RiceWiki - User contributions [en]

File:Expression pattern of OsC6.jpg

2014-06-01T13:29:55Z

Zhaocf:

Expression pattern of OsC6. A, Spatial and temporal expression analyses of OsC6 by qRT-PCR. Rice Actin1 (OsActin1) expression was used as a control. Total RNA was isolated from rice tissues: root, shoot, leaf, glume, lemma, palea, pistil at stage 13, and anthers at various stages (St 8, stage 8; St 9, stage 9; St 10, stage 10; St 11, stage 11; St 13, stage 13). B, GUS expression in anthers at stage 10 of wild-type (WT; left) and tdr (right) background. C, GUS expression was visible in immature anthers at different stages (from stage 8 to stage 13). D, GUS expression (arrowhead) in the tapetal cells at stage 10. The section was counterstained by Safranin O. E to H, In situ analyses of OsC6. E, A wild-type anther at stage 8 showing no OsC6 expression. F, A wild-type anther at stage 10 showing stronger OsC6 expression in tapetal cells. G, The expression of OsC6 decreased at stage 11. H, Successive section to that shown in F, probed with the OsC6 sense probe. A, Anther; E, epidermis; L, lemma; Msp, microspore; P, palea; T, tapetum; Tds, tetrads. Bars = 2 mm in B, 100 mm in C, and 20 mm in D to H.

File:Expression pattern of OsC6.jpg

2014-06-01T13:26:02Z

Zhaocf: Expression pattern of OsC6. A, Spatial and temporal expression analyses of OsC6 by qRT-PCR. Rice Actin1 (OsActin1) expression was used as a control. Total RNA was isolated from rice tissues: root, shoot, leaf, glume, lemma, palea, pistil at stage 13, and

Expression pattern of OsC6. A, Spatial and temporal expression
analyses of OsC6 by qRT-PCR. Rice Actin1 (OsActin1) expression
was used as a control. Total RNA was isolated from rice tissues: root,
shoot, leaf, glume, lemma, palea, pistil at stage 13, and anthers at
various stages (St 8, stage 8; St 9, stage 9; St 10, stage 10; St 11, stage 11;
St 13, stage 13). B, GUS expression in anthers at stage 10 of wild-type
(WT; left) and tdr (right) background. C, GUS expression was visible in
immature anthers at different stages (from stage 8 to stage 13). D, GUS
expression (arrowhead) in the tapetal cells at stage 10. The section was
counterstained by Safranin O. E to H, In situ analyses of OsC6. E, A
wild-type anther at stage 8 showing no OsC6 expression. F, A wild-type
anther at stage 10 showing stronger OsC6 expression in tapetal cells. G,
The expression of OsC6 decreased at stage 11. H, Successive section to
that shown in F, probed with the OsC6 sense probe. A, Anther; E,
epidermis; L, lemma; Msp, microspore; P, palea; T, tapetum; Tds,
tetrads. Bars = 2 mm in B, 100 mm in C, and 20 mm in D to H.

Os11g0582500

2014-06-01T12:30:36Z

Zhaocf: /* References */

Please input one-sentence summary here.

==Annotated Information==
===Function===
The role of a tapetum-specific gene,OsC6, in the formation of pollen exine and orbicules.OsC6 belongs to a unique LTP clade and is regulated by two anther developmental regulators, TDR and GAMYB. The OsC6 protein is secreted into extracellular spaces of the anther, including anther cuticle, anther locule, and the space between the tapetum and middle layer.

===Expression===
OsC6 expression was detectable in anthers starting from early stage 9 of development, high at stage 10, weak at stage 11, and hardly detectable at stage 13 and was not detectable in root, shoot, leaf, and other floral organs. Expression of OsC6 was down-regulated in tdr,which is able to bind to the E-box (5#-CATTTG-3#;2881 to2712bp) within the promoter region of OsC6 (Li et al., 2006).

===Evolution===
Totally, 82 LTP genes from Arabidopsis, rice, Zea mays, Triticum aestivum, Sorghum bicolor, Vitis vinifera, and Ricinus communis were obtained (Supplemental Table S1). In addition, reported members of the LTP1 subfamily, including OsLTP1(Cheng et al., 2004), AtLTP1 (Thoma et al., 1994), and AtLTP2 (Clark and Bohnert, 1999), the LTP2 subfamily, including OsLTP2 (Samuel et al., 2002) and TaLTP2 (Douliez et al., 2001), as well as another new subfamily member, AtDIR1 (for defective in induced resistance 1; Maldonado et al., 2002), were used for analysis. The phylogenetic tree of these genes was constructed using the characteristic eight-Cys
motif of plant LTPs (C…C…CC…CXC…C…C, where X represents any amino acid) as described by Boutrot et al. (2008; Supplemental Fig. S1). The phylogenetic tree showed that OsC6 was not classified into the LTP1 or LTP2 subfamily, and OsC6 and TAAK330179 (from T. aestivum) were closely grouped with relatively strong support (Fig. 1C, gray clade). A gene from S. bicolor (SBXM002446579) and two genes (AC206507.3FGP004 and GRMZM2G414620) from Z. mays were grouped in the OsC6 clade with relatively lower support (Fig. 1C). Nevertheless, no LTP members from dicots were found to be close to the OsC6 clade, implying that OsC6 likely represents a diversified LTP in monocots.

==Labs working on this gene==
School of Life Science and Biotechnology (Das.Z., W.L., C.Y., J.Z., F.G., Dab.Z.) and Bio-X Research Center,
Key Laboratory of Genetics and Development and Neuropsychiatric Diseases, Ministry of Education (Dab.Z.),
Shanghai Jiao Tong University, Shanghai 200240, China

==References==
Dasheng Zhang;Wanqi Liang;Changsong Yin;Jie Zong;Fangwei Gu;Dabing Zhang
OsC6, Encoding a Lipid Transfer Protein, Is Required for Postmeiotic Anther Development In Rice
Plant Physiology, 2010, 154(1): 149-162

==Structured Information==
{{JaponicaGene|
GeneName = OsC6|
Description = Similar to Anther specific protein|
Version = NM_001074690.1 GI:115486028 GeneID:4350790|
Length = 1584 bp|
Definition = Oryza sativa Japonica Group Os11g0582500, complete gene.|
Source = Oryza sativa Japonica Group

ORGANISM Oryza sativa Japonica Group
Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
Spermatophyta; Magnoliophyta; Liliopsida; Poales; Poaceae; BEP
clade; Ehrhartoideae; Oryzeae; Oryza.
|
Chromosome = [[:category:Japonica Chromosome 11|Chromosome 11]]|
AP = Chromosome 11:23859388..23860971|
CDS = 23859461..23859815,23860411..23860454|
GCID = <gbrowseImage1>
name=NC_008404:23859388..23860971
source=RiceChromosome11
preset=GeneLocation
</gbrowseImage1>|
GSID = <gbrowseImage2>
name=NC_008404:23859388..23860971
source=RiceChromosome11
preset=GeneLocation
</gbrowseImage2>|
CDNA = <cdnaseq>atggcgccgtccaagtccacagccgccgccggcgtcctcctcgtcctgctcgtcgcggcggcgggcggcggcgcagaggcggcggcgacgacgtgcgtggcgtcgctgctggagctgagcccgtgcctgccgttcttcaaggacaaggcggcgacggcggcgccggaggggtgctgcgcggggctgtcgtccatcgtgaagggggaggcggtgtgcctgtgccacatcgtgaaccacaccctggagcgcgccatcggcgtcgacatccccgtcgaccgcgccttcgccctcctccgcgacgtctgccgcctctcgccgccggcggacatcatctccacctgcgccaacgagaaaggtggtgtgccgcctctctactcttgcccggctccatctgcctga</cdnaseq>|
AA = <aaseq>MAPSKSTAAAGVLLVLLVAAAGGGAEAAATTCVASLLELSPCLP FFKDKAATAAPEGCCAGLSSIVKGEAVCLCHIVNHTLERAIGVDIPVDRAFALLRDVC RLSPPADIISTCANEKGGVPPLYSCPAPSA</aaseq>|
DNA = <dnaseqindica>74..428#1024..1067#acacacactcccatcactccaattaaccaaagctaattaagctagctcaagctctaatccacatttagctagaatggcgccgtccaagtccacagccgccgccggcgtcctcctcgtcctgctcgtcgcggcggcgggcggcggcgcagaggcggcggcgacgacgtgcgtggcgtcgctgctggagctgagcccgtgcctgccgttcttcaaggacaaggcggcgacggcggcgccggaggggtgctgcgcggggctgtcgtccatcgtgaagggggaggcggtgtgcctgtgccacatcgtgaaccacaccctggagcgcgccatcggcgtcgacatccccgtcgaccgcgccttcgccctcctccgcgacgtctgccgcctctcgccgccggcggacatcatctccacctgcgccaacgagaaaggtaaaatcaatcaacgcgccgcgccgtggcgtggcgtggcgtgtgcagaagtccaatgcagacggttttcgaatcatctaagttgactctacgtctgtaataatataacactcgtctccgtaaattaaattctcaatttctgaatttttgttttgccgcgcgctgggctccctctcttgtttaaaatccaagagataggcataggcccaatacagggtttaaaatttcggtccaaaacttccgaaaattccaaaatttgggaatttaggatcctcccctctcatgcaactatttcatccaaaatttttagatttttaaaaatatttatgaatctggttaaaattagttgaattcagtcaaaatgtgtttaaatttcaaaatgtttcgttcgaaatttctgaattttgatacacccgattttttttgtccattttggaagtacaaagcccggggccaaacgaatgtccaaatgatcaagtttaaaatctcagttctaactaggactttgtttatttatagatttatatgttttaaaagtgcaacgttgagtagtgctaattaactaatgtacatatcatgattgacttgtgtgtaggtggtgtgccgcctctctactcttgcccggctccatctgcctgaggtaaaccgtcgtcaaccacaaaattatttccacaaaagagcctataaccatgctaaatttctacagtaactactcatataattcagctgttttgtttatattttttttaggggagctgttttgtttataatgacaagtgctttttaattcatgcagtatatatgagaaaagaataaatgttaccaaaggagggatttcaacatatctaaaagtcaagatggagtaactttggtatacaagaccaacatatatatcacgttgttaaaggacaagtagatattggattattggcatatactgatatatccatgctaatattagtatatgtatattctgcaacatgcatggacatacacattgtcaaatgaagtactaagtaacacggaacgtgtactagctcgtgctactgtcgtgctatgcgctgtcaatagaaataaaatattttacattgtggtattaagcattaaagccatattgtattctaatattatcgggcggagattgcggattattcct</dnaseqindica>|
Link = [http://www.ncbi.nlm.nih.gov/nuccore/NM_001074690.1 RefSeq:Os11g0582500]|
}}
[[Category:Genes]]
[[Category:Japonica mRNA]]
[[Category:Oryza Sativa Japonica Group]]
[[Category:Japonica Genes]]
[[Category:Japonica Chromosome 11]]
[[Category:Chromosome 11]]

Os11g0582500

2014-06-01T12:29:43Z

Zhaocf: /* Labs working on this gene */

Please input one-sentence summary here.

==Annotated Information==
===Function===
The role of a tapetum-specific gene,OsC6, in the formation of pollen exine and orbicules.OsC6 belongs to a unique LTP clade and is regulated by two anther developmental regulators, TDR and GAMYB. The OsC6 protein is secreted into extracellular spaces of the anther, including anther cuticle, anther locule, and the space between the tapetum and middle layer.

===Expression===
OsC6 expression was detectable in anthers starting from early stage 9 of development, high at stage 10, weak at stage 11, and hardly detectable at stage 13 and was not detectable in root, shoot, leaf, and other floral organs. Expression of OsC6 was down-regulated in tdr,which is able to bind to the E-box (5#-CATTTG-3#;2881 to2712bp) within the promoter region of OsC6 (Li et al., 2006).

===Evolution===
Totally, 82 LTP genes from Arabidopsis, rice, Zea mays, Triticum aestivum, Sorghum bicolor, Vitis vinifera, and Ricinus communis were obtained (Supplemental Table S1). In addition, reported members of the LTP1 subfamily, including OsLTP1(Cheng et al., 2004), AtLTP1 (Thoma et al., 1994), and AtLTP2 (Clark and Bohnert, 1999), the LTP2 subfamily, including OsLTP2 (Samuel et al., 2002) and TaLTP2 (Douliez et al., 2001), as well as another new subfamily member, AtDIR1 (for defective in induced resistance 1; Maldonado et al., 2002), were used for analysis. The phylogenetic tree of these genes was constructed using the characteristic eight-Cys
motif of plant LTPs (C…C…CC…CXC…C…C, where X represents any amino acid) as described by Boutrot et al. (2008; Supplemental Fig. S1). The phylogenetic tree showed that OsC6 was not classified into the LTP1 or LTP2 subfamily, and OsC6 and TAAK330179 (from T. aestivum) were closely grouped with relatively strong support (Fig. 1C, gray clade). A gene from S. bicolor (SBXM002446579) and two genes (AC206507.3FGP004 and GRMZM2G414620) from Z. mays were grouped in the OsC6 clade with relatively lower support (Fig. 1C). Nevertheless, no LTP members from dicots were found to be close to the OsC6 clade, implying that OsC6 likely represents a diversified LTP in monocots.

==Labs working on this gene==
School of Life Science and Biotechnology (Das.Z., W.L., C.Y., J.Z., F.G., Dab.Z.) and Bio-X Research Center,
Key Laboratory of Genetics and Development and Neuropsychiatric Diseases, Ministry of Education (Dab.Z.),
Shanghai Jiao Tong University, Shanghai 200240, China

==References==
Please input cited references here.

==Structured Information==
{{JaponicaGene|
GeneName = OsC6|
Description = Similar to Anther specific protein|
Version = NM_001074690.1 GI:115486028 GeneID:4350790|
Length = 1584 bp|
Definition = Oryza sativa Japonica Group Os11g0582500, complete gene.|
Source = Oryza sativa Japonica Group

ORGANISM Oryza sativa Japonica Group
Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
Spermatophyta; Magnoliophyta; Liliopsida; Poales; Poaceae; BEP
clade; Ehrhartoideae; Oryzeae; Oryza.
|
Chromosome = [[:category:Japonica Chromosome 11|Chromosome 11]]|
AP = Chromosome 11:23859388..23860971|
CDS = 23859461..23859815,23860411..23860454|
GCID = <gbrowseImage1>
name=NC_008404:23859388..23860971
source=RiceChromosome11
preset=GeneLocation
</gbrowseImage1>|
GSID = <gbrowseImage2>
name=NC_008404:23859388..23860971
source=RiceChromosome11
preset=GeneLocation
</gbrowseImage2>|
CDNA = <cdnaseq>atggcgccgtccaagtccacagccgccgccggcgtcctcctcgtcctgctcgtcgcggcggcgggcggcggcgcagaggcggcggcgacgacgtgcgtggcgtcgctgctggagctgagcccgtgcctgccgttcttcaaggacaaggcggcgacggcggcgccggaggggtgctgcgcggggctgtcgtccatcgtgaagggggaggcggtgtgcctgtgccacatcgtgaaccacaccctggagcgcgccatcggcgtcgacatccccgtcgaccgcgccttcgccctcctccgcgacgtctgccgcctctcgccgccggcggacatcatctccacctgcgccaacgagaaaggtggtgtgccgcctctctactcttgcccggctccatctgcctga</cdnaseq>|
AA = <aaseq>MAPSKSTAAAGVLLVLLVAAAGGGAEAAATTCVASLLELSPCLP FFKDKAATAAPEGCCAGLSSIVKGEAVCLCHIVNHTLERAIGVDIPVDRAFALLRDVC RLSPPADIISTCANEKGGVPPLYSCPAPSA</aaseq>|
DNA = <dnaseqindica>74..428#1024..1067#acacacactcccatcactccaattaaccaaagctaattaagctagctcaagctctaatccacatttagctagaatggcgccgtccaagtccacagccgccgccggcgtcctcctcgtcctgctcgtcgcggcggcgggcggcggcgcagaggcggcggcgacgacgtgcgtggcgtcgctgctggagctgagcccgtgcctgccgttcttcaaggacaaggcggcgacggcggcgccggaggggtgctgcgcggggctgtcgtccatcgtgaagggggaggcggtgtgcctgtgccacatcgtgaaccacaccctggagcgcgccatcggcgtcgacatccccgtcgaccgcgccttcgccctcctccgcgacgtctgccgcctctcgccgccggcggacatcatctccacctgcgccaacgagaaaggtaaaatcaatcaacgcgccgcgccgtggcgtggcgtggcgtgtgcagaagtccaatgcagacggttttcgaatcatctaagttgactctacgtctgtaataatataacactcgtctccgtaaattaaattctcaatttctgaatttttgttttgccgcgcgctgggctccctctcttgtttaaaatccaagagataggcataggcccaatacagggtttaaaatttcggtccaaaacttccgaaaattccaaaatttgggaatttaggatcctcccctctcatgcaactatttcatccaaaatttttagatttttaaaaatatttatgaatctggttaaaattagttgaattcagtcaaaatgtgtttaaatttcaaaatgtttcgttcgaaatttctgaattttgatacacccgattttttttgtccattttggaagtacaaagcccggggccaaacgaatgtccaaatgatcaagtttaaaatctcagttctaactaggactttgtttatttatagatttatatgttttaaaagtgcaacgttgagtagtgctaattaactaatgtacatatcatgattgacttgtgtgtaggtggtgtgccgcctctctactcttgcccggctccatctgcctgaggtaaaccgtcgtcaaccacaaaattatttccacaaaagagcctataaccatgctaaatttctacagtaactactcatataattcagctgttttgtttatattttttttaggggagctgttttgtttataatgacaagtgctttttaattcatgcagtatatatgagaaaagaataaatgttaccaaaggagggatttcaacatatctaaaagtcaagatggagtaactttggtatacaagaccaacatatatatcacgttgttaaaggacaagtagatattggattattggcatatactgatatatccatgctaatattagtatatgtatattctgcaacatgcatggacatacacattgtcaaatgaagtactaagtaacacggaacgtgtactagctcgtgctactgtcgtgctatgcgctgtcaatagaaataaaatattttacattgtggtattaagcattaaagccatattgtattctaatattatcgggcggagattgcggattattcct</dnaseqindica>|
Link = [http://www.ncbi.nlm.nih.gov/nuccore/NM_001074690.1 RefSeq:Os11g0582500]|
}}
[[Category:Genes]]
[[Category:Japonica mRNA]]
[[Category:Oryza Sativa Japonica Group]]
[[Category:Japonica Genes]]
[[Category:Japonica Chromosome 11]]
[[Category:Chromosome 11]]

Os11g0582500

2014-06-01T12:28:51Z

Zhaocf: /* Structured Information */

Please input one-sentence summary here.

==Annotated Information==
===Function===
The role of a tapetum-specific gene,OsC6, in the formation of pollen exine and orbicules.OsC6 belongs to a unique LTP clade and is regulated by two anther developmental regulators, TDR and GAMYB. The OsC6 protein is secreted into extracellular spaces of the anther, including anther cuticle, anther locule, and the space between the tapetum and middle layer.

===Expression===
OsC6 expression was detectable in anthers starting from early stage 9 of development, high at stage 10, weak at stage 11, and hardly detectable at stage 13 and was not detectable in root, shoot, leaf, and other floral organs. Expression of OsC6 was down-regulated in tdr,which is able to bind to the E-box (5#-CATTTG-3#;2881 to2712bp) within the promoter region of OsC6 (Li et al., 2006).

===Evolution===
Totally, 82 LTP genes from Arabidopsis, rice, Zea mays, Triticum aestivum, Sorghum bicolor, Vitis vinifera, and Ricinus communis were obtained (Supplemental Table S1). In addition, reported members of the LTP1 subfamily, including OsLTP1(Cheng et al., 2004), AtLTP1 (Thoma et al., 1994), and AtLTP2 (Clark and Bohnert, 1999), the LTP2 subfamily, including OsLTP2 (Samuel et al., 2002) and TaLTP2 (Douliez et al., 2001), as well as another new subfamily member, AtDIR1 (for defective in induced resistance 1; Maldonado et al., 2002), were used for analysis. The phylogenetic tree of these genes was constructed using the characteristic eight-Cys
motif of plant LTPs (C…C…CC…CXC…C…C, where X represents any amino acid) as described by Boutrot et al. (2008; Supplemental Fig. S1). The phylogenetic tree showed that OsC6 was not classified into the LTP1 or LTP2 subfamily, and OsC6 and TAAK330179 (from T. aestivum) were closely grouped with relatively strong support (Fig. 1C, gray clade). A gene from S. bicolor (SBXM002446579) and two genes (AC206507.3FGP004 and GRMZM2G414620) from Z. mays were grouped in the OsC6 clade with relatively lower support (Fig. 1C). Nevertheless, no LTP members from dicots were found to be close to the OsC6 clade, implying that OsC6 likely represents a diversified LTP in monocots.

==Labs working on this gene==
Please input related labs here.

==References==
Please input cited references here.

==Structured Information==
{{JaponicaGene|
GeneName = OsC6|
Description = Similar to Anther specific protein|
Version = NM_001074690.1 GI:115486028 GeneID:4350790|
Length = 1584 bp|
Definition = Oryza sativa Japonica Group Os11g0582500, complete gene.|
Source = Oryza sativa Japonica Group

ORGANISM Oryza sativa Japonica Group
Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
Spermatophyta; Magnoliophyta; Liliopsida; Poales; Poaceae; BEP
clade; Ehrhartoideae; Oryzeae; Oryza.
|
Chromosome = [[:category:Japonica Chromosome 11|Chromosome 11]]|
AP = Chromosome 11:23859388..23860971|
CDS = 23859461..23859815,23860411..23860454|
GCID = <gbrowseImage1>
name=NC_008404:23859388..23860971
source=RiceChromosome11
preset=GeneLocation
</gbrowseImage1>|
GSID = <gbrowseImage2>
name=NC_008404:23859388..23860971
source=RiceChromosome11
preset=GeneLocation
</gbrowseImage2>|
CDNA = <cdnaseq>atggcgccgtccaagtccacagccgccgccggcgtcctcctcgtcctgctcgtcgcggcggcgggcggcggcgcagaggcggcggcgacgacgtgcgtggcgtcgctgctggagctgagcccgtgcctgccgttcttcaaggacaaggcggcgacggcggcgccggaggggtgctgcgcggggctgtcgtccatcgtgaagggggaggcggtgtgcctgtgccacatcgtgaaccacaccctggagcgcgccatcggcgtcgacatccccgtcgaccgcgccttcgccctcctccgcgacgtctgccgcctctcgccgccggcggacatcatctccacctgcgccaacgagaaaggtggtgtgccgcctctctactcttgcccggctccatctgcctga</cdnaseq>|
AA = <aaseq>MAPSKSTAAAGVLLVLLVAAAGGGAEAAATTCVASLLELSPCLP FFKDKAATAAPEGCCAGLSSIVKGEAVCLCHIVNHTLERAIGVDIPVDRAFALLRDVC RLSPPADIISTCANEKGGVPPLYSCPAPSA</aaseq>|
DNA = <dnaseqindica>74..428#1024..1067#acacacactcccatcactccaattaaccaaagctaattaagctagctcaagctctaatccacatttagctagaatggcgccgtccaagtccacagccgccgccggcgtcctcctcgtcctgctcgtcgcggcggcgggcggcggcgcagaggcggcggcgacgacgtgcgtggcgtcgctgctggagctgagcccgtgcctgccgttcttcaaggacaaggcggcgacggcggcgccggaggggtgctgcgcggggctgtcgtccatcgtgaagggggaggcggtgtgcctgtgccacatcgtgaaccacaccctggagcgcgccatcggcgtcgacatccccgtcgaccgcgccttcgccctcctccgcgacgtctgccgcctctcgccgccggcggacatcatctccacctgcgccaacgagaaaggtaaaatcaatcaacgcgccgcgccgtggcgtggcgtggcgtgtgcagaagtccaatgcagacggttttcgaatcatctaagttgactctacgtctgtaataatataacactcgtctccgtaaattaaattctcaatttctgaatttttgttttgccgcgcgctgggctccctctcttgtttaaaatccaagagataggcataggcccaatacagggtttaaaatttcggtccaaaacttccgaaaattccaaaatttgggaatttaggatcctcccctctcatgcaactatttcatccaaaatttttagatttttaaaaatatttatgaatctggttaaaattagttgaattcagtcaaaatgtgtttaaatttcaaaatgtttcgttcgaaatttctgaattttgatacacccgattttttttgtccattttggaagtacaaagcccggggccaaacgaatgtccaaatgatcaagtttaaaatctcagttctaactaggactttgtttatttatagatttatatgttttaaaagtgcaacgttgagtagtgctaattaactaatgtacatatcatgattgacttgtgtgtaggtggtgtgccgcctctctactcttgcccggctccatctgcctgaggtaaaccgtcgtcaaccacaaaattatttccacaaaagagcctataaccatgctaaatttctacagtaactactcatataattcagctgttttgtttatattttttttaggggagctgttttgtttataatgacaagtgctttttaattcatgcagtatatatgagaaaagaataaatgttaccaaaggagggatttcaacatatctaaaagtcaagatggagtaactttggtatacaagaccaacatatatatcacgttgttaaaggacaagtagatattggattattggcatatactgatatatccatgctaatattagtatatgtatattctgcaacatgcatggacatacacattgtcaaatgaagtactaagtaacacggaacgtgtactagctcgtgctactgtcgtgctatgcgctgtcaatagaaataaaatattttacattgtggtattaagcattaaagccatattgtattctaatattatcgggcggagattgcggattattcct</dnaseqindica>|
Link = [http://www.ncbi.nlm.nih.gov/nuccore/NM_001074690.1 RefSeq:Os11g0582500]|
}}
[[Category:Genes]]
[[Category:Japonica mRNA]]
[[Category:Oryza Sativa Japonica Group]]
[[Category:Japonica Genes]]
[[Category:Japonica Chromosome 11]]
[[Category:Chromosome 11]]

Os11g0582500

2014-06-01T12:28:11Z

Zhaocf: /* Evolution */

Please input one-sentence summary here.

==Annotated Information==
===Function===
The role of a tapetum-specific gene,OsC6, in the formation of pollen exine and orbicules.OsC6 belongs to a unique LTP clade and is regulated by two anther developmental regulators, TDR and GAMYB. The OsC6 protein is secreted into extracellular spaces of the anther, including anther cuticle, anther locule, and the space between the tapetum and middle layer.

===Expression===
OsC6 expression was detectable in anthers starting from early stage 9 of development, high at stage 10, weak at stage 11, and hardly detectable at stage 13 and was not detectable in root, shoot, leaf, and other floral organs. Expression of OsC6 was down-regulated in tdr,which is able to bind to the E-box (5#-CATTTG-3#;2881 to2712bp) within the promoter region of OsC6 (Li et al., 2006).

===Evolution===
Totally, 82 LTP genes from Arabidopsis, rice, Zea mays, Triticum aestivum, Sorghum bicolor, Vitis vinifera, and Ricinus communis were obtained (Supplemental Table S1). In addition, reported members of the LTP1 subfamily, including OsLTP1(Cheng et al., 2004), AtLTP1 (Thoma et al., 1994), and AtLTP2 (Clark and Bohnert, 1999), the LTP2 subfamily, including OsLTP2 (Samuel et al., 2002) and TaLTP2 (Douliez et al., 2001), as well as another new subfamily member, AtDIR1 (for defective in induced resistance 1; Maldonado et al., 2002), were used for analysis. The phylogenetic tree of these genes was constructed using the characteristic eight-Cys
motif of plant LTPs (C…C…CC…CXC…C…C, where X represents any amino acid) as described by Boutrot et al. (2008; Supplemental Fig. S1). The phylogenetic tree showed that OsC6 was not classified into the LTP1 or LTP2 subfamily, and OsC6 and TAAK330179 (from T. aestivum) were closely grouped with relatively strong support (Fig. 1C, gray clade). A gene from S. bicolor (SBXM002446579) and two genes (AC206507.3FGP004 and GRMZM2G414620) from Z. mays were grouped in the OsC6 clade with relatively lower support (Fig. 1C). Nevertheless, no LTP members from dicots were found to be close to the OsC6 clade, implying that OsC6 likely represents a diversified LTP in monocots.

==Labs working on this gene==
Please input related labs here.

==References==
Please input cited references here.

==Structured Information==
{{JaponicaGene|
GeneName = Os11g0582500|
Description = Similar to Anther specific protein|
Version = NM_001074690.1 GI:115486028 GeneID:4350790|
Length = 1584 bp|
Definition = Oryza sativa Japonica Group Os11g0582500, complete gene.|
Source = Oryza sativa Japonica Group

ORGANISM Oryza sativa Japonica Group
Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
Spermatophyta; Magnoliophyta; Liliopsida; Poales; Poaceae; BEP
clade; Ehrhartoideae; Oryzeae; Oryza.
|
Chromosome = [[:category:Japonica Chromosome 11|Chromosome 11]]|
AP = Chromosome 11:23859388..23860971|
CDS = 23859461..23859815,23860411..23860454|
GCID = <gbrowseImage1>
name=NC_008404:23859388..23860971
source=RiceChromosome11
preset=GeneLocation
</gbrowseImage1>|
GSID = <gbrowseImage2>
name=NC_008404:23859388..23860971
source=RiceChromosome11
preset=GeneLocation
</gbrowseImage2>|
CDNA = <cdnaseq>atggcgccgtccaagtccacagccgccgccggcgtcctcctcgtcctgctcgtcgcggcggcgggcggcggcgcagaggcggcggcgacgacgtgcgtggcgtcgctgctggagctgagcccgtgcctgccgttcttcaaggacaaggcggcgacggcggcgccggaggggtgctgcgcggggctgtcgtccatcgtgaagggggaggcggtgtgcctgtgccacatcgtgaaccacaccctggagcgcgccatcggcgtcgacatccccgtcgaccgcgccttcgccctcctccgcgacgtctgccgcctctcgccgccggcggacatcatctccacctgcgccaacgagaaaggtggtgtgccgcctctctactcttgcccggctccatctgcctga</cdnaseq>|
AA = <aaseq>MAPSKSTAAAGVLLVLLVAAAGGGAEAAATTCVASLLELSPCLP FFKDKAATAAPEGCCAGLSSIVKGEAVCLCHIVNHTLERAIGVDIPVDRAFALLRDVC RLSPPADIISTCANEKGGVPPLYSCPAPSA</aaseq>|
DNA = <dnaseqindica>74..428#1024..1067#acacacactcccatcactccaattaaccaaagctaattaagctagctcaagctctaatccacatttagctagaatggcgccgtccaagtccacagccgccgccggcgtcctcctcgtcctgctcgtcgcggcggcgggcggcggcgcagaggcggcggcgacgacgtgcgtggcgtcgctgctggagctgagcccgtgcctgccgttcttcaaggacaaggcggcgacggcggcgccggaggggtgctgcgcggggctgtcgtccatcgtgaagggggaggcggtgtgcctgtgccacatcgtgaaccacaccctggagcgcgccatcggcgtcgacatccccgtcgaccgcgccttcgccctcctccgcgacgtctgccgcctctcgccgccggcggacatcatctccacctgcgccaacgagaaaggtaaaatcaatcaacgcgccgcgccgtggcgtggcgtggcgtgtgcagaagtccaatgcagacggttttcgaatcatctaagttgactctacgtctgtaataatataacactcgtctccgtaaattaaattctcaatttctgaatttttgttttgccgcgcgctgggctccctctcttgtttaaaatccaagagataggcataggcccaatacagggtttaaaatttcggtccaaaacttccgaaaattccaaaatttgggaatttaggatcctcccctctcatgcaactatttcatccaaaatttttagatttttaaaaatatttatgaatctggttaaaattagttgaattcagtcaaaatgtgtttaaatttcaaaatgtttcgttcgaaatttctgaattttgatacacccgattttttttgtccattttggaagtacaaagcccggggccaaacgaatgtccaaatgatcaagtttaaaatctcagttctaactaggactttgtttatttatagatttatatgttttaaaagtgcaacgttgagtagtgctaattaactaatgtacatatcatgattgacttgtgtgtaggtggtgtgccgcctctctactcttgcccggctccatctgcctgaggtaaaccgtcgtcaaccacaaaattatttccacaaaagagcctataaccatgctaaatttctacagtaactactcatataattcagctgttttgtttatattttttttaggggagctgttttgtttataatgacaagtgctttttaattcatgcagtatatatgagaaaagaataaatgttaccaaaggagggatttcaacatatctaaaagtcaagatggagtaactttggtatacaagaccaacatatatatcacgttgttaaaggacaagtagatattggattattggcatatactgatatatccatgctaatattagtatatgtatattctgcaacatgcatggacatacacattgtcaaatgaagtactaagtaacacggaacgtgtactagctcgtgctactgtcgtgctatgcgctgtcaatagaaataaaatattttacattgtggtattaagcattaaagccatattgtattctaatattatcgggcggagattgcggattattcct</dnaseqindica>|
Link = [http://www.ncbi.nlm.nih.gov/nuccore/NM_001074690.1 RefSeq:Os11g0582500]|
}}
[[Category:Genes]]
[[Category:Japonica mRNA]]
[[Category:Oryza Sativa Japonica Group]]
[[Category:Japonica Genes]]
[[Category:Japonica Chromosome 11]]
[[Category:Chromosome 11]]

Os11g0582500

2014-06-01T12:24:15Z

Zhaocf: /* Expression */

Please input one-sentence summary here.

==Annotated Information==
===Function===
The role of a tapetum-specific gene,OsC6, in the formation of pollen exine and orbicules.OsC6 belongs to a unique LTP clade and is regulated by two anther developmental regulators, TDR and GAMYB. The OsC6 protein is secreted into extracellular spaces of the anther, including anther cuticle, anther locule, and the space between the tapetum and middle layer.

===Expression===
OsC6 expression was detectable in anthers starting from early stage 9 of development, high at stage 10, weak at stage 11, and hardly detectable at stage 13 and was not detectable in root, shoot, leaf, and other floral organs. Expression of OsC6 was down-regulated in tdr,which is able to bind to the E-box (5#-CATTTG-3#;2881 to2712bp) within the promoter region of OsC6 (Li et al., 2006).

===Evolution===
Please input evolution information here.

You can also add sub-section(s) at will.

==Labs working on this gene==
Please input related labs here.

==References==
Please input cited references here.

==Structured Information==
{{JaponicaGene|
GeneName = Os11g0582500|
Description = Similar to Anther specific protein|
Version = NM_001074690.1 GI:115486028 GeneID:4350790|
Length = 1584 bp|
Definition = Oryza sativa Japonica Group Os11g0582500, complete gene.|
Source = Oryza sativa Japonica Group

ORGANISM Oryza sativa Japonica Group
Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
Spermatophyta; Magnoliophyta; Liliopsida; Poales; Poaceae; BEP
clade; Ehrhartoideae; Oryzeae; Oryza.
|
Chromosome = [[:category:Japonica Chromosome 11|Chromosome 11]]|
AP = Chromosome 11:23859388..23860971|
CDS = 23859461..23859815,23860411..23860454|
GCID = <gbrowseImage1>
name=NC_008404:23859388..23860971
source=RiceChromosome11
preset=GeneLocation
</gbrowseImage1>|
GSID = <gbrowseImage2>
name=NC_008404:23859388..23860971
source=RiceChromosome11
preset=GeneLocation
</gbrowseImage2>|
CDNA = <cdnaseq>atggcgccgtccaagtccacagccgccgccggcgtcctcctcgtcctgctcgtcgcggcggcgggcggcggcgcagaggcggcggcgacgacgtgcgtggcgtcgctgctggagctgagcccgtgcctgccgttcttcaaggacaaggcggcgacggcggcgccggaggggtgctgcgcggggctgtcgtccatcgtgaagggggaggcggtgtgcctgtgccacatcgtgaaccacaccctggagcgcgccatcggcgtcgacatccccgtcgaccgcgccttcgccctcctccgcgacgtctgccgcctctcgccgccggcggacatcatctccacctgcgccaacgagaaaggtggtgtgccgcctctctactcttgcccggctccatctgcctga</cdnaseq>|
AA = <aaseq>MAPSKSTAAAGVLLVLLVAAAGGGAEAAATTCVASLLELSPCLP FFKDKAATAAPEGCCAGLSSIVKGEAVCLCHIVNHTLERAIGVDIPVDRAFALLRDVC RLSPPADIISTCANEKGGVPPLYSCPAPSA</aaseq>|
DNA = <dnaseqindica>74..428#1024..1067#acacacactcccatcactccaattaaccaaagctaattaagctagctcaagctctaatccacatttagctagaatggcgccgtccaagtccacagccgccgccggcgtcctcctcgtcctgctcgtcgcggcggcgggcggcggcgcagaggcggcggcgacgacgtgcgtggcgtcgctgctggagctgagcccgtgcctgccgttcttcaaggacaaggcggcgacggcggcgccggaggggtgctgcgcggggctgtcgtccatcgtgaagggggaggcggtgtgcctgtgccacatcgtgaaccacaccctggagcgcgccatcggcgtcgacatccccgtcgaccgcgccttcgccctcctccgcgacgtctgccgcctctcgccgccggcggacatcatctccacctgcgccaacgagaaaggtaaaatcaatcaacgcgccgcgccgtggcgtggcgtggcgtgtgcagaagtccaatgcagacggttttcgaatcatctaagttgactctacgtctgtaataatataacactcgtctccgtaaattaaattctcaatttctgaatttttgttttgccgcgcgctgggctccctctcttgtttaaaatccaagagataggcataggcccaatacagggtttaaaatttcggtccaaaacttccgaaaattccaaaatttgggaatttaggatcctcccctctcatgcaactatttcatccaaaatttttagatttttaaaaatatttatgaatctggttaaaattagttgaattcagtcaaaatgtgtttaaatttcaaaatgtttcgttcgaaatttctgaattttgatacacccgattttttttgtccattttggaagtacaaagcccggggccaaacgaatgtccaaatgatcaagtttaaaatctcagttctaactaggactttgtttatttatagatttatatgttttaaaagtgcaacgttgagtagtgctaattaactaatgtacatatcatgattgacttgtgtgtaggtggtgtgccgcctctctactcttgcccggctccatctgcctgaggtaaaccgtcgtcaaccacaaaattatttccacaaaagagcctataaccatgctaaatttctacagtaactactcatataattcagctgttttgtttatattttttttaggggagctgttttgtttataatgacaagtgctttttaattcatgcagtatatatgagaaaagaataaatgttaccaaaggagggatttcaacatatctaaaagtcaagatggagtaactttggtatacaagaccaacatatatatcacgttgttaaaggacaagtagatattggattattggcatatactgatatatccatgctaatattagtatatgtatattctgcaacatgcatggacatacacattgtcaaatgaagtactaagtaacacggaacgtgtactagctcgtgctactgtcgtgctatgcgctgtcaatagaaataaaatattttacattgtggtattaagcattaaagccatattgtattctaatattatcgggcggagattgcggattattcct</dnaseqindica>|
Link = [http://www.ncbi.nlm.nih.gov/nuccore/NM_001074690.1 RefSeq:Os11g0582500]|
}}
[[Category:Genes]]
[[Category:Japonica mRNA]]
[[Category:Oryza Sativa Japonica Group]]
[[Category:Japonica Genes]]
[[Category:Japonica Chromosome 11]]
[[Category:Chromosome 11]]

Os11g0582500

2014-06-01T12:20:36Z

Zhaocf: /* Function */