Altschul et al., 1997) against the OrygenesDB database were performed  (Droc et al., 2006). The protein alignment generated with ClustalX (Larkin et al., 2007) was manually edited and curated, and gaps were removed for further analyses. We used MEGA 5.05 (Tamura et al., 2011) to reconstruct maximum parsimony, maximum likelihood, and distance trees. For the maximum parsimony analysis, we used the heuristic search algorithm to explore the possible topologies. For the maximum likelihood analysis, we used the JTT + G amino acid substitution model. Accordingto the smallest Akaike information criterion (AIC), this model was determined&lt;br /&gt;
to be the best-fit model using ProtTest 3 (Darriba et al., 2011),which estimates the likelihood and the parameter values of 112 different protein evolution models using a maximum likelihood framework. For the distance analysis, we used neighbor joining with the JTT + G amino acid substitution model. For the three analyses, we performed 1000 bootstrap replicates to assess the support for the nodes and displayed the bootstrap consensus tree.&amp;lt;ref name=&amp;quot;ref7&amp;quot; /&amp;gt;&lt;br /&gt;
Interestingly, RGA4 and RGA5 also confer resistance againstM. oryzae isolates expressing the avirulence gene AVR-Pia,which shows no sequence similarity to AVR1-CO39 (Yoshidaet al., 2009; Okuyama et al., 2011). Therefore, RGA4 and RGA5 together constitute the genetically defined Pia and Pi-CO39resistance genes. Accordingly, perfect association between Pia and Pi-CO39 resistance was observed when a collection of rice cultivars was analyzed for resistance to M. oryzae strains carrying&lt;br /&gt;
either AVR-Pia or AVR1-CO39. Hence, our study demonstrates that the pair of CC-NB-LRR proteins RGA4 and RGA5 possesses a dual Avr recognition specificity. Such dual specificity for a pair of NB-LRR proteins had previously been demonstrated for RPS4 and RRS1, a TIR-NB-LRR pair that is required to recognize the P. syringae effector AvrRps4, the Ralstonia solanacearum effector PopP2, and a still uncharacterized factor produced by Colletotrichum higginsianum (Gassmann et al.,1999; Deslandes et al., 2002; Birker et al., 2009; Narusaka et al.,2009). The present work provides therefore an example of dualrecognition mediated by a pair of distinct CC-NB-LRR proteins.&amp;lt;ref name=&amp;quot;ref8&amp;quot; /&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==Labs working on this gene==&lt;br /&gt;
*INRA, UMR 385 Biologie et Génétique des Interactions Plante-Parasite, F-34398 Montpellier, France&lt;br /&gt;
*CIRAD, UMR Biologie et Génétique des Interactions Plante-Parasite, F-34398 Montpellier, France&lt;br /&gt;
*CNRS, Plateforme Imagerie-Microscopie, Fédération de Recherche FR3450, 31326 Castanet-Tolosan, France&lt;br /&gt;
*INRA, UMR 441 Laboratoire des Interactions Plantes-Microorganismes, F-31326 Castanet-Tolosan, France&lt;br /&gt;
*CNRS, UMR 2594 Laboratoire des Interactions Plantes-Microorganismes, F-31326 Castanet-Tolosan, France&lt;br /&gt;
*Iwate Biotechnology Research Center, Kitakami, Iwate 024-0003, Japan&lt;br /&gt;
&lt;br /&gt;
==References==&lt;br /&gt;
&lt;br /&gt;
&amp;lt;references&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref1&amp;quot;&amp;gt;Stella Cesari;Gaëtan Thilliez;Cécile Ribot, et al. (2013) The Rice Resistance Protein Pair RGA4/RGA5 Recognizes the Magnaporthe oryzae Effectors AVR-Pia and AVR1-CO39 by Direct Binding.The Plant Cell, 25(4): 1463-1481.&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref2&amp;quot;&amp;gt;Altschul, S.F., Madden, T.L., Schäffer, A.A., Zhang, J., Zhang, Z.,Miller, W., and Lipman, D.J. (1997). Gapped BLAST and PSIBLAST:A new generation of protein database search programs.Nucleic Acids Res. 25: 3389–3402.&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref3&amp;quot;&amp;gt;Ashikawa, I., Hayashi, N., Yamane, H., Kanamori, H., Wu, J.,Matsumoto, T., Ono, K., and Yano, M. (2008). Two adjacent nucleotide-binding site-leucine-rich repeat class genes are required toconfer Pikm-specific rice blast resistance. Genetics 180: 2267–2276.&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref4&amp;quot;&amp;gt;Bai, J., Pennill, L.A., Ning, J., Lee, S.W., Ramalingam, J., Webb,C.A., Zhao, B., Sun, Q., Nelson, J.C., Leach, J.E., and Hulbert,S.H. (2002). Diversity in nucleotide binding site-leucine-rich repeatgenes in cereals. Genome Res. 12: 1871–1884.&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref5&amp;quot;&amp;gt;Ballini, E., Morel, J.B., Droc, G., Price, A., Courtois, B., Notteghem,J.L., and Tharreau, D. (2008). A genome-wide meta-analysis of rice blast resistance genes and quantitative trait loci provides newinsights into partial and complete resistance. Mol. Plant Microbe Interact. 21: 859–868.&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref6&amp;quot;&amp;gt;Bernoux,M., Ve, T., Williams, S.,Warren, C., Hatters, D., Valkov, E.,Zhang, X., Ellis, J.G., Kobe, B., and Dodds, P.N. (2011). Structural and functional analysis of a plant resistance protein TIR domainreveals interfaces for self-association, signaling, and autoregulation.Cell Host Microbe 9: 200–211.&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref7&amp;quot;&amp;gt;Berruyer, R., Adreit, H., Milazzo, J., Gaillard, S., Berger, A., Dioh,W., Lebrun, M.-H., and Tharreau, D. (2003). Identification and finemapping of Pi33, the rice resistance gene corresponding to theMagnaporthe grisea avirulence gene ACE1. Theor. Appl. Genet.107: 1139–1147.&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref8&amp;quot;&amp;gt;Birker, D., Heidrich, K., Takahara, H., Narusaka, M., Deslandes, L.,Narusaka, Y., Reymond, M., Parker, J.E., and O’Connell, R.J.(2009). A locus conferring resistance to Colletotrichum higginsianum isshared by four geographically distinct Arabidopsis accessions. Plant J.60: 602–613.&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;/references&amp;gt;&lt;br /&gt;
&lt;br /&gt;
[[Category:Genes]]&lt;br /&gt;
[[Category:Japonica mRNA]]&lt;br /&gt;
[[Category:Oryza Sativa Japonica Group]]&lt;br /&gt;
[[Category:Japonica Genes]]&lt;br /&gt;
[[Category:Japonica Chromosome 11]]&lt;br /&gt;
[[Category:Chromosome 11]]&lt;/div&gt;</summary>
		<author><name>Lmw2015</name></author>	</entry>

	<entry>
		<id>https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os11g0225100&amp;diff=248903</id>
		<title>Os11g0225100</title>
		<link rel="alternate" type="text/html" href="https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os11g0225100&amp;diff=248903"/>
				<updated>2015-06-12T04:23:36Z</updated>
		
		<summary type="html">&lt;p&gt;Lmw2015: /* Structured Information */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;Please input one-sentence summary here.&lt;br /&gt;
&lt;br /&gt;
==Annotated Information==&lt;br /&gt;
&lt;br /&gt;
Blast, caused by Magnaporthe oryzae, is one of the most widespread and destructive diseases of rice. The Oryza sativa (rice) resistance gene Pia confers resistance to the blast fungus Magnaporthe oryzae carrying the AVR-Pia avirulence gene. Pia , carried by cv. Aichi Asahi,is located on the short arm of chromosome 11.Associated with the rice leaf blast resistance which can make rice rice blast fungus produces a small species-specific resistance. Previous studies have shown that, the gene resistance spectrum of Pia is narrow, but widespread in Japanese rice varieties. the method of classical genetic is used to identify  this gene. Have been cloned.（Okuyama et al., 2011）&lt;br /&gt;
&lt;br /&gt;
===Expression===&lt;br /&gt;
Rice blast resistance gene Pia consists of two adjacentgenes RGA4 and RGA5 coding  NBS-LRR protein.(Okuyama et al., 2011)  Two NB-LRR protein-coding genes from rice (Oryza sativa), RGA4 and RGA5, were found to be required for the recognition of the Magnaporthe oryzae effector AVR1-CO39. RGA4 and RGA5 also mediate recognition of the unrelated M. oryzae effector AVR-Pia,thereby sparking an intense defense response of host plant to eliminate pathogens.&lt;br /&gt;
[[File:RGA4_and_RGA5_Confer_Pi-CO39.jpg]]&lt;br /&gt;
&lt;br /&gt;
===Evolution===&lt;br /&gt;
&lt;br /&gt;
Phylogenetic relationship of the RATX1 domains of RGA5-A, Pik-1, Pikp-1, pi5-3, and closely related homologous RATX1 proteins from rice, reconstructed using the neighbor-joining distance method based on the alignment shown in figure :Phylogenetic_analysis&lt;br /&gt;
Node supports are given in percentage of 1000 bootstrap replicates. The topology shows the condense consensus tree of the 1000 bootstrap&lt;br /&gt;
replicates, with nodes with a bootstrap support &amp;lt;50% being collapsed. Branch lengths are proportional to phylogenetic distances estimated from the&lt;br /&gt;
JTT + G amino acid substitution model.[[File: Phylogenetic analysis.jpg]]&lt;br /&gt;
&lt;br /&gt;
==Labs working on this gene==&lt;br /&gt;
1、Biologie et Génétique des Interactions Plante-Parasite, F-34398 Montpellier, France&lt;br /&gt;
----&lt;br /&gt;
&lt;br /&gt;
2、Plateforme Imagerie-Microscopie, Fédération de Recherche FR3450, 31326 Castanet-Tolosan, France&lt;br /&gt;
----&lt;br /&gt;
&lt;br /&gt;
3、UMR 441 Laboratoire des Interactions Plantes-Microorganismes, F-31326 Castanet-Tolosan, France&lt;br /&gt;
----&lt;br /&gt;
&lt;br /&gt;
4、UMR 2594 Laboratoire des Interactions Plantes-Microorganismes, F-31326 Castanet-Tolosan, France&lt;br /&gt;
----&lt;br /&gt;
&lt;br /&gt;
5、Iwate Biotechnology Research Center, Kitakami, Iwate 024-0003, Japan&lt;br /&gt;
----&lt;br /&gt;
&lt;br /&gt;
6、华南农业大学资源环境学院植物抗病遗传学研究室, 广州510642; &lt;br /&gt;
----&lt;br /&gt;
&lt;br /&gt;
7、湖南农业大学农学院, 长沙410128&lt;br /&gt;
----&lt;br /&gt;
&lt;br /&gt;
8、Tsukuba Botanical Garden, National Museum of Nature and Science, Tsukuba 305-0005, Japan&lt;br /&gt;
----&lt;br /&gt;
&lt;br /&gt;
9、Graduate School of Agriculture, Hokkaido University, Sapporo 060-8589, Japan&lt;br /&gt;
----&lt;br /&gt;
&lt;br /&gt;
10、International Rice Research Institute, MCPO Box,3127, Makati 1271, Philippines&lt;br /&gt;
----&lt;br /&gt;
&lt;br /&gt;
11、National Agriculture Research Center,3-1-1 Kannondai, Tsukuba, Ibaraki 305-8666,Japan&lt;br /&gt;
----&lt;br /&gt;
&lt;br /&gt;
==References==&lt;br /&gt;
1、Kiyosawa-S，  Genetics of blast resistance，  Rice Breeding, 1972, (0): 203-225&lt;br /&gt;
----&lt;br /&gt;
2、 Hiroshi Tsunematsu;Mary Jeanie T. Yanoria;Leodegario A. Ebron;Nagao Hayashi;Ikuo Ando;Hiroshi Kato;Tokio Imbe;Gurdev S. Khush；  Development of monogenic lines of rice for blast resistance；  Breeding Science, 2000, 50(3): 229-234&lt;br /&gt;
----&lt;br /&gt;
3、 曾晓珊;杨先锋;赵正洪;林菲;王玲;潘庆华，  稻瘟病抗病基因Pia的抗性分析及精细定位，  中国科学: 生命科学, 2011, 41(1): 70-77&lt;br /&gt;
----&lt;br /&gt;
4、XiaoShan Zeng;XianFeng Yang;ZhengHong Zhao;Fei Lin;Ling Wang;QingHua Pan，  Characterization and fine mapping of the rice blast resistance gene Pia，  Science China Life Sciences, 2011, 54(4): 372-378&lt;br /&gt;
----&lt;br /&gt;
5、Yudai Okuyama;Hiroyuki Kanzaki;Akira Abe;Kentaro Yoshida;Muluneh Tamiru;Hiromasa Saitoh;Takahiro Fujibe;Hideo Matsumura;Matt Shenton;Dominique Clark Galam;Jerwin Undan;Akiko Ito;Teruo Sone;Ryohei Terauchi，  A multifaceted genomics approach allows the isolation of the rice Pia-blast resistance gene consisting of two adjacent NBS-LRR protein genes，  The Plant Journal, 2011, 66(3): 467-479&lt;br /&gt;
----&lt;br /&gt;
6、Stella Cesari;Gaëtan Thilliez;Cécile Ribot;Véronique Chalvon;Corinne Michel;Alain Jauneau;Susana Rivas;Ludovic Alaux;Hiroyuki Kanzaki;Yudai Okuyama;Jean-Benoit Morel;Elisabeth Fournier;Didier Tharreau;Ryohei Terauchi;Thomas Kroj，  The Rice Resistance Protein Pair RGA4/RGA5 Recognizes the Magnaporthe oryzae Effectors AVR-Pia and AVR1-CO39 by Direct Binding， The Plant Cell, 2013, 25(4): 1463-1481&lt;br /&gt;
----&lt;br /&gt;
&lt;br /&gt;
[[Category:Genes]]&lt;br /&gt;
[[Category:Japonica mRNA]]&lt;br /&gt;
[[Category:Oryza Sativa Japonica Group]]&lt;br /&gt;
[[Category:Japonica Genes]]&lt;br /&gt;
[[Category:Japonica Chromosome 11]]&lt;br /&gt;
[[Category:Chromosome 11]]&lt;/div&gt;</summary>
		<author><name>Lmw2015</name></author>	</entry>

	<entry>
		<id>https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os11g0216300&amp;diff=248902</id>
		<title>Os11g0216300</title>
		<link rel="alternate" type="text/html" href="https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os11g0216300&amp;diff=248902"/>
				<updated>2015-06-12T04:23:17Z</updated>
		
		<summary type="html">&lt;p&gt;Lmw2015: /* Structured Information */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;Please input one-sentence summary here.&lt;br /&gt;
&lt;br /&gt;
==Annotated Information==&lt;br /&gt;
''OsABC1-13'' contains 15 extrons, locates in chromosome 11, and encodes a protein with 675 amino acids.&lt;br /&gt;
===Function===&lt;br /&gt;
Members of the activity of bc1 complex (ABC1) family are widely existed in prokaryotes and eukaryotes as protein kinases. These protein kinase members were initially isolated from Saccharomyces cerevisiae and were responsible to suppress a defect in mRNA translation of cytochrome b and maintain the activity of the bc1 complex in the mitochondrial respiratory chain &amp;lt;ref name=&amp;quot;ref1&amp;quot; /&amp;gt;. Mitochondrial and chloroplast ABC1 proteins is associated in respiratory electron transport system and as a lipid-soluble antioxidant in ''yeast'', ''Escherichia col'', and human &amp;lt;ref name=&amp;quot;ref2&amp;quot; /&amp;gt;&amp;lt;ref name=&amp;quot;ref3&amp;quot; /&amp;gt;.&lt;br /&gt;
There are 15 non-redundant ABC1genes distributed on all rice chromosomes randomly except chromosomes 3, 8, 10, and 12 in rice, and were named from OsABC1-1 to OsABC1-15 according to their chromosomal location (table 1). However, there are 17 members of ABC1 family in ''Arabidopsis''. All of these genes contain introns and the number of intron varies greatly, and intron gain was an important event accompanying the recent evolution of the rice ABC1 family &amp;lt;ref name=&amp;quot;ref4&amp;quot; /&amp;gt;.&lt;br /&gt;
[[File:abc1-table.jpg|middle|thumb|530px|'''Table.1'' Basic information of the rice ABC1 genes.(from reference) &amp;lt;ref name=&amp;quot;ref4&amp;quot; /&amp;gt;.]]&lt;br /&gt;
ABC1 domain is an important part of the ABC1 proteins, and aligned results show that the domains of all proteins were from 102–126 amino acids, except the OsABC1-14 and OsABC1-15 proteins. The length of the domain in OsABC1-14 and OsABC1-15 is 92 amino acids and 184 amino acids, respectively &amp;lt;ref name=&amp;quot;ref4&amp;quot; /&amp;gt;. The XaXasX2QV segment that functions as a nucleotide-binding motif for protein kinases is highly conserved in ABC1 domain as well as lysine residue in N-terminal that as a binding site for chemical groups. In addition, other conserved amino acid valine and aspartate acid in the middle of the domain and glutamate acid in the C-terminal. It is also suggested that there are 10 putative motifs in rice ABC1 proteins. &lt;br /&gt;
The real-time PCR results show that 14 genes express mainly in leaves. The subcellular localization is predicted that OsABC1-1 and OsABC1-8 were localized in the cytoplasm, OsABC1-3 and OsABC1-6 in the plasma membrane, OsABC1-10 in mitochondria, OsABC1-14 in vacuoles and the others in chloroplasts &amp;lt;ref name=&amp;quot;ref4&amp;quot; /&amp;gt;.&lt;br /&gt;
Members of this family participate in the extensive abiotic stress response and may play roles in the tolerance of plants to adverse environments. Furthermore, some of the rice ABC1 genes may be involved in the oxidative stress response and ABA signaling&amp;lt;ref name=&amp;quot;ref4&amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
===Expression===&lt;br /&gt;
Please input expression information here.&lt;br /&gt;
&lt;br /&gt;
===Evolution===&lt;br /&gt;
Please input evolution information here.&lt;br /&gt;
&lt;br /&gt;
You can also add sub-section(s) at will.&lt;br /&gt;
&lt;br /&gt;
==Labs working on this gene==&lt;br /&gt;
*Jiangsu Provincial Key Laboratory of Crop Genetics and Physiology&lt;br /&gt;
*Key Laboratory of Plant Functional Genomics of the Ministry of Education, Yangzhou University, China&lt;br /&gt;
&lt;br /&gt;
==References==&lt;br /&gt;
&amp;lt;references&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref1&amp;quot;&amp;gt; Bousquet I, Dujardin G, Slonimski P P. 1991. ABC1, a novel yeast nuclear gene has a dual function in mitochondria: It suppresses a cytochrome b mRNA translation defect and is essential for the electron transfer in the bc 1 complex. EMBO J, 10(8): 2023–2031.&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref2&amp;quot;&amp;gt; Villalba J M, Navas P. 2000. Plasma membrane redox system in the control of stress-induced apoptosis. Antioxid Redox Signal, 2(2): 213–230.&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref3&amp;quot;&amp;gt; Ernster L, Forsmark-Andree P. 1993. Ubiquinol: an endogenous antioxidant in aerobic organisms. Clin Investig, 71(8 Suppl): S60–S65.&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref4&amp;quot;&amp;gt;GAOQing-song, ZHANGDan, XULiang, XUChen-wu. Systematic Identification of Rice ABC1Gene Family and Its Response to Abiotic Stress. Rice Science, 2011, 18(2).&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;/references&amp;gt;&lt;br /&gt;
&lt;br /&gt;
[[Category:Genes]]&lt;br /&gt;
[[Category:Japonica mRNA]]&lt;br /&gt;
[[Category:Oryza Sativa Japonica Group]]&lt;br /&gt;
[[Category:Japonica Genes]]&lt;br /&gt;
[[Category:Japonica Chromosome 11]]&lt;br /&gt;
[[Category:Chromosome 11]]&lt;/div&gt;</summary>
		<author><name>Lmw2015</name></author>	</entry>

	<entry>
		<id>https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os11g0210300&amp;diff=248901</id>
		<title>Os11g0210300</title>
		<link rel="alternate" type="text/html" href="https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os11g0210300&amp;diff=248901"/>
				<updated>2015-06-12T04:22:57Z</updated>
		
		<summary type="html">&lt;p&gt;Lmw2015: /* Structured Information */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;''Adh1'' gene locus, elongating coleoptile when rice in flooded conditions.&lt;br /&gt;
&lt;br /&gt;
==Annotated Information==&lt;br /&gt;
===Function===&lt;br /&gt;
[[File:Shijc-Fig1.jpg|right|thumb|300px|''Diagram of alcoholic fermentation pathway in plants. (from reference &amp;lt;ref name=&amp;quot;ref13&amp;quot; /&amp;gt;).'']]&lt;br /&gt;
&lt;br /&gt;
In many higher plants, alcoholic fermentation is necessary for germination and survival under anaerobic conditions caused by heavy rain and ﬂooding &amp;lt;ref name=&amp;quot;ref1&amp;quot; /&amp;gt;. Alcoholic fermentation occurs in two reaction steps: the decarboxylation of pyruvate to acetaldehyde by pyruvate decarboxylase (PDC) and the subsequent reduction of acetaldehyde to ethanol by lcohol dehydrogenase (ADH). This metabolic pathway supports glycolysis and ATP synthesis by recycling NAD+. Analyses of ADH deﬁcient mutants in maize &amp;lt;ref name=&amp;quot;ref2&amp;quot; /&amp;gt;&amp;lt;ref name=&amp;quot;ref3&amp;quot; /&amp;gt;&amp;lt;ref name=&amp;quot;ref4&amp;quot; /&amp;gt;, barley &amp;lt;ref name=&amp;quot;ref5&amp;quot; /&amp;gt;, Arabidopsis &amp;lt;ref name=&amp;quot;ref6&amp;quot; /&amp;gt;&amp;lt;ref name=&amp;quot;ref7&amp;quot; /&amp;gt; and rice &amp;lt;ref name=&amp;quot;ref8&amp;quot; /&amp;gt; have shown that ADH is required for anaerobic tolerance in plants. &lt;br /&gt;
When rice germinates under water, ADH activity is required for coleoptile elongation &amp;lt;ref name=&amp;quot;ref9&amp;quot; /&amp;gt;&amp;lt;ref name=&amp;quot;ref10&amp;quot; /&amp;gt; &amp;lt;ref name=&amp;quot;ref11&amp;quot; /&amp;gt;. Matsumura et al. &amp;lt;ref name=&amp;quot;ref12&amp;quot; /&amp;gt; isolated a single recessive rice mutant, whose ADH activity was markedly reduced. Thus, the mutant was designated as reduced ''adh'' activity (rad) mutant. Elongation of the coleoptile was strongly repressed in the submerged rad mutant &amp;lt;ref name=&amp;quot;ref12&amp;quot; /&amp;gt;. Subsequently, the amount of ADHl protein, but not the amount of ADH2 protein, in shoots and roots in the rad mutant was found to be lower than that in the wild type, while the Adhl mRNA levels in the rad mutant were comparable to those in the wild type &amp;lt;ref name=&amp;quot;ref8&amp;quot; /&amp;gt;. &lt;br /&gt;
The rad ''Adhl'' gene displayed a point mutation linked to the phenotype ofrepressed coleoptile elongation. &lt;br /&gt;
&lt;br /&gt;
===Mutant===&lt;br /&gt;
The DNA sequence of Kinmaze is identical to rad mutant except for a G to A transition at position 106 at CDS region that resulted in a change of the predicted amino acid Glutamate (Glu-36) in Kinmaze to Lys in rad mutant. &amp;lt;ref name=&amp;quot;ref13&amp;quot; /&amp;gt;&lt;br /&gt;
&lt;br /&gt;
===Expression===&lt;br /&gt;
[[File:Shijc-Fig2.jpg|right|thumb|200px|''Comparison of coleoptiles of wild type rice and the rad mutant. (from reference &amp;lt;ref name=&amp;quot;ref13&amp;quot; /&amp;gt;).'']]&lt;br /&gt;
&lt;br /&gt;
Under submerged conditions, the coleoptiles of the wild type Kinmaze began to elongate one day after imbibition and reached an average length of 52.2 mm after 5 days. However, the coleoptiles ofthe rad mutant hardly elongated even after 5 days. This result was consistent with the ﬁndings of &amp;lt;ref name=&amp;quot;ref12&amp;quot; /&amp;gt;. The relative transcript levels of ''Adh1'' in the coleoptile were comparable between the rad mutant and Kinmaze, while the amount of ADH protein in the coleoptiles in the radmutant was 5-fold lower than that in Kinmaze. These results were similar to those observed in the leaves and roots ofthe rad mutant &amp;lt;ref name=&amp;quot;ref8&amp;quot; /&amp;gt;. On the other hand, the Pdc1 mRNA levels and the PDC protein levels were comparable between the rad mutant and Kinmaze, suggesting that the expression of the Pdc1 gene was not affected by the reduction ofthe ADH protein level.&lt;br /&gt;
&lt;br /&gt;
===Alternative Splicing===&lt;br /&gt;
{| class='wikitable' style=&amp;quot;text-align:center&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! | Loci ID&lt;br /&gt;
! | CDS Coordinates&lt;br /&gt;
! | Length of nucleotides&lt;br /&gt;
! |Predicted length of protein&lt;br /&gt;
|-&lt;br /&gt;
| LOC_Os11g10480.1&lt;br /&gt;
| 5713026 ~ 5715916&lt;br /&gt;
| 1140&lt;br /&gt;
| 380&lt;br /&gt;
|-&lt;br /&gt;
| LOC_Os11g10480.2&lt;br /&gt;
| 5713026 ~ 5715555&lt;br /&gt;
| 1038&lt;br /&gt;
| 346&lt;br /&gt;
|-&lt;br /&gt;
| LOC_Os11g10480.4&lt;br /&gt;
| 5713026 ~ 5714398&lt;br /&gt;
| 807&lt;br /&gt;
| 269&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
==Labs working on this gene==&lt;br /&gt;
Laboratory of Plant Molecular Genetics, Graduate School of Agricultural and Life Sciences, The University of Tokyo, 1-1-1 Yayoi, Bunkyo, Tokyo 113-8657, Japan&lt;br /&gt;
&lt;br /&gt;
==References==&lt;br /&gt;
&amp;lt;references&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref1&amp;quot;&amp;gt;Tadege,M., I.Dupuis and C.Kuhlemeier (1999) Ethanolic fermentation: new functions for an old pathway. Trends Plant Sci. 4: 320-325.&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref2&amp;quot;&amp;gt;Schwartz,D. (1969) An example of gene ﬁxation resulting from selective advantage in suboptimal conditions. Am. Nat. 103: 479-481.&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref3&amp;quot;&amp;gt;Freeling,M. and D.C.Bennett (1985) Maize Adh1. Ann. Rev. Genet.19: 297-323.&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref4&amp;quot;&amp;gt;Johnson,J.R., B.G.Cobb and M.C.Drew (1994) Hypoxic induction of anoxia tolerance in roots of Adh1 null Zea mays L. Plant Physiol. 105: 61-67.&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref5&amp;quot;&amp;gt;Harberd,N.P. and K.J.R. Edwards (1982) The effect of a mutation causing alcohol dehydrogenase deﬁciency on ﬂooding tolerance in barley. New Phytol. 90: 631-644.&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref6&amp;quot;&amp;gt;Jacobs,M., R.Dolferus and D.VandenBossche (1988) Isolation and biochemical analysis of ethyl methanesulfonate-induced alcohol dehydrogenase null mutants of Arabidopsis thaliana (L.) Heynh. Biochem. Genet. 26: 105-122.&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref7&amp;quot;&amp;gt;Ellis M.H., E.S.Dennis and W.J.Peacock (1999) Arabidopsis roots and shoots have different mechanisms for hypoxic stress tolerance.Plant Physiol. 119: 57-64.&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref8&amp;quot;&amp;gt;Matsumura,H., T.Takano, G.Takeda and H.Uchimiya (1998) Adh1 is transcriptionally active but its translational product is reduced&lt;br /&gt;
in a rad mutant of rice (Oryza sativa L.), which is vulnerable to submergence stress. Theor. Appl. Genet. 97: 1197-1203.&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref9&amp;quot;&amp;gt;Setter,T.L. and E.S.Ella (1994) Relationship between coleoptile elongation and alcoholic fermentation in rice exposed to anoxia.I.Importance of treatment conditions and different tissues. Ann.Bot. 74: 265 271.&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref10&amp;quot;&amp;gt;Kato-Noguchi,H. (2001) Submergence tolerance and ethanolic fermentation in rice coleoptiles. Plant Prod. Sci. 4: 62-65.&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref11&amp;quot;&amp;gt;Kato-Noguchi,H. and T.Kugimiya (2003) Preferential induction of alcohol dehydrogenase in coleoptiles of rice seedlings germinated in submergence condition. Biol. Plant. 46: 153-155.&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref12&amp;quot;&amp;gt;Matsumura,H., T.Takano, K.T.Yoshida and G.Takeda (1995) A rice mutant lacking Alcohol-dehydrogenase. Breed. Sci. 45: 365-367.&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref13&amp;quot;&amp;gt;Hiroaki,S., H. Matsumura, T. Takano, N. Tsutsumi and M. Nakazono (2006) A Point Mutation ofAdh1 Gene is Involved in the Repression of Coleoptile Elongation under Submergence in Rice. Breed. Sci. 56: 69-74&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;/references&amp;gt;&lt;br /&gt;
&lt;br /&gt;
[[Category:Genes]]&lt;br /&gt;
[[Category:Japonica mRNA]]&lt;br /&gt;
[[Category:Oryza Sativa Japonica Group]]&lt;br /&gt;
[[Category:Japonica Genes]]&lt;br /&gt;
[[Category:Japonica Chromosome 11]]&lt;br /&gt;
[[Category:Chromosome 11]]&lt;/div&gt;</summary>
		<author><name>Lmw2015</name></author>	</entry>

	<entry>
		<id>https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os11g0184900&amp;diff=248900</id>
		<title>Os11g0184900</title>
		<link rel="alternate" type="text/html" href="https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os11g0184900&amp;diff=248900"/>
				<updated>2015-06-12T04:22:37Z</updated>
		
		<summary type="html">&lt;p&gt;Lmw2015: /* Structured Information */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;Please input one-sentence summary here.&lt;br /&gt;
&lt;br /&gt;
The ''OsNAC5'' gene is a member of plant specific NAC family in rice that encodes a transcript factor to regulate stress responses.&lt;br /&gt;
==Annotated Information==&lt;br /&gt;
===Function===&lt;br /&gt;
Stress-responsive proteins OsNAC5 is a transcriptional activator induced by abiotic stress,including drought,cold and high salinity.By microarray analysis,OsNAC5 upregulates many stress-inducible genes,including ''OsLEA3''( the late embryogenesis abundant gene) and ''Os06g0681200'' in rice plant that overexpressed ''OsNAC5''.By gel mobility shift assay demonstrated that this protein bind specifically to the NAC recognition sequence of the ''OsLEA3'' promoter (-56 to -85) and enhance the expression of this stress-related gene. Moreover,''OsNAC5''-overexpressing plants did not retard growth under non-stressed conditions. Hence, ''OsNAC5'' may be an effective gene to enhance the stress tolerance of rice without inviting growth defects &amp;lt;ref name=&amp;quot;ref1&amp;quot; /&amp;gt;. In addition to abiotic stress, expression of ''OsNAC5'' was also responsive to ABA,MeJA and other plant hormones such as ethylene,IAA,SA and BR could also induce rapid upregulation of ''OsNAC5'' &amp;lt;ref name=&amp;quot;ref2&amp;quot; /&amp;gt;&amp;lt;ref name=&amp;quot;ref3&amp;quot; /&amp;gt;. &lt;br /&gt;
[[File:Fig.1 OsNAC5.png|right|thumb|250px|Fig.1 Expression of OsNAC3, OsNAC4,OsNAC5, OsNAC6 and SNAC1 in response to dehydration, cold temperature(4°C), high salinity, and ABA or MeJA in rice plants(From reference &amp;lt;ref name=&amp;quot;ref1&amp;quot; /&amp;gt;).'']]&lt;br /&gt;
&lt;br /&gt;
OsNAC5 has been characterized as a novel senescence associated ABA-dependent NAC transcription factor &amp;lt;ref name=&amp;quot;ref3&amp;quot; /&amp;gt;. The promoter regions of OsNAC5 which contain a conserved ABRE sequences (ACGTG G/TC) are activated in response to ABA &amp;lt;ref name=&amp;quot;ref1&amp;quot; /&amp;gt;. It is possible that OsNAC5 protein regulates similar transporter genes in rice and that these genes are needed for effective Fe and Zn remobilization &amp;lt;ref name=&amp;quot;ref7&amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
''OsNAC5'' involves in modulating several downstream functional genes (associated with accumulation of compatible solutes,Na+,H2O2 and malondialdehyde. By detecting some metabolic changes,such as greater amounts of Pro and soluble sugars, and less amounts of MDA and H2O2 accumulated in ''OsNAC5''-overexpressing rice plants suggests that it can protect plants from dehydration and oxidative damage in response to abiotic stresses &amp;lt;ref name=&amp;quot;ref2&amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
''OsNAC5'' is a metal homeostasis related gene. Final seed Fe, Zn and protein concentrations were positively correlated with high and early ''OsNAC5'' expression level in flag leaves (the major source of remobilized metals for developing seeds)during panicle emergence stage.(Sperotto et al., 2009)[3].The increase expression of ''OsNAC5''  in NH+4 (compared with NH4+:NO3-) demonstrates that the NAC domain is crucial to plant development &amp;lt;ref name=&amp;quot;ref8&amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
===Mutation===&lt;br /&gt;
[[File:Fig.2 OsNAC5.png|left|thumb|250px|Fig.2 WT, OE1, Ri5 and Ri6 rice seedlings treated with cold (4°C for 6 days),salt stress(200 mM NaCl for 14 days),drought(withholding of water for 15 days).(From reference &amp;lt;ref name=&amp;quot;ref2&amp;quot; /&amp;gt;).'']]&lt;br /&gt;
The knockdown lines (Ri5, Ri6) less tolerant to cold,drought and salt stress, while overexpression of ''OsNAC5'' (OE1) rice seedings conferred greater tolerance to these abiotic stress (Fig.2)&amp;lt;ref name=&amp;quot;ref2&amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
Under the control of the root-specific (RCc3) and constitutive (GOS2) promoters,the overexpressed OsNAC5 could improve rice plant tolerance to drought and high salinity during the vegetative stage of growth.&lt;br /&gt;
Moreover,Root-specific overexpression of OsNAC5 can significantly enlarge the root diameter in transgenic rice plants via enlarging steles and aerenchymas at the reproductive stage of growth(Fig.6)&amp;lt;ref name=&amp;quot;ref4&amp;quot; /&amp;gt;. It suggests the importance of this phenotype to improve grain yield.(Fig.3) &amp;lt;ref name=&amp;quot;ref4&amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
[[File:Fig.6 OsNAC5.png|left|thumb|250px|Fig.6 Light microscopic images of cross-sectioned RCc3:OsNAC5, GOS2:OsNAC5 and NT roots (10 cm down from the ground surface level)during the panicle heading stage. The position of the metaxylem vessel (Me) and aerenchyma (Ae) are indicated. Scale bars, 500 lm in the upper panels and 100 lm in the lower panels.(From reference &amp;lt;ref name=&amp;quot;ref4&amp;quot; /&amp;gt;).'']][[File:Fig.3 OsNAC5.png|left|thum|200px|Fig.3 Drought stress tolerance of RCc3:OsNAC5 and GOS2:OsNAC5 plants.(From reference &amp;lt;ref name=&amp;quot;ref4&amp;quot; /&amp;gt;).'']]&lt;br /&gt;
&lt;br /&gt;
===Expression===&lt;br /&gt;
Each ''OsNAC'' gene has a unique expression pattern. ''OsNAC5'' is predominantly expressed in root and embryo &amp;lt;ref name=&amp;quot;ref5&amp;quot; /&amp;gt;. [[File:Fig 4.OsNAC5.png|center|thumb|200px|Fig.4 Expression patterns of OsNAC5 in different.(From reference &amp;lt;ref name=&amp;quot;ref2&amp;quot; /&amp;gt;).'']]&lt;br /&gt;
&lt;br /&gt;
Surprisingly,later studies found that it expresses in leaves, roots, stems and flowers(Fig.2) and higher expression in flag leaves, non-flag leaves panicles and Lower expression in stems and roots, with no detectable expression in leaf blades of mature plants and young panicles(Fig.7). A possible explanation for such differences in organ specificity could be the use of a different cultivar and of a completely different experiment strategy for transcript detection &amp;lt;ref name=&amp;quot;ref2&amp;quot; /&amp;gt;&amp;lt;ref name=&amp;quot;ref3&amp;quot; /&amp;gt;.&lt;br /&gt;
[[File:Fig 7.OsNAC5.png|center|thumb|200px|Fig.7 Relative expression levels (qRT-PCR, relative to Ubiquitin expression) of OsNAC5 in different rice organs collected during the grain filling stage.(From reference &amp;lt;ref name=&amp;quot;ref3&amp;quot; /&amp;gt;).'']]&lt;br /&gt;
&lt;br /&gt;
{| class='wikitable' style=&amp;quot;text-align:center&amp;quot;&lt;br /&gt;
|-&lt;br /&gt;
! | Primer&lt;br /&gt;
! | Forward primer&lt;br /&gt;
! | Reverse primer&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;1&amp;quot;|Gene amplication&lt;br /&gt;
| | 5′-CGCGGATCCATGGAGTGCGGTGGTGCGCTG-3′;&lt;br /&gt;
| | 5′-CGGGGTACCTTAGAACGGCTTCTGCAGGTAC-3′;(&amp;lt;ref name=&amp;quot;ref2&amp;quot; /&amp;gt;)&lt;br /&gt;
|-&lt;br /&gt;
| rowspan=&amp;quot;2&amp;quot;|RT-PCR&lt;br /&gt;
| | 5′-ATGGAGTGCGGTGGTGCGCT-3′&lt;br /&gt;
| | 5′-TTAGAACGGCTTCTGCAGGT-3′ &amp;lt;ref name=&amp;quot;ref4&amp;quot; /&amp;gt;&lt;br /&gt;
|-&lt;br /&gt;
| | 5′-TTCAAGAACA-CATCCCTG-3′&lt;br /&gt;
| | 5′-GAAGTGAACTGAAGTACC-3′ &amp;lt;ref name=&amp;quot;ref5&amp;quot; /&amp;gt;&lt;br /&gt;
|}&lt;br /&gt;
&lt;br /&gt;
===Evolution===&lt;br /&gt;
[[File:Fig.5 OsNAC5.png|right|thumb|250px|Fig.5 A dendrogram of NAC genes based on the amino-acid sequences of their NAC domains(The tree was made by the neighbor-joining method).(From reference &amp;lt;ref name=&amp;quot;ref5&amp;quot; /&amp;gt;).'']]&lt;br /&gt;
Amino acid sequence analysis revealed that the NAC genes in plants can fall into several subfamilies, such as the NAM, ATAF, and OsNAC3 subfamilies.OsNAC5 and OsNAC6 represent ATAF subfamily in rice &amp;lt;ref name=&amp;quot;ref5&amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
According to phylogenetic relationship, NAC family with 151 members in rice is divided into five groups. OsNAC5 belongs to the third subgroup with SNAC1 and OsNAC6/SNAC2 &amp;lt;ref name=&amp;quot;ref9&amp;quot; /&amp;gt; &amp;lt;ref name=&amp;quot;ref10&amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
===Knowledge Extension===&lt;br /&gt;
Subcellular localization studies using ''OsNAC5''-GFP fusion proteins showed that OsNAC5 is localized to the nucleus.Transactivation assays demonstrated that OsNAC5 is a transcriptional activator that its activation domain lies C-terminal region between aa 273 and 328 &amp;lt;ref name=&amp;quot;ref1&amp;quot; /&amp;gt;. &lt;br /&gt;
&lt;br /&gt;
By yeast two-hybrid screening and pull-down assays in vitro demonstrated that OsNAC5 interacts with other OsNACs including itself to form homodimers and heterodimers. It also suggested that NAC-domain plays complex roles in binding to DNA and proteins&amp;lt;ref name=&amp;quot;ref6&amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
Like others members of the NAM-ATAF-CUC (NAC) protein family，OsNAC5 contains a highly conserved N-terminal NAC-domain and a variable C-terminal domain.C-terminal region comprising the acidic, proline-, and serine-rich elements are responsible for transcriptional activation &amp;lt;ref name=&amp;quot;ref6&amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
==Labs working on this gene==&lt;br /&gt;
*School of Biotechnology and Environmental Engineering, Myongji University, Yongin, 449-728, South Korea&lt;br /&gt;
*Laboratory of Plant Molecular Physiology, Graduate School of Agricultural and Life Sciences, The University of Tokyo, Bunkyo-ku, Tokyo, 1138657, Japan&lt;br /&gt;
*Centro de Biotecnologia, Universidade Federal do Rio Grande do Sul, P.O. Box 15005, 91501-970, Porto Alegre, RS, Brazil&lt;br /&gt;
*State Key Laboratory of Vegetation and Environmental Change, Institute of Botany, The Chinese Academy of Sciences, Beijing, 100093, People’s Republic of China&lt;br /&gt;
*Laboratory of Plant Breeding and Genetics, Graduate School of Agricultural and Life Sciences, University of Tokyo, Yayoi 1-1-1, Bunkyo-ku, Tokyo 113-8657, Japan&lt;br /&gt;
&lt;br /&gt;
==References==&lt;br /&gt;
&amp;lt;references&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref1&amp;quot;&amp;gt;Takasaki H., Maruyama K., Kidokoro S., Ito Y., Fujita Y., et al. (2010) The abiotic stress-responsive NAC-type transcription factor OsNAC5 regulates stress-inducible genes and stress tolerance in rice. Mol Genet Genomics 284: 173–183.&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref2&amp;quot;&amp;gt;Song, S.Y., Chen, Y., Chen, J., Dai, X.Y. and Zhang, W.H. (2011) Physiological mechanisms underlying OsNAC5-dependent tolerance of rice plants to abiotic stress. Planta 234: 331–345.&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref3&amp;quot;&amp;gt;Sperotto RA, Ricachenevsky FK, Duarte GL, BoV T, Lopes KL, et al. (2009) Identification of up-regulated genes in flag leaves during rice grain filling and characterization of OsNAC5, a new ABA-dependent transcription factor. Planta 230: 985–1002.&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref4&amp;quot;&amp;gt;Jeong, J. S., Kim,Y. S., Redillas, M. C. F. R., Jang, G., Jung, H., Bang, S. W.,et al. (2013) OsNAC5 overexpression enlarges root diameter in rice plants leading to enhanced drought tolerance and increased grain yield in the field. Plant Biotechnology Journal, 11: 101–114.&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref5&amp;quot;&amp;gt;Kikuchi K, Ueguchi-Tanaka M, Yoshida KT, Nagato Y, Matsusoka M, et al. (2000) Molecular analysis of the NAC gene family in rice. Mol Gen Genet 262: 1047–1051.&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref6&amp;quot;&amp;gt;Jeong, J.S., Park, Y.T., Jung, H., Park, S.H. and Kim, J.-K. (2009) Rice NAC proteins act as homodimers and heterodimers. Plant Biotechnol. Rep 3: 127–134.&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref7&amp;quot;&amp;gt;Raul A. Sperotto, Tatiana Boff, Guilherme L. Duarte, Lívia S. Santos,Michael A. Grusakc, et al. (2010) Identification of putative target genes to manipulate Fe and Zn concentrations in rice grains. Journal of Plant Physiology 167: 1500–1506.&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref8&amp;quot;&amp;gt;Marta S. Lopes and Jose L. Araus (2008) Comparative genomic and physiological analysis of nutrient response to NH4+, NH4+: NO3- and NO3- in barley seedlings. Physiologia Plantarum 134: 134–150.&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref9&amp;quot;&amp;gt;Fang YJ, You J, Xie KB, Xie WB, Xiong LZ (2008) Systematic sequence analysis and identification of tissue-specific or stressresponsive genes of NAC transcription factor family in rice. MolGenet Genomics 280: 547–563.&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref10&amp;quot;&amp;gt;Nuruzzaman M, Manimekalai R, Sharoni AM, Satoh K, Kondoh H,et al. (2010) Genome-wide analysis of NAC transcription factor family in rice. Gene 465: 30–44.&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;/references&amp;gt;&lt;br /&gt;
[[Category:Genes]]&lt;br /&gt;
[[Category:Japonica mRNA]]&lt;br /&gt;
[[Category:Oryza Sativa Japonica Group]]&lt;br /&gt;
[[Category:Japonica Genes]]&lt;br /&gt;
[[Category:Japonica Chromosome 11]]&lt;br /&gt;
[[Category:Chromosome 11]]&lt;/div&gt;</summary>
		<author><name>Lmw2015</name></author>	</entry>

	<entry>
		<id>https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os11g0171800&amp;diff=248899</id>
		<title>Os11g0171800</title>
		<link rel="alternate" type="text/html" href="https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os11g0171800&amp;diff=248899"/>
				<updated>2015-06-12T04:22:15Z</updated>
		
		<summary type="html">&lt;p&gt;Lmw2015: /* Structured Information */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;&lt;br /&gt;
[[Category:Genes]]&lt;br /&gt;
[[Category:Japonica mRNA]]&lt;br /&gt;
[[Category:Oryza Sativa Japonica Group]]&lt;br /&gt;
[[Category:Japonica Genes]]&lt;br /&gt;
[[Category:Japonica Chromosome 11]]&lt;br /&gt;
[[Category:Chromosome 11]]&lt;/div&gt;</summary>
		<author><name>Lmw2015</name></author>	</entry>

	<entry>
		<id>https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os11g0171800&amp;diff=248898</id>
		<title>Os11g0171800</title>
		<link rel="alternate" type="text/html" href="https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os11g0171800&amp;diff=248898"/>
				<updated>2015-06-12T04:22:03Z</updated>
		
		<summary type="html">&lt;p&gt;Lmw2015: /* Structured Information */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;Please input one-sentence summary here.&lt;br /&gt;
&lt;br /&gt;
==Annotated Information==&lt;br /&gt;
===Function===&lt;br /&gt;
Please input function information here.&lt;br /&gt;
&lt;br /&gt;
===Expression===&lt;br /&gt;
Please input expression information here.&lt;br /&gt;
&lt;br /&gt;
===Evolution===&lt;br /&gt;
Please input evolution information here.&lt;br /&gt;
&lt;br /&gt;
You can also add sub-section(s) at will.&lt;br /&gt;
&lt;br /&gt;
==Labs working on this gene==&lt;br /&gt;
Please input related labs here.&lt;br /&gt;
&lt;br /&gt;
==References==&lt;br /&gt;
Please input cited references here.&lt;br /&gt;
&lt;br /&gt;
[[Category:Genes]]&lt;br /&gt;
[[Category:Japonica mRNA]]&lt;br /&gt;
[[Category:Oryza Sativa Japonica Group]]&lt;br /&gt;
[[Category:Japonica Genes]]&lt;br /&gt;
[[Category:Japonica Chromosome 11]]&lt;br /&gt;
[[Category:Chromosome 11]]&lt;/div&gt;</summary>
		<author><name>Lmw2015</name></author>	</entry>

	<entry>
		<id>https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os11g0167800&amp;diff=248897</id>
		<title>Os11g0167800</title>
		<link rel="alternate" type="text/html" href="https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os11g0167800&amp;diff=248897"/>
				<updated>2015-06-12T04:21:34Z</updated>
		
		<summary type="html">&lt;p&gt;Lmw2015: /* Structured Information */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;Please input one-sentence summary here.&lt;br /&gt;
&lt;br /&gt;
==Annotated Information==&lt;br /&gt;
===Function===&lt;br /&gt;
Among cereal crops, rice is considered the most tolerant toaluminium (Al). However, variability among rice genotypes leads to remarkable differences in the degree of Al tolerance for distinct cultivars. A number of studies have demonstrated that rice plants achieve Al tolerance through an unknown mechanism that is independent of root tip Al exclusion. We have analysed expression changes of the rice ASRgene family as a function of Al treatment. The gene ASR5was differentially regulated in the Al-tolerant ricessp. Japonica cv. Nipponbare. However,ASR expression did not respond to Al exposure in Indica cv. Taim rice roots,which are highly Al sensitive. Transgenic plants carrying RNAi constructs that targeted theASRgenes wereobtained, and increased Al susceptibility was observed in T1 plants. Embryogenic calli of transgenic rice carrying an ASR5-green fluorescent protein fusion revealed that ASR5 was localized in both the nucleus and cytoplasm. Using a proteomic approach to compare non-transformed and ASR-RNAi plants, a total of 41 proteins with contrasting expression patterns were identified. We suggest that the ASR5 protein acts as a transcription factor to regulate the expression of different genes that collectively protect rice&lt;br /&gt;
cells from Al-induced stress responses.&lt;br /&gt;
&lt;br /&gt;
===Expression===&lt;br /&gt;
Please input expression information here.&lt;br /&gt;
    Aluminium (Al) is the most abundant metal, accounting for approximately 7% of Earth’s mass. Regardless of its abundance,Al is not considered an essential nutrient; however, it can occasionally stimulate plant growth or induce other desirable effects when present atlow concentrations (Foy1983). Most Al is chelated by ligands or is present in non-toxic forms, such as aluminosilicates or precipitates. Al-induced toxicity can occur through solubilization of Al in soils under highly acidic conditions (pH below 5.0)(Famoso et al. 2010). It has been estimated that approximately 50% of arable land is negatively impacted by Al toxicity that results from acidic soil(Panda,Baluska&amp;amp;Matsumoto 2009). Al toxicity is considered a primary limiting factor in regard to agricultural productivity (Matsumoto 2000) because it inhibits root growth and mineral absorption (Liu &amp;amp; Luan 2001), leading to a stunted root system that negatively impacts the uptake of water and nutrients.There are many potential cellular locations that could be damaged through interaction with Al, including the cell wall, the surface of the plasma membrane, the cytoskeleton and the nucleus (Pandaet al. 2009). For example, it has been demonstrated that Al binds strongly to the cell wall of root epidermal and cortical cells (Delhaize, Ryan &amp;amp; Randall1993). However, some plants are able to tolerate toxic levels of Al in acidic soils. These plants have evolved mechanisms to detoxify Al that is both present internally and externally(Kochian, Pineros &amp;amp; Hoekenga 2005). To achieve internal detoxification, plants accumulate Al inside vacuoles, where it is chelated with organic acids (OA), such as citrate and oxalate (Ma 2007). In contrast, the majority of Al-tolerant plants exclude Al from the root tip by releasing OA at sites of high Al concentration; examples of these acids include malate, citrate and oxalate (Ma, Ryan &amp;amp; Delhaize 2001; Kochian, Hoekenga &amp;amp; Pineros 2004). In species such as sorghum and wheat, the OA–Al complex prevents Al from entering the cell (Sasakiet al. 2004; Magalhaes et al. 2007),which reduces the concentration and potential toxicity of Al at the growing root tip (Ma et al. 2001). &lt;br /&gt;
    Rice is considered the most Al-tolerant crop (Fageria1989; Duncan &amp;amp; Baligar 1990); however, there is variability among different rice genotypes, resulting in widely varied tolerance levels among different cultivars (Ferreira 1995).In two independent studies, Ma et al. (2002) and Yang et al.(2008) observed no OA exudation and increased Al accumulation in the root apex of Al-susceptible rice strains relative to Al-tolerant strains. These results demonstrate that rice plants achieve high levels of Al tolerance through anovel mechanism that does not involve root tip Al exclusion(Famosoet al. 2010). Although genetic studies in rice have identified more than 10 quantitative trait loci for Al tolerance, the responsible genes have only recently been cloned (Huang et al. 2009). The genes STAR1andSTAR2were isolated from an Al-tolerant cultivar irradiated withg-rays (Ma et al.2005). The disruption of either gene resulted in hypersensitivity to Al toxicity. STAR1encodes a nucleotide-bindingdomain protein, and STAR2 encodes a transmembrane domain protein of a bacterial-type ATP-binding cassette (ABC) transporter. Analyses indicated that STAR1 and STAR2form a complex that functions as an ABC transporter that is required for detoxification of Al in rice. The ABC transporter transports uridine diphosphate (UDP)-glucose, which may be used to modify the cell wall (Huanget al. 2009). Yamajiet al. (2009) isolated the zinc finger transcription factor ART1, which regulates multiple rice genes implicated in Al tolerance. Genes regulated by ART1 include STAR1, STAR2andNrat1, the latter of which is a specific transporter that mediates the sequestration of trivalent Al ions into vacuoles to achieve Al detoxification (Xia et al. 2010).&lt;br /&gt;
    Using a proteomic approach, Yanget al. (2007) identified some proteins responsive to Al in rice roots; ASR5 was more highly expressed in these roots. TheASR(abscisic acid, stress and ripening) gene was first described in tomato(Iusemet al. 1993). Subsequently,ASRgenes were found to be widely distributed in the vegetal kingdom, having been identified in potato (Silhavyet al. 1995), pinus (Chang et al. 1996), maize (Riccardi et al. 1998), rice (Vaidyanathan,Kuruvila &amp;amp; Thomas 1999), sugarcane (Sugihartoet al. 2002),grape (Cakir et al. 2003) and others. Nevertheless, ASR genes do not occur in the genome ofArabidopsis thaliana(Maskinet al. 2001). ASRgenes are expressed during fruit ripening and are induced in response to ABA and various abiotic stresses, including water and salt stresses (Carrari,Fernie &amp;amp; Iusem 2004). Kalifaet al. (2004a) demonstrated that tomato ASR1 proteins were present as unstructured monomers localized in the cytosol and as structured homodimers in the nucleus, where they can bind DNA.Cytosolic tomato ASR1 performs a chaperone-like activityand can stabilize a number of proteins, protecting them from denaturation induced by repeated freeze/thaw cycles(Konrad &amp;amp; Bar-Zvi 2008). Furthermore, a grape ASR protein binds to the promoter of a hexose transporter gene(Cakiret al. 2003), suggesting that it may be a transcription factor that is involved in sugar metabolism.In silicoanalyses mapped the locations of six copies ofASRgenes in the rice genome in different chromosomes; these loci were confirmed by expressed sequence tags (ESTs) (Frankel et al.2006). &lt;br /&gt;
    In this study, we analysed changes in gene expression of the riceASRfamily in response to Al treatment. We found that all members of the ASRgene family display a variable degree of expression, indicating thatASRgenes of the tolerant Japonica rice (cv. Nipponbare) are differentially regulated in response to Al. Conversely,ASR5did not respond to Al exposure in Indica rice roots (cv. Taim), which unlike the Nipponbare cultivar, is highly sensitive to Al (Freitas et al. 2006).According to Maet al. (2002), Japonica varieties are often more resistant to Al than the Indica varieties. Inaddition to gene expression analyses, transgenic plants carrying RNAi constructs targeting theASRgenes were made,and an increased Al susceptibility was observed in T1 plants. In addition, transgenic embryogenic calli of rice carrying an ASR5-green fluorescent protein (GFP) fusion protein revealed that ASR5 is located in both the nucleus and the cytoplasm, suggesting that ASR5 may act as a transcription factor.&lt;br /&gt;
&lt;br /&gt;
===Evolution===&lt;br /&gt;
Please input evolution information here.&lt;br /&gt;
&lt;br /&gt;
You can also add sub-section(s) at will.&lt;br /&gt;
&lt;br /&gt;
==Labs working on this gene==&lt;br /&gt;
Please input related labs here.&lt;br /&gt;
&lt;br /&gt;
==References==&lt;br /&gt;
Please input cited references here.&lt;br /&gt;
&lt;br /&gt;
[[Category:Genes]]&lt;br /&gt;
[[Category:Japonica mRNA]]&lt;br /&gt;
[[Category:Oryza Sativa Japonica Group]]&lt;br /&gt;
[[Category:Japonica Genes]]&lt;br /&gt;
[[Category:Japonica Chromosome 11]]&lt;br /&gt;
[[Category:Chromosome 11]]&lt;/div&gt;</summary>
		<author><name>Lmw2015</name></author>	</entry>

	<entry>
		<id>https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os11g0127600&amp;diff=248896</id>
		<title>Os11g0127600</title>
		<link rel="alternate" type="text/html" href="https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os11g0127600&amp;diff=248896"/>
				<updated>2015-06-12T04:21:14Z</updated>
		
		<summary type="html">&lt;p&gt;Lmw2015: /* Structured Information */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;''ONAC045'', is a rice NAC(NAM, ATAF1/2, CUC2) gene and belongs to The plant-specific NAC transcription factors, which play diverse roles in plant development and stress responses&amp;lt;ref name=&amp;quot;ref1&amp;quot;/&amp;gt;&amp;lt;ref name=&amp;quot;ref2&amp;quot;/&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
==Annotated Information==&lt;br /&gt;
===Function===&lt;br /&gt;
''ONAC045'' was induced by drought, high salt, and low temperature stresses, and abscisic acid (ABA) treatment in leaves and roots. It functioned as a transcriptional activator. ''ONAC045'' encodes a novel stress-responsive NAC transcription factor and is potential useful for engineering drought and salt tolerant rice&amp;lt;ref name=&amp;quot;ref1&amp;quot;/&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
'''GO assignment(s):''' [http://amigo.geneontology.org/amigo/term/GO:0003677 GO:0003677], GO:0045449&lt;br /&gt;
&lt;br /&gt;
===Mutation===&lt;br /&gt;
[[File: ONAC045 transgenic.jpg|left|thumb|300px|'''Figure 1.'''''Drought tolerance assays of ONAC045-overexpressing transgenic rice.(from reference &amp;lt;ref name=&amp;quot;ref1&amp;quot;/&amp;gt;)'']]&lt;br /&gt;
transgenic rice plants&amp;lt;ref name=&amp;quot;ref1&amp;quot;/&amp;gt;:&lt;br /&gt;
In order to characterize the in vivo function of ''ONAC045'', transgenic rice plants overexpressing this gene were generated. The T2&lt;br /&gt;
generations of two homozygous transgenic lines, overexpression line 2 (OE2) and overexpression line 3 (OE3), were used for stress&lt;br /&gt;
tolerance assay. We tested the effect of ''ONAC045'' overexpression on drought tolerance. As shown in Fig. 1A and B, more than 90% of OE2 and more than 70% of OE3 remained vigorous respectively after recovery, while only about 35% of wide type survived, suggesting that overexpression of ONAC045 could improve drought tolerance in transgenic rice. The effect of ''ONAC045'' overexpression on salt tolerance was also investigated. As shown in Fig. 1C and D, the survival rates of OE2 and OE3 were more than 60%, significantly higher than that of WT plants (16%), suggesting that overexpression of ''ONAC045'' could improve salt tolerance in transgenic rice.&lt;br /&gt;
&lt;br /&gt;
===Expression===&lt;br /&gt;
[[File: ONAC045 expression1.jpg|right|thumb|400px|'''Figure 2.'''''Expression pattern of ONAC045 in Guangluai 4 was detected by real-time RT-PCR.(from reference &amp;lt;ref name=&amp;quot;ref1&amp;quot;/&amp;gt;)'']]&lt;br /&gt;
*Expression pattern of ''ONAC045'' in young leaves, young roots, mature leaves, stems, and panicles was investigated using realtime&lt;br /&gt;
RT-PCR. It was shown that the expression level was higher in young roots than in other organs examined (Fig. 2A). The expression pattern of ''ONAC045'' under various stress treatments in leaves and roots was also investigated (Fig. 2B).Expression analysis showed that ''ONAC045'' was highly induced by drought, salt, cold, and ABA in leaves and roots. Interestingly, the expression pattern was different between leaves and roots. For example, after salt treatment, the induced expression was much higher in roots than that in leaves at all three examined time points, suggesting that the expression of ''ONAC045'' was differently regulated in leaves and roots. A previous study showed that ''ONAC045'' was not induced under drought treatment in leaves&amp;lt;ref name=&amp;quot;ref3&amp;quot;/&amp;gt; , which was different with our results here (Fig. 2B).&lt;br /&gt;
*Transgenic rice plants overexpressing ''ONAC045'' showed enhanced drought and salt tolerance, indicating that ''ONAC045'' played an important role in abiotic stress response and may serve as a potential target for engineering stress tolerant rice.&lt;br /&gt;
*Overexpression of ''ONAC045'' induced expression of two stressresponsive genes: the expression levels of a late embryogenesis abundant (LEA) gene and a homologue gene of wheat plasma membrane protein (WPM-1) were strongly induced in transgenic rice compared with that in wild type rice under normal growth condition.&lt;br /&gt;
&lt;br /&gt;
===Subcellular localization===&lt;br /&gt;
Yeast two-hybrid system was used to investigate the transcriptional activation of ''ONAC045''. The results indicate that ''ONAC045'' had transcriptional activation and was localized in the nucleus&amp;lt;ref name=&amp;quot;ref1&amp;quot;/&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
===Evolution===&lt;br /&gt;
Systematic sequence analysis revealed 140 putative NAC or NAC-like genes (ONAC) in rice&amp;lt;ref name=&amp;quot;ref3&amp;quot;/&amp;gt;.&lt;br /&gt;
Phylogenetic analysis suggested that NAC family can be divided into five groups (I–V). Among them, all the published development-related genes fell into group I, and all the published stress-related NAC genes fell into the group III (namely stress-responsive NAC genes, SNAC). Distinct compositions of the putative motifs were revealed on the basis of NAC protein sequences in rice. Most members contained a complete NAC DNA-binding domain and a variable transcriptional regulation domain. Sequence analysis, together with the organization of putative motifs, indicated distinct structures and potential diverse functions of NAC family in rice&amp;lt;ref name=&amp;quot;ref3&amp;quot;/&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
===Knowledge Extension===&lt;br /&gt;
[[File: ONAC045 TFs.jpg|left|thumb|300px|'''Figure 3.'''''A model representing the regulation of NAC TFs at different levels&lt;br /&gt;
during stress.(from reference &amp;lt;ref name=&amp;quot;ref2&amp;quot;/&amp;gt;).'']]&lt;br /&gt;
*The complex post-transcriptional regulation involves micro-RNA (miRNA)-mediated cleavage of genes (Figure 3).NAC TFs also undergo intensive post-translational regulation which includes protein degradation mediated by ubiquitins, dimerization and interaction with other non-NAC proteins.Upon translation, such DREB-type and AREB-type proteins could counter-control the transcription of NAC genes. Furthermore, expression of stress-responsive NACs may be tightly regulated by several stress-responsive cis-acting elements contained in the promoter region&amp;lt;ref name=&amp;quot;ref2&amp;quot;/&amp;gt;(Figure 3).&lt;br /&gt;
*NAC family, which is one of the largest plant transcription factor families, is only found in plants to date&amp;lt;ref name=&amp;quot;ref4&amp;quot;/&amp;gt;. Proteins of this family are characterized by a highly conserved DNA binding domain, known as NAC domain in the N-terminal region. In contrast, the C-terminal region of NAC proteins, usually containing the transcriptional activation domain, is highly diversified both in length and sequence&amp;lt;ref name=&amp;quot;ref5&amp;quot;/&amp;gt;. More than 100 members of this family have been identified in both Arabidopsis and rice&amp;lt;ref name=&amp;quot;ref3&amp;quot;/&amp;gt;&amp;lt;ref name=&amp;quot;ref5&amp;quot;/&amp;gt;. However, only a few of them have been functionally characterized, especially in rice. NACs play important roles in plant development, including pattern formation of embryos and flowers, formation of secondary walls, and development of lateral roots. NACs are also reported to participate in abiotic and biotic responses.&lt;br /&gt;
*Genetic improvement in drought tolerance in rice is the key to save water for sustainable agriculture. Drought tolerance is a complex trait and involves interplay of a vast array of genes. Several genotypes of rice have evolved features that impart tolerance&lt;br /&gt;
to drought and other abiotic stresses&amp;lt;ref name=&amp;quot;ref6&amp;quot;/&amp;gt;.&lt;br /&gt;
==Labs working on this gene==&lt;br /&gt;
*National Center for Gene Research &amp;amp; Shanghai Institute of Plant Physiology and Ecology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, 500 Caobao Road, Shanghai 200233, China&lt;br /&gt;
*National Institute of Plant Genome Research, Aruna Asaf Ali Marg, New Delhi-110067, India&lt;br /&gt;
*Department of Biotechnology, Faculty of Science, Jamia Hamdard, New Delhi-110062, India&lt;br /&gt;
&lt;br /&gt;
==References==&lt;br /&gt;
&amp;lt;references&amp;gt;&lt;br /&gt;
* &amp;lt;ref name=&amp;quot;ref1&amp;quot;&amp;gt;&lt;br /&gt;
Zheng X, Chen B, Lu G, et al. Overexpression of a NAC transcription factor enhances rice drought and salt tolerance[J]. Biochemical and biophysical research communications, 2009, 379(4): 985-989.&lt;br /&gt;
&amp;lt;/ref&amp;gt;&lt;br /&gt;
* &amp;lt;ref name=&amp;quot;ref2&amp;quot;&amp;gt;&lt;br /&gt;
Puranik S, Sahu P P, Srivastava P S, et al. NAC proteins: regulation and role in stress tolerance[J]. Trends in plant science, 2012, 17(6): 369-381.&lt;br /&gt;
&amp;lt;/ref&amp;gt;&lt;br /&gt;
* &amp;lt;ref name=&amp;quot;ref3&amp;quot;&amp;gt;&lt;br /&gt;
Fang Y, You J, Xie K, et al. Systematic sequence analysis and identification of tissue-specific or stress-responsive genes of NAC transcription factor family in rice[J]. Molecular Genetics and Genomics, 2008, 280(6): 547-563.&lt;br /&gt;
&amp;lt;/ref&amp;gt;&lt;br /&gt;
* &amp;lt;ref name=&amp;quot;ref4&amp;quot;&amp;gt;&lt;br /&gt;
Riechmann J L, Heard J, Martin G, et al. Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes[J]. Science, 2000, 290(5499): 2105-2110.&lt;br /&gt;
&amp;lt;/ref&amp;gt;&lt;br /&gt;
* &amp;lt;ref name=&amp;quot;ref5&amp;quot;&amp;gt;&lt;br /&gt;
Ooka H, Satoh K, Doi K, et al. Comprehensive analysis of NAC family genes in Oryza sativa and Arabidopsis thaliana[J]. DNA research, 2003, 10(6): 239-247.&lt;br /&gt;
&amp;lt;/ref&amp;gt;&lt;br /&gt;
* &amp;lt;ref name=&amp;quot;ref6&amp;quot;&amp;gt;&lt;br /&gt;
Lenka S K, Katiyar A, Chinnusamy V, et al. Comparative analysis of drought‐responsive transcriptome in Indica rice genotypes with contrasting drought tolerance[J]. Plant biotechnology journal, 2011, 9(3): 315-327.&lt;br /&gt;
&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;/references&amp;gt;&lt;br /&gt;
&lt;br /&gt;
[[Category:Genes]]&lt;br /&gt;
[[Category:Japonica mRNA]]&lt;br /&gt;
[[Category:Oryza Sativa Japonica Group]]&lt;br /&gt;
[[Category:Japonica Genes]]&lt;br /&gt;
[[Category:Japonica Chromosome 11]]&lt;br /&gt;
[[Category:Chromosome 11]]&lt;/div&gt;</summary>
		<author><name>Lmw2015</name></author>	</entry>

	<entry>
		<id>https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os11g0126100&amp;diff=248895</id>
		<title>Os11g0126100</title>
		<link rel="alternate" type="text/html" href="https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os11g0126100&amp;diff=248895"/>
				<updated>2015-06-12T04:20:38Z</updated>
		
		<summary type="html">&lt;p&gt;Lmw2015: /* Structured Information */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;Please input one-sentence summary here.&lt;br /&gt;
&lt;br /&gt;
==Annotated Information==&lt;br /&gt;
===Function===&lt;br /&gt;
Fe homeostasis&lt;br /&gt;
&lt;br /&gt;
===Expression===&lt;br /&gt;
Please input expression information here.&lt;br /&gt;
&lt;br /&gt;
===Evolution===&lt;br /&gt;
Please input evolution information here.&lt;br /&gt;
&lt;br /&gt;
You can also add sub-section(s) at will.&lt;br /&gt;
&lt;br /&gt;
==Labs working on this gene==&lt;br /&gt;
Please input related labs here.&lt;br /&gt;
&lt;br /&gt;
==References==&lt;br /&gt;
Please input cited references here.&lt;br /&gt;
&lt;br /&gt;
[[Category:Genes]]&lt;br /&gt;
[[Category:Japonica mRNA]]&lt;br /&gt;
[[Category:Oryza Sativa Japonica Group]]&lt;br /&gt;
[[Category:Japonica Genes]]&lt;br /&gt;
[[Category:Japonica Chromosome 11]]&lt;br /&gt;
[[Category:Chromosome 11]]&lt;/div&gt;</summary>
		<author><name>Lmw2015</name></author>	</entry>

	<entry>
		<id>https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os11g0117400&amp;diff=248894</id>
		<title>Os11g0117400</title>
		<link rel="alternate" type="text/html" href="https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os11g0117400&amp;diff=248894"/>
				<updated>2015-06-12T04:20:17Z</updated>
		
		<summary type="html">&lt;p&gt;Lmw2015: /* Structured Information */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;RNA gel blot analysis indicated that OsWRKY89 was strongly induced by treatments of methyljasmonate and UV-B radiation. The transient expression analysis of the OsWRKY89–eGFP reporter in onion epidermal cells revealed that OsWRKY89 was targeted to nuclei. Transcriptional activity assays of OsWRKY89 and its mutants fused with a GAL4 DNA binding domain indicated that the 67 C-terminal aminoacids were required for the transcriptional activation and that the leucine zipper region at the N-terminus enhancedits transcriptional activity.&lt;br /&gt;
&lt;br /&gt;
==Annotated Information==&lt;br /&gt;
===Function===&lt;br /&gt;
Please input function information here.&lt;br /&gt;
&lt;br /&gt;
WRKY genes are a family of transcriptional regulatory factors that have specific functions in plants.Plant WRKY gene-encoded transcriptional regulators appear to be involved in various physiological programs, including disease-resistance,senescence,stress responses of biotic and abiotic, growth and development processes&amp;lt;ref name=&amp;quot;ref4&amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
===Expression===&lt;br /&gt;
Please input expression information here.&lt;br /&gt;
&lt;br /&gt;
Expression of OsW89p::GUS was observed in leaves, stems, and sheaths; pollens hadn't expression; mature seeds hadn't expression; the embryos of germinating seeds had expression; primary roots, adventitious roots and their lateral roots had expression but not in root tips of seedling stage; only lateral roots had expressin in roots of maturation phase&amp;lt;ref name=&amp;quot;ref4&amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
Analyzing inducible expression pattern in T1 transgenic seedlings, the results showed: expression level of OsW89p::GUS can be increased by MeJA, IAA, ultraviolet, high temperature, low temperature and wounding treatment, inducible effects of MeJA and ultraviolet were distinct; and can be restrined by 2, 4-D; ABA and SA can't influence OsW89p::GUS expession; NaCl and PEG can restrain expression level of OsW89p::GUS in roots but increase expression level in leaves.GUS activity of OsW89p::GUS was higher than 35s::GUS in trangenic plants.In conclusion,we thought OsWRKY89 gene promoter was an inducible promoter with tissue specific expression characteristic&amp;lt;ref name=&amp;quot;ref4&amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
RNA gel blot analysis indicated that OsWRK Y89 was strongly induced by treatments of methyl jasmonate and UV-B &lt;br /&gt;
radiation. The transient expression analysis of the OsWRKY89–eGFP reporter in onion epidermal cells revealed that OsWR KY89 was targeted to nuclei. Transcriptional activity assays of OsWRKY89 and its mutants fused with a GAL4 DNA binding domain indicated that the 67 C-terminal amino acids were required for the transcrip tional activation and that the leucine zipper region at the N-term inus enhanced its transcriptional activity. Overexpression of OsWRKY89 led to growth retardation at the early stage and reduction of internode length. Scanning electron microscopy revealed an increase in wax deposition on leaf surfaces of the OsWRKY89 overexpression lines and a decrease in wax loading in the RNAi-me diated OsW RKY89 suppression lines. Moreover, extractable and cell-wall-bound phenolic compounds were decreased in the overexpressor lines, but its SA levels were increased. Lignin staining showed an increase in lignification inculms of the overexpressor lines. Intere stingly, overexpression of the OsWRKY89 gene enhanced resistance to the rice blast fungus and white-backed planthop per as well as tolerance to UV-B irradia-tion. These results suggest that OsW RKY89 plays an important role in response to biotic and abiotic stresses&amp;lt;ref name=&amp;quot;ref1&amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
[[File:图片1.png]]&lt;br /&gt;
&lt;br /&gt;
The inducible expression characteristic of OsW89p in rice detected by GUS fluorometric measurement revealed that:1)Expression level of GUS was increased 4-fold by MeJA treatment, and repressed by the presence of 2, 4-D, but was not influenced by salicylic acid; 2)The expression of GUS was repressed in the roots and promoted in the leaves by NaCl and PEG;3)Ultraviolet, high temperature(42°C), low temperature(5°C)and injury treatments can increase the expression of GUS leaves, and the induced efficiency of ultraviolet was the highest&amp;lt;ref name=&amp;quot;ref3&amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
===Evolution===&lt;br /&gt;
Please input evolution information here.&lt;br /&gt;
&lt;br /&gt;
Accordingly, the rice genome has been pre-dicted to contain 1,611 transcription factors. However the genome of single-celled yeast Saccharomyces cerevi-sae contains only 12% of these genes. Thereby, indi-cating that evolution from primitive to complex life forms involves an increase or expansion in regulator genes. Sequence specific DNA-binding transcription regulators act in concert with other components of the transcriptional machinery to modulate the expression of specific target genes in temporal and spatial manner, necessary for normal development and proper response to physiological or&lt;br /&gt;
environmental stimuli. Transcription factors are identified and classified according to their DNA-binding domains&lt;br /&gt;
(DBDs) and therefore, the names of the DBDs, e.g., AP2/ERF (or EREBP), WRKY, NAC, are also used as thenames of the transcription factor families&amp;lt;ref name=&amp;quot;ref5&amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
WRKY family shows evolution from simpler unicellular to more complex multicellular forms. As compared to pine, fern and moss, flowering plants, have the largest WRKY family, indicating that these transcription factors play an important&lt;br /&gt;
regulatory role in flowering plants. The group III genes are greatly amplified in monocots and are most advanced in evolution and most successful in adaptability. The rice WRKY genes of group III are evolutionarily more active, as they evolved due to tandem and segmental gene duplication compared with those of Arabidopsis and therefore, may have specific roles in monocots&amp;lt;ref name=&amp;quot;ref5&amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
===Knowledge Extension===&lt;br /&gt;
Please input evolution information here.&lt;br /&gt;
&lt;br /&gt;
You can also add sub-section(s) at will.&lt;br /&gt;
&lt;br /&gt;
WRKY genes encode transcription factors that are involved in the regulation of various biological processes. These&lt;br /&gt;
zinc-finger proteins, especially those members mediating stress responses, are uniquely expanded in plants&amp;lt;ref name=&amp;quot;ref2&amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
The WRKY gene family, important for plant development and responses to both biotic and abiotic stresses, has encoun-tered several duplication and deletion events in very recent evolutionary history in  Oryza sativa. Completing the annotation&lt;br /&gt;
of this family in rice will enable the determination of whether these changes are simply neutral occurrences in a heavily&lt;br /&gt;
redundant family of transcription factors or whether they ac-tively contributed to the variation between modern rice sub-species and cultivars. Mounting evidence indicates that  WRKY genes modulate the signaling networks for all hormones and&lt;br /&gt;
regulate the biosynthesis of starch, sesquiterpene, and alka-loids in a variety of plants, including important crops. There is no doubt that studies of this family of transcription factors will not only further our understanding of the fundamental pro-cesses that are controlled by WRKY genes, but also help en-hance agricultural productivity&amp;lt;ref name=&amp;quot;ref2&amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
==Labs working on this gene==&lt;br /&gt;
Please input related labs here.&lt;br /&gt;
&lt;br /&gt;
Department of Plant Pathology, State Key Laboratory of Agrobiotechnology, China Agricultural University, Yuanmenyuan West Rd. 2, Beijing 100094, China&lt;br /&gt;
&lt;br /&gt;
Biotechnology Institute, Zhejiang University, Hangzhou 310029, China&lt;br /&gt;
&lt;br /&gt;
Department of Biological Sciences, Hunan University of Science and Technology, Xiangtan 411201, China&lt;br /&gt;
&lt;br /&gt;
Institute of Insect Sciences, Zhejiang University, Hangzhou 310029, China&lt;br /&gt;
&lt;br /&gt;
Bioinformatics Core, School of Life Sciences, University of Nevada, Las Vegas, Nevada 89154, USA&lt;br /&gt;
&lt;br /&gt;
College of Agriculture and Biotechnology Zhejiang University, Hangzhou, P. R. China May. 2005&lt;br /&gt;
&lt;br /&gt;
Central Salt and Marine Chemicals Research Institute, Council of Scientific and Industrial Research, Bhavnagar 364021, India&lt;br /&gt;
&lt;br /&gt;
==References==&lt;br /&gt;
&amp;lt;references&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref1&amp;quot;&amp;gt;Haihua Wang;Junjie Hao;Xujun Chen;Zhongna Hao;Xia Wang;Yonggen Lou;Youliang Peng;Zejian Guo&lt;br /&gt;
  Overexpression of rice WRKY89 enhances ultraviolet B tolerance and disease resistance in rice plants&lt;br /&gt;
  Plant Molecular Biology, 2007, 65(6): 799-815.&amp;lt;/ref&amp;gt; &lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref2&amp;quot;&amp;gt;Christian A. Ross;Yue Liu;Qingxi J. Shen&lt;br /&gt;
  The WRKY Gene Family in Rice (Oryza sativa)&lt;br /&gt;
  Journal of Integrative Plant Biology, 2007, 49(6): 827-842.&amp;lt;/ref&amp;gt; &lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref3&amp;quot;&amp;gt;郝中娜;王海华;郭泽建&lt;br /&gt;
  水稻OsWRKY89基因启动子的表达特性&lt;br /&gt;
  中国水稻科学, 2006, 20(2): 125-130.&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref4&amp;quot;&amp;gt;郝中娜 (2005). &lt;br /&gt;
  水稻 WRKY19 和 WRKY89 基因启动子的分析, 浙江大学.&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref5&amp;quot;&amp;gt;Agarwal, P., M. Reddy, et al. (2011). &amp;quot;WRKY: its structure, evolutionary relationship, DNA-binding selectivity, role in stress tolerance and development of plants.&amp;quot; Molecular biology reports 38(6): 3883-3896.&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;/references&amp;gt;&lt;br /&gt;
&lt;br /&gt;
[[Category:Genes]]&lt;br /&gt;
[[Category:Japonica mRNA]]&lt;br /&gt;
[[Category:Oryza Sativa Japonica Group]]&lt;br /&gt;
[[Category:Japonica Genes]]&lt;br /&gt;
[[Category:Japonica Chromosome 11]]&lt;br /&gt;
[[Category:Chromosome 11]]&lt;/div&gt;</summary>
		<author><name>Lmw2015</name></author>	</entry>

	<entry>
		<id>https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os11g0116200&amp;diff=248893</id>
		<title>Os11g0116200</title>
		<link rel="alternate" type="text/html" href="https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os11g0116200&amp;diff=248893"/>
				<updated>2015-06-12T04:19:52Z</updated>
		
		<summary type="html">&lt;p&gt;Lmw2015: /* Structured Information */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;Please input one-sentence summary here.&lt;br /&gt;
&lt;br /&gt;
==Annotated Information==&lt;br /&gt;
 one gene of Lipid transfer proteins (LTPs)&lt;br /&gt;
 also one gene of Non-specific lipid-transfer protein&lt;br /&gt;
&lt;br /&gt;
==Function==&lt;br /&gt;
&lt;br /&gt;
Gene Os11g0116200 is one gene of Lipid transfer proteins (LTPs).while Lipid transfer proteins (LTPs) are highly conserved proteins in plants and play an important role in the resistance to pests, activation of resistance signalling, and adaptation to environmental stress.therefore,this gene palys a important role in pesticide-induced susceptibility.the other Lipid transfer proteins (LTPs) genes are Os012g0115100, Os10g0551700, Os10g0552600, Os11g0427800, Os12g0114800, Os11g0115100Os01g0822900, Os12g0114500.&lt;br /&gt;
&lt;br /&gt;
According to NCBI, gene Os11g0116200 is also a gene of Non-specific lipid-transfer protein.the function is Plant non-specific lipid-transfer proteins transfer phospholipids as well as galactolipids across membranes. May play a role in wax or cutin deposition in the cell walls of expanding epidermal cells and certain secretory tissues.&lt;br /&gt;
&lt;br /&gt;
==Laboratory==&lt;br /&gt;
&lt;br /&gt;
1.School of Plant Protection, Yangzhou University, Yangzhou 220059, PR China&lt;br /&gt;
&lt;br /&gt;
2.Microbiology and Immunology Department, Georgetown University, Suite 603, 2115 Wisconsin Ave, NW, Washington, DC 2007, USA&lt;br /&gt;
&lt;br /&gt;
==Research arctiles==&lt;br /&gt;
&lt;br /&gt;
Yao Cheng,a Zhao-Peng Shi,a Li-Ben Jiang et al.Possible connection between imidacloprid-induced changes in rice gene transcription profiles and susceptibility to the brown plant hopper Nilaparvatalugens Stål (Hemiptera: Delphacidae)[J].Pesticide Biochemistry and Physiology.2012.&lt;br /&gt;
&lt;br /&gt;
International rice genome sequencing project (IRGSP).The map-based sequence of the rice genome.Nature 2005&lt;br /&gt;
&lt;br /&gt;
The rice annotation project (RAP).The rice annotation project database (RAP-DB): 2008 update.&lt;br /&gt;
&lt;br /&gt;
[[Category:Genes]]&lt;br /&gt;
[[Category:Japonica mRNA]]&lt;br /&gt;
[[Category:Oryza Sativa Japonica Group]]&lt;br /&gt;
[[Category:Japonica Genes]]&lt;br /&gt;
[[Category:Japonica Chromosome 11]]&lt;br /&gt;
[[Category:Chromosome 11]]&lt;/div&gt;</summary>
		<author><name>Lmw2015</name></author>	</entry>

	<entry>
		<id>https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os11g0113700&amp;diff=248892</id>
		<title>Os11g0113700</title>
		<link rel="alternate" type="text/html" href="https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os11g0113700&amp;diff=248892"/>
				<updated>2015-06-12T04:19:34Z</updated>
		
		<summary type="html">&lt;p&gt;Lmw2015: /* Structured Information */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;The ''OsCIPK15'' gene;s expression can link O2-deficiency signals to the sugar-sensing cascade to regulate sugar and energy production and to enable rice growth under floodwater.Further more,the ''OsCIPK15'' gene involves in various MAMP-induced immune responses.&lt;br /&gt;
&lt;br /&gt;
==Annotated Information==&lt;br /&gt;
===Function===&lt;br /&gt;
This gene encodes a protein kinase, the calcineurin B-like interacting protein kinase 15 (CIPK15), which is a key regulator of the sensing cascade for successful rice germination under flooding &amp;lt;ref name=&amp;quot;ref1&amp;quot; /&amp;gt;. CIPK15 regulates the plant global energy and stress sensor SnRK1A (Snf1-related protein kinase 1) and links O2-deficiency signals to the SnRK1-dependent sugar-sensing cascade to regulate sugar and energy production and to enable rice growth under floodwater. CIPKs are a group of plant-specific Ser-Thr protein kinases containing a conserved 24-amino acid motif, called the NAF (Asn-Ala-Phe) domain, which is in the C-terminal nonkinase region and is sufficient and necessary for CIPK interaction with Calcineurin B-like (CBL) proteins. The Arabidopsis CBL-CIPK network consists of 10 CBLs and 25 CIPKs that act in combination with one another, and different pair combinations have been found to participate in signaling pathways related to abiotic stresses, including salt, drought, osmotic, cold, and ABA (abscisic acid). The current works show that CIPK15 integrates sugar- and O2-deficiency signaling processes relevant to germination and seedling growth under floodwater and in mature plants grown under partial flooding. Under O2 deprivation, the CIPK15 pathway is repressed in the tolerant, Sub1A-containing, FR13A variety. CIPK15 is likely to play a role in the up-regulation of Ramy3D in flooding-intolerant rice varieties that display fast elongation under flooding and that do not possess Sub1A &amp;lt;ref name=&amp;quot;ref2&amp;quot; /&amp;gt;.&lt;br /&gt;
OsCIPK14 and OsCIPK15, which are rapidly induced by MAMPs, involved in various MAMP-induced immune responses including defense-related gene expression, phytoalexin biosynthesis and hypersensitive cell death. MAMP-induced production of reactive oxygen species as well as cell browning were also suppressed in OsCIPK14/15-RNAi transgenic cell lines &amp;lt;ref name=&amp;quot;ref3&amp;quot; /&amp;gt;. OsCIPK14/15 play a crucial role in the microbe-associated molecular pattern-induced defense signaling pathway in rice cultured cells &amp;lt;ref name=&amp;quot;ref4&amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
===Mutation===&lt;br /&gt;
Nipponbare mutant line: A Tos17 insertion in ATG downstream, which turns to be hypersensitive to the effect of anaerobic germination under water &amp;lt;ref name=&amp;quot;ref1&amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
O. sativa FR13A variety: Sub1A-containing variety whose CIPK15 pathway is repressed under O2 deprivation &amp;lt;ref name=&amp;quot;ref2&amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
===Expression===&lt;br /&gt;
OsCIPK14/15 interacted with several OsCBLs through the FISL/NAF motif in yeast cells and showed the strongest interaction with OsCBL4. The recombinant OsCIPK14/15 proteins showed Mn2+-dependent protein kinase activity, which was enhanced both by deletion of their FISL/NAF motifs and by combination with OsCBL4. OsCIPK14/15-RNAitransgenic cell lines showed reduced sensitivity to TvX/EIX for the induction of a wide range of defense responses, including hypersensitive cell death, mitochondrial dysfunction, phytoalexin biosynthesis, and pathogenesis-related gene expression. On the other hand, TvX/EIX-induced cell death was enhanced in OsCIPK15-overexpressing lines &amp;lt;ref name=&amp;quot;ref3&amp;quot; /&amp;gt;. &lt;br /&gt;
In adult plants Sub1A and CIPK15 may perhaps play an antagonistic role in terms of carbohydrate consumption, with Sub1A acting as a starch degradation repressor and CIPK15 as an activator &amp;lt;ref name=&amp;quot;ref2&amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
===Evolution===&lt;br /&gt;
Arabidopsis thaliana genome sequence revealed 10&lt;br /&gt;
CBL and 25 CIPK homologues &amp;lt;ref name=&amp;quot;ref5&amp;quot; /&amp;gt;. OsCIPK14/15 showed 44% homology with AtCIPK24/SOS2 at the amino acid level &amp;lt;ref name=&amp;quot;ref6&amp;quot; /&amp;gt;. Amino acid sequences of the N terminus of the kinase domain and the FISL/NAF motif &amp;lt;ref name=&amp;quot;ref7&amp;quot; /&amp;gt; were especially well conserved.&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
You can also add sub-section(s) at will.&lt;br /&gt;
&lt;br /&gt;
==Labs working on this gene==&lt;br /&gt;
*Graduate Institute of Life Sciences, National Defense Medical Center, Neihu, Taipei 114, Taiwan, ROC.&lt;br /&gt;
*Institute of Molecular Biology, Academia Sinica, Nankang, Taipei 115, Taiwan, ROC.&lt;br /&gt;
*Department of Crop Plant Biology, University of Pisa, Pisa, Italy.&lt;br /&gt;
*Department of Applied Biological Science, Tokyo University of Science, Noda, Chiba 278–8510, Japan&lt;br /&gt;
*Plant Disease Resistance Research Unit and Division of Genome and Biodiversity Research, National Institute of Agrobiological Sciences, Ibaraki 305–8602, Japan&lt;br /&gt;
*Laboratory of Environmental Biochemistry, Biotechnology Research Center, University of Tokyo, Tokyo 113–8657, Japan&lt;br /&gt;
&lt;br /&gt;
== References ==&lt;br /&gt;
&amp;lt;references&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref1&amp;quot;&amp;gt;Lee K.W., Chen P.W., Lu C.A., Chen S., Ho T.H.D., Yu S.M. (2009) Coordinated responses to oxygen and sugar deficiency allow rice seedlings to tolerate flooding. Science Signaling, 2, ra61.&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref2&amp;quot;&amp;gt;N. P. Kudahettige, C. Pucciariello, S. Parlanti, A. Alpi, P. Perata (2011) Regulatory interplay of the Sub1A and CIPK15 pathways in the regulation of α-amylase production in flooded rice plants. Plant Biology, 13(4): 611-619.&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref3&amp;quot;&amp;gt;Takamitsu Kurusu, Jumpei Hamada, Haruyasu Hamada, Shigeru Hanamata, Kazuyuki Kuchitsu (2010) Roles of calcineurin B-like protein-interacting protein kinases in innate immunity in rice. Plant Signaling &amp;amp; Behavior, 5(8): 1045-1047.&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref4&amp;quot;&amp;gt;Takamitsu Kurusu, Jumpei Hamada, Hiroshi Nokajima, Youichiro Kitagawa, Masahiro Kiyoduka, Akira Takahashi, Shigeru Hanamata, Ryoko Ohno, Teruyuki Hayashi, Kazunori Okada, Jinichiro Koga, Hirohiko Hirochika, Hisakazu Yamane, Kazuyuki Kuchitsu (2010)  Regulation of Microbe-Associated Molecular Pattern-Induced Hypersensitive Cell Death, Phytoalexin Production, and Defense Gene Expression by Calcineurin B-Like Protein-Interacting Protein Kinases, OsCIPK14/15, in Rice Cultured Cells. Plant Physiology, 153(2): 678-692.&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref5&amp;quot;&amp;gt;Luan S, Kudla J, Rodriguez-Concepcion M, Yalovsky S, Gruissem W (2002) Calmodulins and calcineurin B-like proteins: calcium sensors for specific signal response coupling in plants. Plant Cell (Suppl) 14: S389–S400.&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref6&amp;quot;&amp;gt;Liu J, IshitaniM, Halfter U, Kim CS, Zhu JK (2000) The Arabidopsis thaliana SOS2 gene encodes a protein kinase that is required for salt tolerance.&lt;br /&gt;
Proc Natl Acad Sci USA 97: 3730–3734.&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref7&amp;quot;&amp;gt;Albrecht V, Ritz O, Linder S, Harter K, Kudla J (2001) The NAF domain defines a novel protein-protein interaction module conserved in Ca2+-&lt;br /&gt;
regulated kinases. EMBO J 20: 1051–1063.&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;/references&amp;gt;&lt;br /&gt;
&lt;br /&gt;
[[Category:Genes]]&lt;br /&gt;
[[Category:Japonica mRNA]]&lt;br /&gt;
[[Category:Oryza Sativa Japonica Group]]&lt;br /&gt;
[[Category:Japonica Genes]]&lt;br /&gt;
[[Category:Japonica Chromosome 11]]&lt;br /&gt;
[[Category:Chromosome 11]]&lt;/div&gt;</summary>
		<author><name>Lmw2015</name></author>	</entry>

	<entry>
		<id>https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os11g0104300&amp;diff=248891</id>
		<title>Os11g0104300</title>
		<link rel="alternate" type="text/html" href="https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os11g0104300&amp;diff=248891"/>
				<updated>2015-06-12T04:19:10Z</updated>
		
		<summary type="html">&lt;p&gt;Lmw2015: /* Structured Information */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;DWARF 53(Os11g0104300) acts as a repressor of strigolactone signalling in rice.&amp;lt;ref name=&amp;quot;ref2&amp;quot; /&amp;gt;&lt;br /&gt;
==Annotated Information==&lt;br /&gt;
&lt;br /&gt;
===Name===&lt;br /&gt;
''DWARF53''（''D53'')&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
===Phenotype===&lt;br /&gt;
The rice (Oryza sativa) d53 mutant, which displays reduced height and increased tillering, as well as thinner stem and shorter crown root compared to wild-type plants, is caused by a gain-of-function mutation and is insensitive to exogenous SL treatment. Further, measurement of SLs produced in the root exudates showed that d53 accumulated markedly higher levels of 2′-epi-5-deoxystrigol (epi-5DS), a native SL of rice, than the wild-type cultivar Norin 8.&amp;lt;ref name=&amp;quot;ref1&amp;quot; /&amp;gt;&lt;br /&gt;
[[File:phenotype of d53 mutant.jpg]&lt;br /&gt;
&lt;br /&gt;
===Characterization===&lt;br /&gt;
''D53'' was mapped to the terminal region of the short arm of rice chromosome 11. A single-nucleotide substitution and 15-nucleotide deletion in the third exon of LOC_Os11g01330 in d53, which resulted in an amino acid substitution (R812T) and deletion of five amino acids (813GKTGI817).&amp;lt;ref name=&amp;quot;ref1&amp;quot; /&amp;gt;&lt;br /&gt;
&lt;br /&gt;
[[File:characterization of D53.jpg]]&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
===Function===&lt;br /&gt;
''DWARF53''（''D53'') encodes a substrate of the SCF-D3 ubiquitination complex and functions as a repressor of SL signalling, whose hormone-induced degradation represents a key molecular link between SL perception and responses. D53 can interact with transcriptional co-repressors known as TOPLESS-RELATED PROTEINS.&amp;lt;ref name=&amp;quot;ref1&amp;quot; /&amp;gt;&lt;br /&gt;
In the absence of SLs, D53 is stable and may recruit TPL/TPR proteins and repress downstream responses. In the presence of SLs, perception of SL leads to SCFD3-mediated ubiquitination of D53 and its subsequent degradation by the proteasome system, which in turn releases the repression of downstream responses.&amp;lt;ref name=&amp;quot;ref2&amp;quot; /&amp;gt;&lt;br /&gt;
&lt;br /&gt;
[[File:A proposed model of D53 action.jpg]]&lt;br /&gt;
&lt;br /&gt;
===Expression===&lt;br /&gt;
The ''D53'' gene product shares predicted features with the class I Clp ATPase proteins and can form a complex with thea/bhydrolase protein DWARF 14 (D14) and the F-box protein DWARF 3 (D3), two previously identified signalling components potentially responsible for SL perception. In a D14- and D3-dependent manner, SLs induce D53 degradation by the proteasome and abrogate its activity in promoting axillary bud outgrowth.&amp;lt;ref name=&amp;quot;ref1&amp;quot; /&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==Labs working on this gene==&lt;br /&gt;
*National Key Laboratory for Crop Genetics and Germplasm Enhancement, Jiangsu Plant Gene Engineering Research Center, Nanjing Agricultural University, Nanjing 210095, China&lt;br /&gt;
*National Key Facility for Crop Gene Resources and Genetic Improvement, Institute of Crop Science, Chinese Academy of Agricultural Sciences, Beijing 100081, China&lt;br /&gt;
*Department of Pharmacology, University of Washington, Seattle, Washington 98195, USA&lt;br /&gt;
*Howard Hughes Medical Institute, Box 357280, University of Washington, Seattle, Washington 98195, USA&lt;br /&gt;
*National Centre for Plant Gene Research (Beijing), Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, 1-2 Beichen West Road, Beijing 100101, China&lt;br /&gt;
*Department of Applied Biological Chemistry, The University of Tokyo, 1-1-1 Yayoi, Bunkyo, Tokyo 113-8657, Japan&lt;br /&gt;
&lt;br /&gt;
==References==&lt;br /&gt;
&amp;lt;references&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref1&amp;quot;&amp;gt; Feng Zhou, Qibing Lin, Lihong Zhu, Yulong Ren, Kunneng Zhou, Nitzan Shabek, Fuqing Wu, Haibin Mao, Wei Dong, Lu Gan, Weiwei Ma, He Gao,	 Jun Chen, Chao Yang, Dan Wang, Junjie Tan, Xin Zhang, Xiuping Guo, Jiulin Wang, Ling Jiang, Xi Liu, Weiqi Chen, Jinfang Chu, Cunyu Yan, Kotomi Ueno etal.D14–SCFD3-dependent degradation of D53 regulates strigolactone signalling[J]. Nature, 2013, 504:406–410.&lt;br /&gt;
&amp;lt;/ref&amp;gt; &lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref2&amp;quot;&amp;gt;&lt;br /&gt;
Liang Jiang, Xue Liu, Guosheng Xiong, Huihui Liu, Fulu Chen, Lei Wang, Xiangbing Meng, Guifu Liu, Hong Yu, Yundong Yuan, Wei Yi, Lihua Zhao, Honglei Ma,	 Yuanzheng He, Zhongshan Wu, Karsten Melcher, Qian Qian, H. Eric Xu, Yonghong Wang &amp;amp; Jiayang Li[J]. Nature, 2013, 504,:401–405.&lt;br /&gt;
&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;/references&amp;gt;&lt;br /&gt;
&lt;br /&gt;
[[Category:Genes]]&lt;br /&gt;
[[Category:Japonica mRNA]]&lt;br /&gt;
[[Category:Oryza Sativa Japonica Group]]&lt;br /&gt;
[[Category:Japonica Genes]]&lt;br /&gt;
[[Category:Japonica Chromosome 11]]&lt;br /&gt;
[[Category:Chromosome 11]]&lt;/div&gt;</summary>
		<author><name>Lmw2015</name></author>	</entry>

	<entry>
		<id>https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os10g0580800&amp;diff=248890</id>
		<title>Os10g0580800</title>
		<link rel="alternate" type="text/html" href="https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os10g0580800&amp;diff=248890"/>
				<updated>2015-06-12T04:18:35Z</updated>
		
		<summary type="html">&lt;p&gt;Lmw2015: /* Structured Information */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;Please input one-sentence summary here.&lt;br /&gt;
&lt;br /&gt;
==Annotated Information==&lt;br /&gt;
===Function===&lt;br /&gt;
Please input function information here.&lt;br /&gt;
&lt;br /&gt;
===Expression===&lt;br /&gt;
Please input expression information here.&lt;br /&gt;
&lt;br /&gt;
===Evolution===&lt;br /&gt;
Please input evolution information here.&lt;br /&gt;
&lt;br /&gt;
You can also add sub-section(s) at will.&lt;br /&gt;
&lt;br /&gt;
==Labs working on this gene==&lt;br /&gt;
Please input related labs here.&lt;br /&gt;
&lt;br /&gt;
==References==&lt;br /&gt;
Please input cited references here.&lt;br /&gt;
&lt;br /&gt;
[[Category:Genes]]&lt;br /&gt;
[[Category:Japonica mRNA]]&lt;br /&gt;
[[Category:Oryza Sativa Japonica Group]]&lt;br /&gt;
[[Category:Japonica Genes]]&lt;br /&gt;
[[Category:Japonica Chromosome 10]]&lt;br /&gt;
[[Category:Chromosome 10]]&lt;/div&gt;</summary>
		<author><name>Lmw2015</name></author>	</entry>

	<entry>
		<id>https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os10g0577600&amp;diff=248889</id>
		<title>Os10g0577600</title>
		<link rel="alternate" type="text/html" href="https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os10g0577600&amp;diff=248889"/>
				<updated>2015-06-12T04:18:17Z</updated>
		
		<summary type="html">&lt;p&gt;Lmw2015: /* Structured Information */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;Rice jmjC domain-containing gene JMJ706 encodes H3K9 demethylase required for floral organ development.&lt;br /&gt;
&lt;br /&gt;
==Annotated Information==&lt;br /&gt;
===Background===&lt;br /&gt;
Histone lysine methylation is an important epigenetic modification with both activating and repressive roles in gene expression &amp;lt;ref name=&amp;quot;ref1&amp;quot; /&amp;gt; . There are six lysine residues in histone N-termini that are predominantly methylated, with the methylation of histone H3 lysine 4 (H3K4) and lysine 36 (H3K36) primarily having an activating function, whereas the methylation of histone H3 lysine 9 (H3K9) and lysine 27 (H3K27) and histone H4lysine 20 (H4K20) is essentially associated with repressed chromatin &amp;lt;ref name=&amp;quot;ref2&amp;quot; /&amp;gt;. Histone lysine residues can be mono-, di- or trimethylated. Each distinct methyl state is associated with different biological functions &amp;lt;ref name=&amp;quot;ref1&amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
Jumonji C (jmjC) domain-containing proteins have been suggested to function as histone demethylases &amp;lt;ref name=&amp;quot;ref3&amp;quot; /&amp;gt;. Using biochemical approaches, the first jmjC domain-containing histone demethylase, JHDM1 (jmjC domain-containing histone demethylase 1), was identified and shown to reverse H3K36 mono- and dimethylation (H3K36me1 and H3K36me2), and the jmjC domain was demonstrated to be the catalytic domain &amp;lt;ref name=&amp;quot;ref4&amp;quot; /&amp;gt;. Jumonji C domain-containing histone demethylases catalyze lysine demethylation through an oxidative reaction that requires iron Fe(II) and α-ketoglutarate as cofactors.&lt;br /&gt;
&lt;br /&gt;
===Function===&lt;br /&gt;
[[File:Function_甲基化.jpg|right|thumb|150px|&amp;quot;Fig.1 In vitro assays of JMJ706 histone demethylation activity (from reference &amp;lt;ref name=&amp;quot;ref5&amp;quot;/&amp;gt;).&amp;quot;]]&lt;br /&gt;
&lt;br /&gt;
JMJ706 encodes a heterochromatin-associated H3K9 demethylase involved in the regulation of flower development in rice. Histone lysine ethylation is an important epigenetic modification with both activating and repressive roles in gene expression. Jumonji C (jmjC) domain-containing proteins have been shown to reverse histone methylation in non plant model systems. Here, we show that plant Jumonji C proteins have both conserved and specific features compared with mammalian homologues. In particular, the rice JMJD2 family jmjC gene JMJ706 is shown to encode a heterochromatin-enriched protein. The JMJ706 protein specifically reverses di- and trimethylations of lysine 9 of histone H3&lt;br /&gt;
(H3K9) in vitro. Loss-of-function mutations of the gene lead to increased di- and trimethylations of H3K9 and affect the spikelet development, including altered floral morphology and organ number. Gene expression and histone modification analysis indicates that JMJ706 regulates a ubset of flower development regulatory genes.&lt;br /&gt;
&lt;br /&gt;
Histone demethylation activity has been shown to be jmjC domain dependent &amp;lt;ref name=&amp;quot;ref4&amp;quot; /&amp;gt; &amp;lt;ref name=&amp;quot;ref6&amp;quot; /&amp;gt;. To study JMJ706 function, a truncated JMJ706 protein containing the jmjN and jmjC domains and an additional GST tag was purified from ''Escherichia coli'' cells and tested for in vitro histone demethylase activity. The incubated histones were analyzed by Western blot tests with antibodies specific to histone H3 modification modules. As shown in Fig.1, the GST-JMJ706 fusion protein reduced the level of H3K9me2 and H3K9me3 but slightly increased the level of H3K9me1. The methylation of other lysine residues was not significantly altered, except a slight decrease observed for H3K36me2. Glutathione S-transferase alone had no effect on histone modification. This suggests that JMJ706 may be mainly involved in the demethylation of H3K9me2 and H3K9me3.&lt;br /&gt;
&lt;br /&gt;
===Evolution===&lt;br /&gt;
[[File:Phylogenetic.jpg|right|thumb|150px|&amp;quot;Fig.2 Phylogenetic relationship of jmjC domain-containing proteins from O. sativa (Os), A. thaliana (At), and H. sapiens (Hs). (from reference &amp;lt;ref name=&amp;quot;ref5&amp;quot;/&amp;gt;).&amp;quot;]]&lt;br /&gt;
&lt;br /&gt;
A genomic survey revealed 20 and 21 jmjC domain-containing genes in rice and Arabidopsis, respectively (Fig. 2). The sequence alignment resulted in the discrimination of five groups containing the plant proteins. Groups I, II, and IV were  found to be related to the JARID, JMJD2, and JHDM2 subfamilies, respectively. Group V could be divided into several subgroups, each of which was found to have related members of the human 'JmjC domain-only' subfamily &amp;lt;ref name=&amp;quot;ref7&amp;quot; /&amp;gt;.&lt;br /&gt;
&lt;br /&gt;
===Localization===&lt;br /&gt;
[[File:Sublocalization.jpg|left|thumb|200px|&amp;quot;Fig.3 Subcellular localization of the protein (from reference &amp;lt;ref name=&amp;quot;ref5&amp;quot;/&amp;gt;).&amp;quot;]]&lt;br /&gt;
&lt;br /&gt;
JMJ706 is enriched in heterochromatin domains.&lt;br /&gt;
To study JMJ706 localization in rice nuclei, a construct expressing a JMJ706 fusion with the GFP was used to transform WT rice plants. Nuclei of the transgenic leaf mesophyll cells showed an enrichment of the fusion protein in spots that overlapped with 4,6-diamidino-2-phenylindole (DAPI)–stained regions (Fig. 3B). To confirm this result, a construct expressing FLAG-tagged JMJ706 protein was used to complement JMJ706&lt;br /&gt;
T-DNA insertion mutant lines . The FLAG-tagged protein was also observed in enriched DAPI-stained domains (Fig. 3C).&lt;br /&gt;
&lt;br /&gt;
===Mutation===&lt;br /&gt;
[[File:Mutant.jpg|left|thumb|200px|&amp;quot;Fig.4 JMJ706 loss-of-function mutation affects spikelet development.(from reference &amp;lt;ref name=&amp;quot;ref5&amp;quot;/&amp;gt;).&amp;quot;]]&lt;br /&gt;
&lt;br /&gt;
JMJ706 Loss-of-Function Mutation Affects Floral Organogenesis.&lt;br /&gt;
A search of a database of a rice T-DNA insertion library identified two insertion lines of the JMJ706 gene (Fig. 4A).Characterization of the insertion mutants revealed similar spikelet morphology defects (Fig. 4B).The phenotype cosegregated with the homozygous state of the insertions and the absence of JMJ706 mRNA accumulation (Fig. 4C).The mutant spikelets showed a variety of defects, mainly on floral organ number (Fig. 4 D–H). Some spikelets were depleted of lemma and/or palea (Fig. 4D), whereas others had an additional piece of palea (Fig. 4E). Increased numbers of stamens and pistils were also observed (Fig. 4F). In addition, vitrified tissues were seen in some spikelets (Fig. 4G). Scanning microscopy revealed irregular cell size and arrangement on the mutant palea surface with increased bristle numbers (Fig. 4H). Some&lt;br /&gt;
spikelets could still produce seeds. These mutant seeds had a deformed shape, but they germinated and produced normal seedlings, suggesting that embryogenesis was not affected.&lt;br /&gt;
&lt;br /&gt;
==Labs working on this gene==&lt;br /&gt;
Dao-Xiu Zhou, Institut de Biotechnologie des Plantes, Universite´ Paris Sud 11, 91405 Orsay, France&lt;br /&gt;
&lt;br /&gt;
==References==&lt;br /&gt;
&amp;lt;references&amp;gt; &lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref1&amp;quot;&amp;gt; &lt;br /&gt;
 Kouzarides T (2007) Chromatin modifications and their function. Cell 128:693–705.&lt;br /&gt;
&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref2&amp;quot;&amp;gt; &lt;br /&gt;
Margueron R, Trojer P, Reinberg D (2005) The key to development: interpreting the histone code? Curr Opin Genet Dev 15:163–176.&lt;br /&gt;
&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref3&amp;quot;&amp;gt; &lt;br /&gt;
Trewick SC, McLaughlin PJ, Allshire RC (2005) Methylation: Lost in hydroxylation EMBO Rep 6:315–320.&lt;br /&gt;
&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref4&amp;quot;&amp;gt; &lt;br /&gt;
Tsukada Y, et al. (2006) Histone demethylation by a family of JmjC domain-containing proteins. Nature 439:811–816.&lt;br /&gt;
&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref5&amp;quot;&amp;gt; &lt;br /&gt;
Qianwen Sun and Dao-Xiu Zhou (2008)Rice jmjC domain-containing gene JMJ706 encodes H3K9 demethylase required for floral organ development. Proceedings of the National Academy of Sciences 105(36): 13679-13684.&lt;br /&gt;
&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref6&amp;quot;&amp;gt; &lt;br /&gt;
Chen Z, et al. (2006) Structural insights into histone demethylation by JMJD2 family members. Cell 125:691–702.&lt;br /&gt;
&amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref7&amp;quot;&amp;gt; &lt;br /&gt;
Klose RJ, Kallin EM, Zhang Y (2006) JmjC-domain-containing proteins and histone demethylation. Nat Rev Genet 7:715–727.&lt;br /&gt;
&amp;lt;/ref&amp;gt;&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&lt;br /&gt;
&amp;lt;/references&amp;gt;&lt;br /&gt;
&lt;br /&gt;
[[Category:Genes]]&lt;br /&gt;
[[Category:Japonica mRNA]]&lt;br /&gt;
[[Category:Oryza Sativa Japonica Group]]&lt;br /&gt;
[[Category:Japonica Genes]]&lt;br /&gt;
[[Category:Japonica Chromosome 10]]&lt;br /&gt;
[[Category:Chromosome 10]]&lt;/div&gt;</summary>
		<author><name>Lmw2015</name></author>	</entry>

	<entry>
		<id>https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os10g0573900&amp;diff=248888</id>
		<title>Os10g0573900</title>
		<link rel="alternate" type="text/html" href="https://ngdc.cncb.ac.cn/ricewiki/index.php?title=Os10g0573900&amp;diff=248888"/>
				<updated>2015-06-12T04:17:55Z</updated>
		
		<summary type="html">&lt;p&gt;Lmw2015: /* Structured Information */&lt;/p&gt;
&lt;hr /&gt;
&lt;div&gt;“OsNMD3”, a highly conserved trans-factor, the 60S ribosomal subunit nuclear export adaptor NMD3. &amp;lt;ref name=&amp;quot;ref1&amp;quot; /&amp;gt;&lt;br /&gt;
&lt;br /&gt;
==Annotated Information==&lt;br /&gt;
===Function===&lt;br /&gt;
[[File:Shijc-Os10g0573900-Fig1.jpeg|right|thumb|200px|'' Expression of OsNMD3 ΔNLS GFP affects plant growth. (from reference &amp;lt;ref name=&amp;quot;ref1&amp;quot; /&amp;gt;).'']]&lt;br /&gt;
In plants, the process of ribosome biogenesis has remained largely unknown; thus, the exploration of a conserved protein that has been well studied in other organisms is an optimal way to gain insight into ribosomal dynamics. NMD3 is such a protein due to its importance and conservation throughout eukaryotic species &amp;lt;ref name=&amp;quot;ref2&amp;quot; /&amp;gt; &amp;lt;ref name=&amp;quot;ref3&amp;quot; /&amp;gt; &amp;lt;ref name=&amp;quot;ref4&amp;quot; /&amp;gt;. Rice possesses one annotated NMD3 sequence with all representative motifs, including Cx2C repeats at the N-terminus as well as an NLS and NES at the C-terminus. Transient expression assays in rice protoplasts revealed that OsNMD3 shuttles between the nucleus and cytoplasm via CRM1/XPO1, demonstrating its conserved behaviour as a pre-60S nuclear export adaptor, as reported in other species. OsNMD3 was further found to interact with the 60S subunit via OsRPL10Ac1, and it co-sedimented with 60S and 80S ribosome components in ribosome profile analysis.&lt;br /&gt;
[[File:Shijc-Os10g0573900-Fig2.jpeg|right|thumb|200px|'' OsNMD3 is nucleocytoplasmically localized. (from reference &amp;lt;ref name=&amp;quot;ref1&amp;quot; /&amp;gt;).'']]&lt;br /&gt;
After being transported from the nucleus, NMD3 must be released from pre-60S particles. This process occurs in the cytoplasm and is an important step toward 60S ribosome maturation &amp;lt;ref name=&amp;quot;ref5&amp;quot; /&amp;gt; &amp;lt;ref name=&amp;quot;ref6&amp;quot; /&amp;gt;. In eukaryotes, the conserved trans-factor NMD3 and eIF6/Tif6 bind to the joining interface with 40S subunit, which blocks premature translation. Release of NMD3 from pre-60S particles can trigger the following events: joining with 40S subunits, processing precursor rRNAs, and forming fully functional ribosomes. Therefore, this step is critical for controlling ribosomal quality for translation &amp;lt;ref name=&amp;quot;ref7&amp;quot; /&amp;gt; &amp;lt;ref name=&amp;quot;ref8&amp;quot; /&amp;gt; &amp;lt;ref name=&amp;quot;ref9&amp;quot; /&amp;gt;. RPL10 and the GTPase LSG1 have been implicated in the release of NMD3 &amp;lt;ref name=&amp;quot;ref9&amp;quot; /&amp;gt;. However, nothing thus far is known about how cytoplasmic maturation of 60S pre-particles occurs in plants. The current work found that OsNMD3ΔNLS was trapped in the cytoplasm. Therefore, truncated OsNMD3 disturbs the cytoplasmic maturation process of 60S particles and affects translational efficiency, which could be further supported by the following findings: (1) both OsNMD3 and OsNMD3ΔNLS bound to OsRPL10Ac1; surplus cytoplasmic OsNMD3ΔNLS may therefore bind to OsRPL10Ac1 and disturb its normal interaction with endogenous OsNMD3; (2) overexpression of OsNMD3 ΔNLS altered the ribosomal structure and interfered with the release of endogenous OsNMD3 from 60S subunits; the presence of OsNMD3ΔNLS in polysomes indicated that cytoplasmic OsNMD3ΔNLS might be loaded onto the ribosome by an unknown mechanism; and (3) transgenic plants showed a reduction in translational efficiency and altered ribosomal structure based on transactivation assays and pharmaceutical treatments with several antibiotics. The protein abundance of CESAs, which participate in cellulose biosynthesis, was significantly low in the OsNMD3ΔNLS transgenic lines, providing solid evidence that OsNMD3ΔNLS decreased the efficiency of protein synthesis. The observation of reduced cellulose content and altered sugar composition was similar to that reported in Arabidopsis plants overexpressing AtNMD3 ΔNES &amp;lt;ref name=&amp;quot;ref4&amp;quot; /&amp;gt;. However, the underlying mechanism differs because the latter was due to the obstruction of AtNMD3 nuclear export. Cell-wall biosynthesis is sensitive to the functionality of nascent ribosomes because these processes are likely to require rapid, abundant protein synthesis. Moreover, RNA sequencing was used to perform a genome-wide examination of the pathways affected by the aberrant 60S particles&amp;lt;ref name=&amp;quot;ref10&amp;quot; /&amp;gt;. The expression level of many factors involved in ribosomal biogenesis was significantly altered in the transgenic plants.&lt;br /&gt;
&lt;br /&gt;
===Transgenic Types===&lt;br /&gt;
[[File:Shijc-Os10g0573900-Fig3.jpeg|right|thumb|200px|'' The effects of leptomycin B (LMB) on OsNMD3 distribution. (from reference &amp;lt;ref name=&amp;quot;ref1&amp;quot; /&amp;gt;).'']]&lt;br /&gt;
To genetically investigate the functions of OsNMD3 in ribosomal dynamics in rice plants, this work employed a dominant negative strategy by overexpression of the GFP-fused wild-type (OsNMD3GFP) and NLS (414–430 aa) truncated forms (OsNMD3ΔNLSGFP) in Nipponbare. The phenotypes of the transgenic plants were examined in the T2 generation. The plants expressing OsNMD3ΔNLSGFP showed dwarfism. From two representative lines (L1 and L2), the plant size of L1 was obviously small compared with that of the wild type. The abnormality was more severe in L2, as the expression level of NMD3ΔNLSGFP was further increased. The L2 plants exhibited pleiotropic phenotypes, including dwarfism and sterility, and they rarely lived to maturity. An observation of the GFP signals in the root cells of these transgenic plants revealed that OsNMD3ΔNLS was localized in the cytoplasm, consistent with the findings obtained with transient expression . However, the plants expressing OsNMD3GFP exhibited a wild-type appearance, although the expression level of OsNMD3 in the transgenic plants was significantly upregulated. The GFP signals in these transgenic plants were found in the cytoplasm and nuclei.&lt;br /&gt;
&lt;br /&gt;
===Expression===&lt;br /&gt;
The presence of NES and NLS motifs indicates that OsNMD3 is nucleocytoplasmically localized. This work therefore fused the green fluorescent protein (GFP) to the C-terminus of full-length OsNMD3 (OsNMD3GFP) and to the C-terminus of truncated OsNMD3 lacking either the NES (OsNMD3ΔNESGFP) or NLS (OsNMD3ΔNLSGFP) and transiently expressed the resulting constructs in rice protoplasts. Fluorescent signals of OsNMD3GFP were observed in both the nucleus and cytoplasm, whereas those of OsNMD3ΔNESGFP and OsNMD3ΔNLSGFP were trapped in the nucleus and cytoplasm, respectively. It has been reported that yeast NMD3 (ScNMD3) acts as a bridge between pre-60S subunits and the nuclear export factor CRM1/XPO1, and leptomycin B (LMB) could block this process &amp;lt;ref name=&amp;quot;ref11&amp;quot; /&amp;gt;&amp;lt;ref name=&amp;quot;ref12&amp;quot; /&amp;gt;&amp;lt;ref name=&amp;quot;ref13&amp;quot; /&amp;gt;. To investigate whether OsNMD3 shares a similar export pathway with ScNMD3, the current work treated rice protoplasts transiently expressing OsNMD3GFP with LMB and examined the distribution of GFP signals. In contrast to the control cells expressing GFP only, which showed GFP signals in both the nucleus and cytoplasm, the OsNMD3GFP signals were retained in the nucleus after treatment. Taken together, these data indicate that OsNMD3 shuttles between the nucleus and cytoplasm via CRM1/XPO1 and functions as a nuclear export adaptor for 60S ribosomal subunits.  &lt;br /&gt;
&lt;br /&gt;
===Evolution===&lt;br /&gt;
NMD3 is one of the highly conserved trans-acting factors and mediates the nuclear export of the 60S ribosomal subunit from yeast to plants &amp;lt;ref name=&amp;quot;ref14&amp;quot; /&amp;gt;&amp;lt;ref name=&amp;quot;ref15&amp;quot; /&amp;gt;&amp;lt;ref name=&amp;quot;ref4&amp;quot; /&amp;gt;. Through a BlastP search of the rice genome, the current work identified only one annotated NMD3 sequence with an open reading frame located at the locus LOC_Os10g42320 (Rice Genome Annotation Project, http://rice.plantbiology.msu.edu/) or Os10g0573900 (National Center for Biotechnology Information, http://www.ncbi.nlm.nih.gov/). An unrooted phylogenetic tree was further constructed including the NMD3 from 18 representative species of bacteria, animals, and plants using the neighbour-joining method. OsNMD3 was clustered with sorghum NMD3 (SbNMD3) into a monophyletic clade that arose before the divergence of monocot and dicot phyla. Despite different evolutionary scenarios, OsNMD3 is conserved among the examined species. Within the length of 523 amino acids, OsNMD3 has four cysteine repeat motifs (Cx2C) at the N-terminus with an NLS (414–430 aa) and a leucine-rich NES (494–503 aa) at the C-terminus. These motifs are highly conserved among all eukaryotic cells, indicating that OsNMD3 may play roles in 60S ribosome dynamics that are similar to those reported in other species.&lt;br /&gt;
&lt;br /&gt;
==Labs working on this gene==&lt;br /&gt;
1. State Key Laboratory of Plant Genomics, Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, Beijing 100101, China&lt;br /&gt;
&lt;br /&gt;
==References==&lt;br /&gt;
&amp;lt;references&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref1&amp;quot;&amp;gt; Shi Y, Liu X, Li R, Gao Y, Xu Z, Zhang B, Zhou Y. Retention of OsNMD3 in the cytoplasm disturbs protein synthesis efficiency and affects plant development in rice. Journal of Experimental Botany, 2014, 65(12): 3055-3069. &amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref2&amp;quot;&amp;gt; Johnson AW, Lund E, Dahlberg J. 2002. Nuclear export of ribosomal subunits.Trends in Biochemical Science 27, 580–585. &amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref3&amp;quot;&amp;gt;Zemp I, Kutay U. 2007. Nuclear export and cytoplasmic maturation of ribosomal subunits. FEBS Letter 581, 2783–2793. &amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref4&amp;quot;&amp;gt; Chen MQ, Zhang AH, Zhang Q, et al. 2012. Arabidopsis NMD3 is required for nuclear export of 60S ribosomal subunits and affects secondary cell wall thickening. PLoS ONE 7, e35904. &amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref5&amp;quot;&amp;gt; Panse VG, Johnson AW. 2010. Maturation of eukaryotic ribosomes: acquisition of functionality. Trends in Biochemical Science 35, 260–266. &amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref6&amp;quot;&amp;gt; Karbstein K. 2013. Quality control mechanisms during ribosome maturation. Trends in Cell Biology 23, 242–250. &amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref7&amp;quot;&amp;gt; Gartmann M, Blau M, Armache JP, Mielke T, Topf M, Beckmann R. 2010. Mechanism of eIF6-mediated inhibition of ribosomal subunit joining. Journal of Biological Chemistry 285, 14848–14851. &amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref8&amp;quot;&amp;gt; Sengupta J, Bussiere C, Pallesen J, West M, Johnson AW, Frank J. 2010. Characterization of the nuclear export adaptor protein Nmd3 in association with the 60S ribosomal subunit. Journal of Cell Biology 189, 1079–1086. &amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref9&amp;quot;&amp;gt; Klinge S, Voigts-Hoffmann F, Leibundgut M, Arpagaus S, Ban N. 2011. Crystal structure of the eukaryotic 60S ribosomal subunit in complex with initiation factor 6. Science 334, 941–948. &amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref10&amp;quot;&amp;gt; Hedges J, West M, Johnson AW. 2005. Release of the export adapter, Nmd3p, from the 60S ribosomal subunit requires Rpl10p and the cytoplasmic GTPase Lsg1p. EMBO Journal 24, 567–579. &amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref11&amp;quot;&amp;gt; Ho JH, Kallstrom G, Johnson AW. 2000. Nmd3p is a Crm1p-dependent adapter protein for nuclear export of the large ribosomal subunit. Journal of Cell Biology 151, 1057–1066. &amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref12&amp;quot;&amp;gt; Gadal O, Strauss D, Kessl J, Trumpower B, Tollervey D, Hurt E. 2001. Nuclear export of 60S ribosomal subunits depends on Xpo1p and requires a nuclear export sequence-containing factor, Nmd3p, that associates with the large subunit protein Rpl10p. Molecular Cell Biology 21, 3405–3415. &amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref13&amp;quot;&amp;gt;Kressler D, Hurt E, Bassler J. 2010. Driving ribosome assembly. Biochimica et Biophysica Acta 1803, 673–683. &amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref14&amp;quot;&amp;gt; Ho JH, Johnson AW. 1999. NMD3 encodes an essential cytoplasmic protein required for stable 60S ribosomal subunits in Saccharomyces cerevisiae . Molecular Cell Biology 19, 2389–2399. &amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;ref name=&amp;quot;ref15&amp;quot;&amp;gt;Thomas F, Kutay U. 2003. Biogenesis and nuclear export of ribosomal subunits in higher eukaryotes depend on the CRM1 export pathway. Journal of Cell Science 116, 2409–2419. &amp;lt;/ref&amp;gt;&lt;br /&gt;
&amp;lt;/references&amp;gt;&lt;br /&gt;
&lt;br /&gt;
[[Category:Genes]]&lt;br /&gt;
[[Category:Japonica mRNA]]&lt;br /&gt;
[[Category:Oryza Sativa Japonica Group]]&lt;br /&gt;
[[Category:Japonica Genes]]&lt;br /&gt;
[[Category:Japonica Chromosome 10]]&lt;br /&gt;
[[Category:Chromosome 10]]&lt;/div&gt;</summary>
		<author><name>Lmw2015</name></author>	</entry>

	</feed>