RiceWiki - User contributions [en]

Os11g0102100

2014-06-09T11:03:07Z

Qwjiayouacomeon: Created page with " == Functin == Map-based cloning revealed that NAL2 and NAL3 are paralogs that encode an identical OsWOX3A (OsNS) transcriptional activator, homologous to NARROW SHEATH1 (NS1..."

== Functin ==

Map-based cloning revealed that NAL2 and NAL3 are paralogs that encode an identical OsWOX3A (OsNS) transcriptional activator, homologous to NARROW SHEATH1 (NS1) and NS2 in maize and PRESSED FLOWER in Arabidopsis. OsWOX3A is expressed in the vascular tissues of various organs, where nal2/3 mutant phenotypes were displayed. Expression levels of several leaf development-associated genes were altered in nal2/3, and auxin transport-related genes were significantly changed, leading to pin mutant-like phenotypes such as more tillers and fewer lateral roots.
OsWOX3A is involved in organ development in rice, lateral-axis outgrowth and vascular patterning in leaves, lemma and palea morphogenesis in spikelets, and development of tillers and lateral roots.narrow-curly leaves resulted mainly from reduced lateral-axis outgrowth with fewer longitudinal veins and more, larger bulliform cells. Opened spikelets, possibly caused by marginal deformity in the lemma, gave rise to narrow-thin grains.[1]

== References ==
1. Sung-Hwan Cho;Soo-Cheul Yoo;Haitao Zhang;Devendra Pandeya;Hee-Jong Koh;Ji-Young Hwang;Gyung-Tae Kim;Nam-Chon Paek. The rice narrow leaf2 and narrow leaf3 loci encode WUSCHEL-related homeobox 3A (OsWOX3A) and function in leaf, spikelet, tiller and lateral root development. New Phytologist, 2013, 198(4): 1071-1084.

CL971152

2014-06-09T10:45:41Z

Qwjiayouacomeon: /* Function */

== Function ==

CL971152, GW5, on rice chromosome 5, controls rice grain width and weight, encodes a novel nuclear protein of 144 amino acids that is localized to the nucleus. GW5 represents a major QTL underlying rice width and weight, and that it likely acts in the ubiquitin-proteasome pathway to regulate cell division during seed development[1].GW5 is associated with rice domestication. The GW5 gene was mapped to an interval between markers RM3328 and RMw513 in 805 homozygotes, the GW5 gene was mapped to a genomic region 2.7 cM in length, located 2.3 cM from RM3328 and 0.37 cM from RMw513. GW5 is associated with a 1 212-bp deletion in the Asominori. GW5 protein may play an important role in regulating the grain shape through involvement with the ubiquitin-proteasome pathway cultivar.GW5 occurred in the wide-grain lines, including most japonica and a few indica rice, whereas GW5 was present in the slender-grain rice, including most indica and a few japonica rice cultivars. GW2 and GW5 in controlling seed development. GW5 may work together with GW2 in targeted degradation of certain substrates that promote cell division and grain growth. GW5 may also work together with the deubiquitinating enzymes and might be involved in reversing ubiquitination by substratespecific cleavage of ubiquitin moieties[1].

== Sequence ==
ATGGCAGGAGGAGCTGCACGAGCGGGCGGTGCAGCCGGCAACTTGGCGAGCGGGCAGAGG
AGGAGGGACGGGCGCCGGGGGAGGGAGCAGGCGGAGGAGGACGGAGCGGCATCGGGGGAG
GGAGCAGGAAGAGGAGGAGGGACGGACGCCGTGGGAGGGAGCAGACGGAGGAGGAGGAAC
GGGCGGCCAGTGGCGGAGCCGAGCAGGAGGCGGAAGGAGCTAATGCCATTCGCTCCATCA
AAGTGGGATGGATTAGTCCAGCCGATTTTGGCGGACCACCTCGTCCTGGATCTGGGAAGA
ATATTCCCATCTAGGATCATCCCGTCCTACACATCCCTCTACCCAAACAGCTCGAAAAAT
AGGATCGACCTAACCCATCTCATTCCATATCCCACTAACCAAACACAAGCTAAAAGTCTC
ACCCTAACCTTATAA
[http://www.ncbi.nlm.nih.gov/nucgss/52396942]

==Reference ==
1.Jianfeng Weng; Suhai Gu; Xiangyuan Wan; He Gao1; Tao Guo; Ning Su; Cailin Lei; Xin Zhang; Zhijun Cheng; Xiuping Guo; Jiulin Wang; Ling Jiang; Huqu Zhai; Jianmin Wan. 2008. Isolation and initial characterization of GW5, a major QTL associated with rice grain width and weight. Cell Research, 18(12): 1199-1209.

CL971152

2014-06-09T07:32:48Z

Qwjiayouacomeon: /* Function */

== Function ==

CL971152, GW5, on rice chromosome 5, controls rice grain width and weight, encodes a novel nuclear protein of 144 amino acids that is localized to the nucleus. GW5 represents a major QTL underlying rice width and weight, and that it likely acts in the ubiquitin-proteasome pathway to regulate cell division during seed development[1].GW5 is associated with rice domestication. The GW5 gene was mapped to an interval between markers RM3328 and RMw513 in 805 homozygotes, the GW5 gene was mapped to a genomic region 2.7 cM in length, located 2.3 cM from RM3328 and 0.37 cM from RMw513. GW5 is associated with a 1 212-bp deletion in the Asominori. GW5 protein may play an important role in regulating the grain shape through involvement with the ubiquitin-proteasome pathway cultivar.GW5 occurred in the wide-grain lines, including most japonica and a few indica rice, whereas GW5 was present in the slender-grain rice, including most indica and a few japonica rice cultivars. GW2 and GW5 in controlling seed development. GW5 may work together with GW2 in targeted degradation of certain substrates that promote cell division and grain growth. GW5 may also work together with the deubiquitinating enzymes and might be involved in reversing ubiquitination by substratespecific cleavage of ubiquitin moieties[1].

==Reference ==
1.Jianfeng Weng; Suhai Gu; Xiangyuan Wan; He Gao1; Tao Guo; Ning Su; Cailin Lei; Xin Zhang; Zhijun Cheng; Xiuping Guo; Jiulin Wang; Ling Jiang; Huqu Zhai; Jianmin Wan. 2008. Isolation and initial characterization of GW5, a major QTL associated with rice grain width and weight. Cell Research, 18(12): 1199-1209.

CL971152

2014-06-09T07:32:28Z

Qwjiayouacomeon: /* Sequence */

== Function ==

CL971152, GW5, on rice chromosome 5, controls rice grain width and weight, encodes a novel nuclear protein of 144 amino acids that is localized to the nucleus. GW5 represents a major QTL underlying rice width and weight, and that it likely acts in the ubiquitin-proteasome pathway to regulate cell division during seed development[1].GW5 is associated with rice domestication. The GW5 gene was mapped to an interval between markers RM3328 and RMw513 in 805 homozygotes, the GW5 gene was mapped to a genomic region 2.7 cM in length, located 2.3 cM from RM3328 and 0.37 cM from RMw513. GW5 is associated with a 1 212-bp deletion in the Asominori. GW5 protein may play an important role in regulating the grain shape through involvement with the ubiquitin-proteasome pathway cultivar.GW5 occurred in the wide-grain lines, including most japonica and a few indica rice, whereas GW5 was present in the slender-grain rice, including most indica and a few japonica rice cultivars [Figure1 Figure 2]. GW2 and GW5 in controlling seed development. GW5 may work together with GW2 in targeted degradation of certain substrates that promote cell division and grain growth. GW5 may also work together with the deubiquitinating enzymes and might be involved in reversing ubiquitination by substratespecific cleavage of ubiquitin moieties[1].

==Reference ==
1.Jianfeng Weng; Suhai Gu; Xiangyuan Wan; He Gao1; Tao Guo; Ning Su; Cailin Lei; Xin Zhang; Zhijun Cheng; Xiuping Guo; Jiulin Wang; Ling Jiang; Huqu Zhai; Jianmin Wan. 2008. Isolation and initial characterization of GW5, a major QTL associated with rice grain width and weight. Cell Research, 18(12): 1199-1209.

CL971152

2014-06-09T01:46:34Z

Qwjiayouacomeon: /* Function */

== Function ==

CL971152, GW5, on rice chromosome 5, controls rice grain width and weight, encodes a novel nuclear protein of 144 amino acids that is localized to the nucleus. GW5 represents a major QTL underlying rice width and weight, and that it likely acts in the ubiquitin-proteasome pathway to regulate cell division during seed development[1].GW5 is associated with rice domestication. The GW5 gene was mapped to an interval between markers RM3328 and RMw513 in 805 homozygotes, the GW5 gene was mapped to a genomic region 2.7 cM in length, located 2.3 cM from RM3328 and 0.37 cM from RMw513. GW5 is associated with a 1 212-bp deletion in the Asominori. GW5 protein may play an important role in regulating the grain shape through involvement with the ubiquitin-proteasome pathway cultivar.GW5 occurred in the wide-grain lines, including most japonica and a few indica rice, whereas GW5 was present in the slender-grain rice, including most indica and a few japonica rice cultivars [Figure1 Figure 2]. GW2 and GW5 in controlling seed development. GW5 may work together with GW2 in targeted degradation of certain substrates that promote cell division and grain growth. GW5 may also work together with the deubiquitinating enzymes and might be involved in reversing ubiquitination by substratespecific cleavage of ubiquitin moieties[1].

== Sequence ==

ATGGCAGGAGGAGCTGCACGAGCGGGCGGTGCAGCCGGCAACTTGGCGAGCGGGCAGAGG
AGGAGGGACGGGCGCCGGGGGAGGGAGCAGGCGGAGGAGGACGGAGCGGCATCGGGGGAG
GGAGCAGGAAGAGGAGGAGGGACGGACGCCGTGGGAGGGAGCAGACGGAGGAGGAGGAAC
GGGCGGCCAGTGGCGGAGCCGAGCAGGAGGCGGAAGGAGCTAATGCCATTCGCTCCATCA
AAGTGGGATGGATTAGTCCAGCCGATTTTGGCGGACCACCTCGTCCTGGATCTGGGAAGA
ATATTCCCATCTAGGATCATCCCGTCCTACACATCCCTCTACCCAAACAGCTCGAAAAAT
AGGATCGACCTAACCCATCTCATTCCATATCCCACTAACCAAACACAAGCTAAAAGTCTC
ACCCTAACCTTATAA

==Reference ==
1.Jianfeng Weng; Suhai Gu; Xiangyuan Wan; He Gao1; Tao Guo; Ning Su; Cailin Lei; Xin Zhang; Zhijun Cheng; Xiuping Guo; Jiulin Wang; Ling Jiang; Huqu Zhai; Jianmin Wan. 2008. Isolation and initial characterization of GW5, a major QTL associated with rice grain width and weight. Cell Research, 18(12): 1199-1209.

CL971152

2014-06-07T05:07:03Z

Qwjiayouacomeon: /* Function */

== Function ==

CL971152, GW5, on rice chromosome 5, controls rice grain width and weight, encodes a novel nuclear protein of 144 amino acids that is localized to the nucleus. GW5 represents a major QTL underlying rice width and weight, and that it likely acts in the ubiquitin-proteasome pathway to regulate cell division during seed development[1].GW5 is associated with rice domestication. The GW5 gene was mapped to an interval between markers RM3328 and RMw513 in 805 homozygotes, the GW5 gene was mapped to a genomic region 2.7 cM in length, located 2.3 cM from RM3328 and 0.37 cM from RMw513. GW5 is associated with a 1 212-bp deletion in the Asominori. GW5 protein may play an important role in regulating the grain shape through involvement with the ubiquitin-proteasome pathway cultivar.GW5 occurred in the wide-grain lines, including most japonica and a few indica rice, whereas GW5 was present in the slender-grain rice, including most indica and a few japonica rice cultivars [Figure1 Figure 2]. GW2 and GW5 in controlling seed development. GW5 may work together with GW2 in targeted degradation of certain substrates that promote cell division and grain growth. GW5 may also work together with the deubiquitinating enzymes and might be involved in reversing ubiquitination by substratespecific cleavage of ubiquitin moieties[1].

==Reference ==
1.Jianfeng Weng; Suhai Gu; Xiangyuan Wan; He Gao1; Tao Guo; Ning Su; Cailin Lei; Xin Zhang; Zhijun Cheng; Xiuping Guo; Jiulin Wang; Ling Jiang; Huqu Zhai; Jianmin Wan. 2008. Isolation and initial characterization of GW5, a major QTL associated with rice grain width and weight. Cell Research, 18(12): 1199-1209.

CL971152

2014-06-07T05:05:31Z

Qwjiayouacomeon: /* Function */

== Function ==

CL971152, GW5, on rice chromosome 5, controls rice grain width and weight, encodes a novel nuclear protein of 144 amino acids that is localized to the nucleus.
CL971152 represents a major QTL underlying rice width and weight, and that it likely acts in the ubiquitin-proteasome pathway to regulate cell division during seed
development[1].GW5 is associated with rice domestication. The GW5 gene was mapped to an interval between markers RM3328 and RMw513 in 805 homozygotes, the GW5 gene was mapped to a genomic region 2.7 cM in length, located 2.3 cM from RM3328 and 0.37 cM from RMw513. GW5 is associated with a 1 212-bp deletion in the Asominori. GW5 protein may play an important role in regulating the grain shape through involvement with the ubiquitin-proteasome pathway cultivar.GW5 occurred in the wide-grain lines, including most japonica and a few indica rice, whereas GW5 was present in the slender-grain rice, including most indica and a few japonica rice cultivars [Figure1 Figure 2]. GW2 and GW5 in controlling seed development. GW5 may work together with GW2 in targeted degradation of certain substrates that promote cell division and grain growth. GW5 may also work together with the deubiquitinating enzymes and might be involved in reversing ubiquitination by substratespecific cleavage of ubiquitin moieties[1].

==Reference ==
1.Jianfeng Weng; Suhai Gu; Xiangyuan Wan; He Gao1; Tao Guo; Ning Su; Cailin Lei; Xin Zhang; Zhijun Cheng; Xiuping Guo; Jiulin Wang; Ling Jiang; Huqu Zhai; Jianmin Wan. 2008. Isolation and initial characterization of GW5, a major QTL associated with rice grain width and weight. Cell Research, 18(12): 1199-1209.

CL971152

2014-06-05T08:57:18Z

Qwjiayouacomeon: /* Function */

== Function ==

CL971152 encodes a novel nuclear protein of 144 amino acids that is localized to the nucleus. CL971152 represents a major QTL underlying rice width and weight, and
that it likely acts in the ubiquitin-proteasome pathway to regulate cell division during seed development[1].

==Reference ==
1.Jianfeng Weng; Suhai Gu; Xiangyuan Wan; He Gao1; Tao Guo; Ning Su; Cailin Lei; Xin Zhang; Zhijun Cheng; Xiuping Guo; Jiulin Wang; Ling Jiang; Huqu Zhai; Jianmin Wan. 2008. Isolation and initial characterization of GW5, a major QTL associated with rice grain width and weight. Cell Research, 18(12): 1199-1209.

CL971152

2014-06-05T08:48:02Z

Qwjiayouacomeon: Created page with " == Function == CL971152 encodes a novel nuclear protein of 144 amino acids that is localized to the nucleus. CL971152 represents a major QTL underlying rice width and weigh..."

== Function ==

CL971152 encodes a novel nuclear protein of 144 amino acids that is localized to the nucleus. CL971152 represents a major QTL underlying rice width and weight, and that it likely acts in the ubiquitin-proteasome pathway to regulate cell division during seed development[1].

==Reference ==
1.Jianfeng Weng; Suhai Gu; Xiangyuan Wan; He Gao1; Tao Guo; Ning Su; Cailin Lei; Xin Zhang; Zhijun Cheng; Xiuping Guo; Jiulin Wang; Ling Jiang; Huqu Zhai; Jianmin Wan. 2008. Isolation and initial characterization of GW5, a major QTL associated with rice grain width and weight. Cell Research, 18(12): 1199-1209.